MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-278I20
Chromosome	11 (Build37)
Map Location	73,071,606 - 73,197,305
singlet/doublet	doublet
Overlap gene	Trpv1, Trpv3, Aspa, Spata22, Olfr20, Olfr376
Upstream gene	Slc13a5, Fbxo39, LOC628100, Tekt1, D130058I21Rik, Ggt6, Mybbp1a, 9830002I17Rik, LOC432577, Ube2g1, Ankfy1, Cyb5d2, Zzef1, LOC627119, Atp2a3, P2rx1, LOC100043309, Camkk1, 1200014J11Rik, Itgae, Gsg2, P2rx5, Tmem93, Tax1bp3, Ctns, Carkl
Downstream gene	Olfr377-ps1, Olfr1, Olfr75-ps1, Olfr378, Olfr379-ps1, Olfr380, Olfr381, Olfr382, Olfr383-ps1, Olfr385, Olfr386, Olfr387-ps1, 1700012C15Rik, Olfr388-ps1, Olfr389, Olfr390, Olfr391-ps1, Olfr392, Olfr393, Olfr394, Olfr395, Olfr396-ps1, Olfr23, Olfr22-ps1, Olfr397, Olfr398, Olfr139, Olfr399, OTTMUSG00000006163, LOC668567, Olfr400-ps1, Olfr401, Olfr402, Olfr403, Olfr43, Olfr404-ps1, Olfr405-ps1, Olfr406, Olfr407-ps1, Olfr59, Olfr408-ps1, Olfr409-ps1, LOC193079, Olfr410, Olfr411, Olfr412, Garnl4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc13a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237831 MGI:3037150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327959 MGI:3505735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins

name	Tekt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21689 MGI:1333819
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D130058I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276829 MGI:2442764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ggt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71522 MGI:1918772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mybbp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18432 MGI:106181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9830002I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77577 MGI:1924827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 607 ESTs, 13 Proteins pseudo : _no_value

name	Ube2g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67128 MGI:1914378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankfy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11736 MGI:1337008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb5d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192986 MGI:2684848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zzef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195018 MGI:2444286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 292 ESTs, 7 Proteins pseudo : _no_value

name	Atp2a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53313 MGI:1194503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18436 MGI:1098235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043309 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Camkk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55984 MGI:1891766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200014J11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66874 MGI:1914124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gsg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14841 MGI:1194498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94045 MGI:2137026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66048 MGI:1913298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tax1bp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76281 MGI:1923531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctns (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83429 MGI:1932872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Carkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74637 MGI:1921887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193034 MGI:1341787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246788 MGI:2181407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aspa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11484 MGI:87914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380709 MGI:2685728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258925 MGI:109315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258924 MGI:3030210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr377-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258226 MGI:3030211
definition	gene_synonym : MOR135-15 note : olfactory receptor 377, pseudogene 1 pseudo : _no_value

name	Olfr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258923 MGI:102698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr75-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258186 MGI:2153204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Olfr378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259026 MGI:3030212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr379-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257942 MGI:3030213
definition	gene_synonym : MOR135-25 note : olfactory receptor 379, pseudogene 1 pseudo : _no_value

name	Olfr380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259027 MGI:3030214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259024 MGI:3030215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258435 MGI:3030216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr383-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258211 MGI:3030217
definition	gene_synonym : MOR135-16P note : olfactory receptor 383, pseudogene 1 pseudo : _no_value

name	Olfr385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259025 MGI:3030219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193053 MGI:3030220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr387-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258210 MGI:3030221
definition	gene_synonym : MOR135-17 note : olfactory receptor 387, pseudogene 1 pseudo : _no_value

name	1700012C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76390 MGI:1923640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Olfr388-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258182 MGI:3030222
definition	gene_synonym : MOR135-22 note : olfactory receptor 388, pseudogene 1 pseudo : _no_value

name	Olfr389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259011 MGI:3030223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr390 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258344 MGI:3030224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr391-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258236 MGI:3030225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2296 Proteins pseudo : _no_value

name	Olfr392 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259008 MGI:3030226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr393 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259010 MGI:3030227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259009 MGI:3030228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259007 MGI:3030229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr396-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258208 MGI:3030230
definition	gene_synonym : MOR135-19 note : olfactory receptor 396, pseudogene 1 pseudo : _no_value

name	Olfr23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18321 MGI:109312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr22-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258209 MGI:109313
definition	gene_synonym : MOR135-18; MTPCR35; Olfr22 note : olfactory receptor 22, pseudogene 1 pseudo : _no_value

name	Olfr397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258343 MGI:3030231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr398 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258705 MGI:3030232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259005 MGI:2177522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr399 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259006 MGI:3030233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000006163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327963 MGI:3650906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 1 Protein

name	LOC668567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 15 Proteins pseudo : _no_value

name	Olfr400-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257876 MGI:3030234
definition	gene_synonym : MOR255-7P note : olfactory receptor 400, pseudogene 1 pseudo : _no_value

name	Olfr401 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258701 MGI:3030235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr402 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258703 MGI:3030236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404316 MGI:3030237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258706 MGI:1333770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr404-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257920 MGI:3030238
definition	gene_synonym : MOR133-5P note : olfactory receptor 404, pseudogene 1 pseudo : _no_value

name	Olfr405-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258128 MGI:3030239
definition	gene_synonym : MOR125-3P note : olfactory receptor 405, pseudogene 1 pseudo : _no_value

name	Olfr406 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258181 MGI:3030240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr407-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258127 MGI:3030241
definition	gene_synonym : MOR125-4P note : olfactory receptor 407, pseudogene 1 pseudo : _no_value

name	Olfr59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18359 MGI:1333755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr408-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258129 MGI:3030242
definition	gene_synonym : MOR125-2P note : olfactory receptor 408, pseudogene 1 pseudo : _no_value

name	Olfr409-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258131 MGI:3030243
definition	gene_synonym : MOR133-2 note : olfactory receptor 409, pseudogene 1 pseudo : _no_value

name	LOC193079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:193079
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	Olfr410 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258702 MGI:3030244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr411 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258704 MGI:3030245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258153 MGI:3030246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Garnl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380711 MGI:3028623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc13a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385951 GeneID:237831 MGI:3037150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 transcript_id : NM_001004148.3

name	Fbxo39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803481 GeneID:327959 MGI:3505735
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 39 transcript_id : NM_001037713.2

name	LOC628100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261980 GeneID:628100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to novel F-box domain containing protein transcript_id : XM_892822.3

name	Tekt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956378 GeneID:21689 MGI:1333819
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tektin 1 transcript_id : NM_011569.2

name	D130058I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130489 GeneID:276829 MGI:2442764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130058I21 gene transcript_id : NM_177776.3

name	Ggt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647221 GeneID:71522 MGI:1918772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-glutamyltransferase 6 transcript_id : NM_027819.2

name	Mybbp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982723 GeneID:18432 MGI:106181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYB binding protein (P160) 1a transcript_id : NM_016776.2

name	9830002I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366352 GeneID:77577 MGI:1924827
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9830002I17 gene transcript_id : NM_029932.2

name	Ube2g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292440 GeneID:67128 MGI:1914378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans) transcript_id : NM_025985.4

name	Ankfy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130294 GeneID:11736 MGI:1337008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and FYVE domain containing 1 transcript_id : NM_009671.5

name	Cyb5d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972403 GeneID:192986 MGI:2684848
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 domain containing 2 transcript_id : NM_001024926.1

name	Zzef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865904 GeneID:195018 MGI:2444286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, ZZ-type with EF hand domain 1 transcript_id : NM_001045536.1

name	Atp2a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542158 GeneID:53313 MGI:1194503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, ubiquitous transcript_id : NM_016745.2

name	P2rx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560658 GeneID:18436 MGI:1098235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 1 transcript_id : NM_008771.2

name	LOC100043309 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261984 GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043309 transcript_id : XM_001480517.1

name	Camkk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922602 GeneID:55984 MGI:1891766
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase kinase 1, alpha transcript_id : NM_018883.2

name	1200014J11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802919 GeneID:66874 MGI:1914124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200014J11 gene transcript_id : NM_025818.2

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680481 GeneID:16407 MGI:1298377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_008399.1

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227222 GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_172944.2

name	Gsg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106328 GeneID:14841 MGI:1194498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-specific gene 2 transcript_id : NM_010353.1

name	P2rx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349156 GeneID:94045 MGI:2137026
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 5 transcript_id : NM_033321.2

name	Tmem93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354019 GeneID:66048 MGI:1913298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 93 transcript_id : NM_025318.2

name	Tax1bp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803240 GeneID:76281 MGI:1923531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tax1 (human T-cell leukemia virus type I) binding protein 3 transcript_id : NM_029564.2

name	Ctns (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354408 GeneID:83429 MGI:1932872
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystinosis, nephropathic transcript_id : NM_031251.3

name	Carkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286807 GeneID:74637 MGI:1921887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate kinase-like transcript_id : NM_029031.3

name	Trpv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47825363 GeneID:193034 MGI:1341787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 1 transcript_id : NM_001001445.1

name	Trpv3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21492637 GeneID:246788 MGI:2181407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 3 transcript_id : NM_145099.1

name	Aspa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354273 GeneID:11484 MGI:87914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartoacylase (aminoacylase) 2 transcript_id : NM_023113.4

name	Spata22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865896 GeneID:380709 MGI:2685728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 22 transcript_id : NM_001045531.1

name	Olfr20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239301 GeneID:258925 MGI:109315
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 20 transcript_id : NM_146923.1

name	Olfr376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239303 GeneID:258924 MGI:3030210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 376 transcript_id : NM_146922.1

name	Olfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129048 GeneID:258923 MGI:102698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1 transcript_id : NM_146921.1

name	Olfr378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128892 GeneID:259026 MGI:3030212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 378 transcript_id : NM_147024.1

name	Olfr380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128894 GeneID:259027 MGI:3030214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 380 transcript_id : NM_147025.1

name	Olfr381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583634 GeneID:259024 MGI:3030215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 381 transcript_id : NM_147022.2

name	Olfr382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239297 GeneID:258435 MGI:3030216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 382 transcript_id : NM_146443.1

name	Olfr385 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239299 GeneID:259025 MGI:3030219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 385 transcript_id : NM_147023.1

name	Olfr386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402198 GeneID:193053 MGI:3030220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 386 transcript_id : NM_207224.1

name	1700012C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390200 GeneID:76390 MGI:1923640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 1700012C15 gene transcript_id : XM_111107.7

name	Olfr389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735421 GeneID:259011 MGI:3030223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 389 transcript_id : NM_147009.2

name	Olfr390 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129603 GeneID:258344 MGI:3030224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 390 transcript_id : NM_146347.1

name	Olfr392 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128926 GeneID:259008 MGI:3030226
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 392 transcript_id : NM_147006.1

name	Olfr393 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128920 GeneID:259010 MGI:3030227
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 393 transcript_id : NM_147008.1

name	Olfr394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128928 GeneID:259009 MGI:3030228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 394 transcript_id : NM_147007.1

name	Olfr395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128932 GeneID:259007 MGI:3030229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 395 transcript_id : NM_147005.1

name	Olfr23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66472355 GeneID:18321 MGI:109312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 23 transcript_id : NM_010970.1

name	Olfr397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129609 GeneID:258343 MGI:3030231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 397 transcript_id : NM_146346.1

name	Olfr398 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129414 GeneID:258705 MGI:3030232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 398 transcript_id : NM_146710.1

name	Olfr139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208855 GeneID:259005 MGI:2177522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 139 transcript_id : NM_147003.1

name	Olfr399 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128930 GeneID:259006 MGI:3030233
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 399 transcript_id : NM_147004.1

name	OTTMUSG00000006163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390202 GeneID:327963 MGI:3650906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 1 Protein product : predicted gene, OTTMUSG00000006163 transcript_id : XM_282967.5

name	Olfr401 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129424 GeneID:258701 MGI:3030235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 401 transcript_id : NM_146706.1

name	Olfr402 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129418 GeneID:258703 MGI:3030236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 402 transcript_id : NM_146708.1

name	Olfr403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518539 GeneID:404316 MGI:3030237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 403 transcript_id : NM_207622.1

name	Olfr43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239309 GeneID:258706 MGI:1333770
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 43 transcript_id : NM_146711.1

name	Olfr406 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801481 GeneID:258181 MGI:3030240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 406 transcript_id : NM_001011863.1

name	Olfr59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828658 GeneID:18359 MGI:1333755
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 59 transcript_id : NM_011002.1

name	Olfr410 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129426 GeneID:258702 MGI:3030244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 410 transcript_id : NM_146707.1

name	Olfr411 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129420 GeneID:258704 MGI:3030245
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 411 transcript_id : NM_146709.1

name	Olfr412 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801459 GeneID:258153 MGI:3030246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 412 transcript_id : NM_001011851.1

name	Garnl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517293 GeneID:380711 MGI:3028623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase activating RANGAP domain-like 4 transcript_id : NM_001015046.2

name	Slc13a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921291 CCDS:CCDS24983.1 GeneID:237831 MGI:3037150
definition	GO_component : GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0015137 - citrate transporter activity [Evidence IDA]; GO:0015141 - succinate transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA]; GO:0015142 - tricarboxylic acid transporter activity [Evidence IDA] GO_process : GO:0015746 - citrate transport [Evidence IDA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0015744 - succinate transport [Evidence IDA]; GO:0006842 - tricarboxylic acid transport [Evidence IDA] codon_start : 1 note : sodium-coupled citrate transporter; novel solute carrier family 13 (sodium-dependent dicarboxylate transporter) (Slc13a2 or 3) member product : solute carrier family 13 (sodium-dependent citrate transporter), member 5 protein_id : NP_001004148.1

name	Fbxo39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702282 CCDS:CCDS24984.1 GeneID:327959 MGI:3505735
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : F-box protein 38; novel TRAF-type zinc finger protein product : F-box protein 39 protein_id : NP_001032802.1

name	LOC628100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261981 GeneID:628100
definition	codon_start : 1 product : similar to novel F-box domain containing protein protein_id : XP_897915.3

name	Tekt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956379 GeneID:21689 MGI:1333819
definition	GO_component : GO:0005874 - microtubule [Evidence IDA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : tektin 1 protein_id : NP_035699.2

name	D130058I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244296 CCDS:CCDS24985.1 GeneID:276829 MGI:2442764
definition	codon_start : 1 product : hypothetical protein LOC276829 protein_id : NP_808444.1

name	Ggt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647222 GeneID:71522 MGI:1918772
definition	GO_function : GO:0003840 - gamma-glutamyltransferase activity [Evidence IEA] codon_start : 1 product : gamma-glutamyltransferase 6 protein_id : NP_082095.2

name	Mybbp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982724 CCDS:CCDS24986.1 GeneID:18432 MGI:106181
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0042564 - NLS-dependent protein nuclear import complex [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence TAS] GO_process : GO:0006118 - electron transport [Evidence IDA]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear protein P160; myb-binding protein 1a product : MYB binding protein (P160) 1a protein_id : NP_058056.2

name	9830002I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037493 CCDS:CCDS24987.1 GeneID:77577 MGI:1924827
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015520 - tetracycline:hydrogen antiporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015904 - tetracycline transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77577 protein_id : NP_084208.1

name	Ube2g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754105 GeneID:67128 MGI:1914378
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2G 1 protein_id : NP_080261.2

name	Ankfy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702366 CCDS:CCDS24989.1 GeneID:11736 MGI:1337008
definition	GO_component : GO:0010008 - endosome membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence NAS] codon_start : 1 note : ankyrin repeat hooked to zinc finger motif; ankyrin repeat hooked to a zinc finger motif short form; Rabankyrin-5 product : ankyrin repeat and FYVE domain containing 1 protein_id : NP_033801.4

name	Cyb5d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972404 CCDS:CCDS24990.1 GeneID:192986 MGI:2684848
definition	codon_start : 1 exception : mismatches in translation product : cytochrome b5 domain containing 2 protein_id : NP_001020097.1

name	Zzef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865905 GeneID:195018 MGI:2444286
definition	GO_component : GO:0005680 - anaphase-promoting complex [Evidence IEA]; GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030071 - regulation of mitotic metaphase/anaphase transition [Evidence IEA] codon_start : 1 note : KIAA0399-like protein human product : zinc finger, ZZ-type with EF hand domain 1 protein_id : NP_001039001.1

name	Atp2a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542159 CCDS:CCDS24991.1 GeneID:53313 MGI:1194503
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sarcoendoplasmic reticulum Ca2+ ATPase; sarcoendoplasmic reticulum Ca2+ ATPase type 3 SERCA3 product : ATPase, Ca++ transporting, ubiquitous protein_id : NP_058025.2

name	P2rx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560659 CCDS:CCDS24992.1 GeneID:18436 MGI:1098235
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P2X1 receptor; programmed cell death 3 product : purinergic receptor P2X1 protein_id : NP_032797.2

name	LOC100043309 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261985 GeneID:100043309
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480567.1

name	Camkk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922603 CCDS:CCDS24993.1 GeneID:55984 MGI:1891766
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004683 - calmodulin regulated protein kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : calcium calmodulin dependent protein kinase kinase alpha product : calcium/calmodulin-dependent protein kinase kinase 1, alpha protein_id : NP_061371.2

name	1200014J11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229010 CCDS:CCDS24994.1 GeneID:66874 MGI:1914124
definition	codon_start : 1 exception : mismatches in translation product : ELG protein protein_id : NP_080094.2

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680482 CCDS:CCDS24995.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation function : adhesion receptor note : isoform 1 is encoded by transcript variant 1; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 1 protein_id : NP_032425.1

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370456 CCDS:CCDS24996.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 2 protein_id : NP_766532.1

name	Gsg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106329 CCDS:CCDS24997.1 GeneID:14841 MGI:1194498
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP] codon_start : 1 note : haploid germ cell-specific nuclear protein kinase product : germ cell-specific gene 2 protein_id : NP_034483.1

name	P2rx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15277325 CCDS:CCDS24998.1 GeneID:94045 MGI:2137026
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC] GO_function : GO:0004931 - ATP-gated cation channel activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : purinergic receptor P2X5 protein_id : NP_201578.1

name	Tmem93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384684 CCDS:CCDS24999.1 GeneID:66048 MGI:1913298
definition	codon_start : 1 product : hypothetical protein LOC66048 protein_id : NP_079594.1

name	Tax1bp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313140 CCDS:CCDS25000.1 GeneID:76281 MGI:1923531
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IMP] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : Tax1 (human T-cell leukemia virus type I) binding protein 3 protein_id : NP_083840.1

name	Ctns (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752577 CCDS:CCDS25001.1 GeneID:83429 MGI:1932872
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cystinosis, nephropathic protein_id : NP_112541.1

name	Carkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095001 CCDS:CCDS25002.1 GeneID:74637 MGI:1921887
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 product : carbohydrate kinase-like protein_id : NP_083307.1

name	Trpv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47825364 CCDS:CCDS25003.1 GeneID:193034 MGI:1341787
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IMP]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence ISS]; GO:0008324 - cation transporter activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0009408 - response to heat [Evidence IDA] [Evidence IMP]; GO:0009268 - response to pH [Evidence IMP] [Evidence IDA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0050955 - thermoception [Evidence IDA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vanilloid receptor subtype 1; capsaicin receptor; cation channel; transient receptor potential cation channel V1; novel protein, ortholog of human and rat transient receptor potential cation channel, subfamily V, member 1 TRPV1 product : transient receptor potential cation channel, subfamily V, member 1 protein_id : NP_001001445.1

name	Trpv3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21492638 CCDS:CCDS25004.1 GeneID:246788 MGI:2181407
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0009266 - response to temperature stimulus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRP ion channel TRPV3; non-hair product : transient receptor potential cation channel, subfamily V, member 3 protein_id : NP_659567.1

name	Aspa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560279 CCDS:CCDS25005.1 GeneID:11484 MGI:87914
definition	GO_function : GO:0004046 - aminoacylase activity [Evidence TAS] [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0006083 - acetate metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : aminoacylase 2; aspartoacylase product : aspartoacylase (aminoacylase) 2 protein_id : NP_075602.2

name	Spata22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865897 GeneID:380709 MGI:2685728
definition	codon_start : 1 product : testes development-related NYD-SP20 protein_id : NP_001038996.1

name	Olfr20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239302 CCDS:CCDS25006.1 GeneID:258925 MGI:109315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor 21; GA_x6K02T2P1NL-3514066-3515010 product : olfactory receptor 20 protein_id : NP_667134.1

name	Olfr376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239304 CCDS:CCDS25007.1 GeneID:258924 MGI:3030210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3535075-3536028; olfactory receptor MOR135-12 product : olfactory receptor 376 protein_id : NP_667133.1

name	Olfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129049 CCDS:CCDS25008.1 GeneID:258923 MGI:102698
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3556334-3555390; olfactory receptor MOR135-13 product : olfactory receptor 1 protein_id : NP_667132.1

name	Olfr378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128893 CCDS:CCDS25009.1 GeneID:259026 MGI:3030212
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3586282-3585338; olfactory receptor MOR135-2; odorant receptor product : olfactory receptor 378 protein_id : NP_667235.1

name	Olfr380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128895 CCDS:CCDS25010.1 GeneID:259027 MGI:3030214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3613021-3612086; olfactory receptor MOR135-1 product : olfactory receptor 380 protein_id : NP_667236.1

name	Olfr381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583635 CCDS:CCDS25011.1 GeneID:259024 MGI:3030215
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3646409-3645474; olfactory receptor MOR135-4 product : olfactory receptor 381 protein_id : NP_667233.2

name	Olfr382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239298 CCDS:CCDS25012.1 GeneID:258435 MGI:3030216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3676608-3675670; MOR135-31_p; olfactory receptor MOR135-14 product : olfactory receptor 382 protein_id : NP_666654.1

name	Olfr385 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239300 CCDS:CCDS25013.1 GeneID:259025 MGI:3030219
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3760313-3759375; olfactory receptor MOR135-3 product : olfactory receptor 385 protein_id : NP_667234.1

name	Olfr386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402199 CCDS:CCDS25014.1 GeneID:193053 MGI:3030220
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2P1NL-3773152-3774090; novel olfactory receptor family MOR135 member product : olfactory receptor 386 protein_id : NP_997107.1

name	1700012C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390201 GeneID:76390 MGI:1923640
definition	codon_start : 1 product : hypothetical protein LOC76390 protein_id : XP_111107.7

name	Olfr389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735422 CCDS:CCDS25015.1 GeneID:259011 MGI:3030223
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3932085-3931147; olfactory receptor MOR135-6 product : olfactory receptor 389 protein_id : NP_667220.2

name	Olfr390 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129604 CCDS:CCDS25016.1 GeneID:258344 MGI:3030224
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3938806-3939741; olfactory receptor MOR135-26 product : olfactory receptor 390 protein_id : NP_666459.1

name	Olfr392 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128927 CCDS:CCDS25017.1 GeneID:259008 MGI:3030226
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-3966976-3966038; olfactory receptor MOR135-9 product : olfactory receptor 392 protein_id : NP_667217.1

name	Olfr393 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128921 CCDS:CCDS25018.1 GeneID:259010 MGI:3030227
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4004140-4003208; olfactory receptor MOR135-7 product : olfactory receptor 393 protein_id : NP_667219.1

name	Olfr394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128929 CCDS:CCDS25019.1 GeneID:259009 MGI:3030228
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4043306-4042374; olfactory receptor MOR135-8 product : olfactory receptor 394 protein_id : NP_667218.1

name	Olfr395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128933 CCDS:CCDS25020.1 GeneID:259007 MGI:3030229
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4062605-4061667; olfactory receptor MOR135-10 product : olfactory receptor 395 protein_id : NP_667216.1

name	Olfr23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66472356 GeneID:18321 MGI:109312
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR135-27; GA_x6K02T2P1NL-4097159-4098136 product : olfactory receptor 23 protein_id : NP_035100.1

name	Olfr397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129610 CCDS:CCDS25021.1 GeneID:258343 MGI:3030231
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4121434-4122381; olfactory receptor MOR135-28 product : olfactory receptor 397 protein_id : NP_666458.1

name	Olfr398 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129415 CCDS:CCDS25022.1 GeneID:258705 MGI:3030232
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4141430-4140486; olfactory receptor MOR157-1 product : olfactory receptor 398 protein_id : NP_666921.1

name	Olfr139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208856 CCDS:CCDS25023.1 GeneID:259005 MGI:2177522
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4202012-4201065; olfactory receptor MOR255-2 product : olfactory receptor 139 protein_id : NP_667214.1

name	Olfr399 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128931 CCDS:CCDS25024.1 GeneID:259006 MGI:3030233
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-4211516-4210581; olfactory receptor MOR255-1 product : olfactory receptor 399 protein_id : NP_667215.1

name	OTTMUSG00000006163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390203 GeneID:327963 MGI:3650906
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_282967.4

name	Olfr401 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129425 CCDS:CCDS25025.1 GeneID:258701 MGI:3030235
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4278037-4278984; olfactory receptor MOR255-6 product : olfactory receptor 401 protein_id : NP_666917.1

name	Olfr402 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129419 CCDS:CCDS25026.1 GeneID:258703 MGI:3030236
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4307199-4308146; olfactory receptor MOR255-4 product : olfactory receptor 402 protein_id : NP_666919.1

name	Olfr403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518540 CCDS:CCDS25027.1 GeneID:404316 MGI:3030237
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007608 - sensory perception of smell [Evidence ISS] codon_start : 1 note : GA_x6K02T2P1NL-4348188-4349129; olfactory receptor 43 product : olfactory receptor 403 protein_id : NP_997505.1

name	Olfr43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239310 CCDS:CCDS25028.1 GeneID:258706 MGI:1333770
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-4359899-4358958; olfactory receptor MOR125-1; olfactory receptor 403 product : olfactory receptor 43 protein_id : NP_666922.1

name	Olfr406 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801482 GeneID:258181 MGI:3030240
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4415162-4416133; olfactory receptor MOR133-1 product : olfactory receptor 406 protein_id : NP_001011863.1

name	Olfr59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828659 CCDS:CCDS25029.1 GeneID:18359 MGI:1333755
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR133-3P; GA_x6K02T2P1NL-4434429-4435400 product : olfactory receptor 59 protein_id : NP_035132.1

name	Olfr410 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129427 CCDS:CCDS25030.1 GeneID:258702 MGI:3030244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4467421-4466474; olfactory receptor MOR255-5 product : olfactory receptor 410 protein_id : NP_666918.1

name	Olfr411 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129421 GeneID:258704 MGI:3030245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2P1NL-4481525-4480578; olfactory receptor MOR255-3; olfactory receptor MOR255-6 product : olfactory receptor 411 protein_id : NP_666920.1

name	Olfr412 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801460 CCDS:CCDS25031.1 GeneID:258153 MGI:3030246
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4500587-4501525; olfactory receptor MOR127-5P product : olfactory receptor 412 protein_id : NP_001011851.1

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 3 pseudo : _no_value

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 2 pseudo : _no_value

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 1 pseudo : _no_value

name	LOC432577 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261982 GeneID:432577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 607 ESTs, 13 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_034718.1

name	LOC627119 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261983 GeneID:627119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 292 ESTs, 7 Proteins product : similar to Signal recognition particle receptor (docking protein) pseudo : _no_value transcript_id : XR_034726.1

name	Olfr75-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872150 GeneID:258186 MGI:2153204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 75, pseudogene 1 pseudo : _no_value transcript_id : NR_002859.1

name	LOC668567 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261932 GeneID:668567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 15 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_033528.1

clone name	MSMg01-491M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-140I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-069P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-475F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-218A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-146N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-278I20.b	B6Ng01-278I20.g
ACC	GA078766	GA078767
length	954	970
definition	B6Ng01-278I20.b	B6Ng01-278I20.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(73,071,606 - 73,072,557)	(73,196,343 - 73,197,305)
sequence	gaattcaggggagaaaggccagggaaggaaggtgggaactggaaggacta ggaagtgtgtgggagcttcagtgaatggcttctctactggtataacaagt cgaactgagctgaacttatagttcgttgtgggtagctctcaggcaggttc actgacctcacaggagggggtcagtggaatcacaaggctgggctgaggca aggcttcctaaaggggtgtgggtagatcttcaatgtgatggtgggggtac aaataaggttatattataaccttattttgtgattttagggccctgtaggt gggacttagaaccagtggtcagttttgagaatcctgaactaggagctggc tttgtccagcgttttgtgtgggcttttgaaagcgagggctcctgatcaga agagaagggtggggatctcttggcccaggccatcttgcctttgttccaaa ccctctggcctaacacttggtattagaatatgatggatggtgatgggaac ctcagctacctctggagaccctggaactggctaggtcaacagttcccaaa ctgggtgtctctacttcctagccaattagtccagatctcaacaggcagtg gtaactgagtcttccttaagagctccctggaactttaggtcatgccaaag ttcttatttgaagcccagtgtcaccatgtctcccttggcattttcttcta tgccctggtggggccttgactctaagtcttgatgttttttggctgctgtt catcactttaggattgcccaatgtggagttgtgttgcagaaatctcttta ccctctcatttgggcagagaggcaataaagcctgaagcaggtgtgagata gactccatgaattatcaggtttaccagggcctgggggagaaaggaagtat aaactggttgatgagctcaactgtcaaagaagaaagaaaatttcatgggt ttaa	gaattctttgactgcttagggtggaggcagggataagcagcaggttgtaa ctcaatcaagataccatttggtgggatgggactgaagctgggagggagat aaaaaagtgtcttttgtgaggttatcaggaactaatttttatggcctgcc ataattgtctgtgacctctgattaccttttctctatgatttaaatgtgag gccttaatcttctttgagtttgttatttctttaaggtcccaagaacaggc acttggagagttcaaccatttatcagagggagagctagtttttggtgaca cagaggcagggaggctgtcttaagctagcatctgactcctctgggtgttt gcattaaggggggttttatgggcagtacaattctaagaccagattgggtt cccttggaatgaccagggagaggaagggagccctgagcttgctgcaaggg gacgcagcatggaaaccaactgcctgcatattgcacttgccacagaaggg agggaagatgggaacttttgctggaggaaacaacacagaggcaaaccgtc tatacacaacactggagtctctttggtgaggcttctaagaagcaggaaaa taaaccacagagagttagcatcagtaatttggaggctataatagatctat ttctaattttctggggaacctccagattgatttccagagtgattgtacca gtttgcaatcccaccaacaatggaggagtgttcctctttctacaatcctc tcccaacatgttgttgtcacctgaggttttgatcttagccattctgattt gtataaaggcagaattctcagggttcatttgtatttgcattcttctaatc actaacggactttgaacatttctttaaggtacttctcagcctctggagat tcccctgttgtgaatcctcagtttagtttataccctaatttttttattgg gtggctcagggattttttta
quality values	Open. Hide. 58 36 23 38 58 34 25 54 54 49 62 47 42 49 62 62 62 47 41 47 39 62 43 35 41 62 62 62 62 62 56 47 47 49 49 62 44 62 59 62 62 62 59 62 62 62 59 43 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 49 54 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 39 62 62 62 62 62 54 62 62 62 62 52 62 62 52 62 62 62 62 62 62 62 62 52 62 43 62 62 62 62 62 58 54 58 58 54 58 58 54 54 54 58 54 58 52 52 58 58 58 58 58 58 58 45 49 54 58 58 49 54 58 58 52 58 54 54 58 58 45 52 58 58 58 58 52 52 48 52 58 58 35 58 47 58 58 58 58 58 41 41 54 58 54 58 54 54 52 58 54 49 54 58 49 54 49 53 58 51 50 50 40 49 51 58 58 40 50 51 50 50 48 58 48 47 32 54 28 53 39 52 52 49 58 43 49 40 47 58 39 46 38 58 41 40 42 49 50 49 33 51 58 51 51 40 54 58 46 32 36 41 41 36 39 53 58 50 50 54 54 41 52 58 50 50 40 40 53 52 52 32 40 52 34 53 53 50 53 49 50 58 51 52 41 47 44 25 37 53 58 58 35 39 36 32 46 27 37 31 51 24 14 39 32 50 21 13 28 51 54 44 31 51 32 47 51 38 37 40 40 42 25 53 31 52 33 24 22 42 42 31 25 13 51 51 51 44 15 44 49 27 40 35 27 27 42 41 31 53 30 45 40 31 45 53 54 44 31 30 52 53 31 37 34 33 53 48 33 23 21 51 31 34 51 51 21 13 46 47 32 12 8 33 12 31 31 11 25 40 31 39 37 31 33 25 51 31 30 30 25 27 31 30 24 31 32 45 46 31 27 51 30 31 39 27 42 23 30 31 31 24 16 33 24 32 46 31 26 33 46 31 42 29 33 21 30 18 18 20 13 19 30 31 31 13 20 13 22 14 9 6 13 7 25 9 16 30 33 31 29 34 32 31 30 11 10 34 18 48 33 8 11 39 29 14 31 25 11 32 30 31 41 44 44 17 16 6 16 31 20 13 31 15 23 8 9 21 26 24 32 19 18 15 31 20 13 8 10 43 21 19 29 10 18 13 42 18 10 10 24 37 15 31 28 36 15 6 11 14 5 7 29 6 8 13 37 32 11 23 30 20 25 10 22 29 13 5 4 5 5 7 7	Open. Hide. 62 49 39 41 62 62 62 62 62 62 47 47 56 49 46 56 54 47 56 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 59 59 62 62 54 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 62 62 62 62 62 54 47 44 43 37 51 56 36 44 62 62 62 62 62 62 62 62 54 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 51 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 47 62 62 62 62 62 62 56 62 62 62 62 62 62 56 56 62 47 49 62 47 62 62 62 47 62 62 62 62 52 47 22 62 62 52 62 62 54 52 62 62 62 62 47 62 62 62 54 38 62 62 62 48 43 52 62 62 43 62 54 43 54 23 58 58 54 54 52 58 58 58 54 54 47 53 53 53 52 46 54 42 58 49 54 49 58 58 58 54 35 54 54 47 54 54 58 52 58 54 34 52 47 25 38 47 52 52 54 52 42 45 26 58 58 42 54 52 47 58 54 58 58 35 35 52 54 49 52 47 41 42 38 52 58 38 45 52 47 38 41 46 52 50 46 46 39 41 50 46 31 54 45 42 58 52 53 51 51 40 40 32 41 39 48 50 50 28 38 42 49 42 52 41 58 34 47 29 19 58 40 58 44 54 50 46 36 58 58 50 53 37 42 53 53 52 40 30 40 52 32 52 53 50 46 58 54 46 27 17 12 51 26 54 53 41 26 34 51 28 20 33 41 29 21 52 51 33 39 36 6 24 36 39 58 21 24 39 32 16 14 26 30 39 38 51 31 29 28 32 52 21 43 35 22 13 42 46 30 26 44 52 49 37 27 29 45 23 38 49 32 52 39 34 24 8 54 15 39 35 52 26 29 19 6 15 47 38 37 38 22 28 23 52 37 42 33 53 40 21 12 49 49 22 29 33 26 53 39 34 32 20 34 54 31 53 30 30 35 34 32 39 32 35 33 20 18 11 8 47 15 29 32 25 23 8 15 32 6 19 31 30 39 20 27 47 36 6 10 11 23 31 47 21 35 21 29 34 51 42 45 31 24 30 33 10 23 10 18 9 14 38 33 33 21 31 31 31 34 28 11 11 25 12 38 51 32 24 31 31 27 21 31 46 35 33 19 37 28 10 10 27 29 17 31 17 12 25 38 32 34 31 15 31 31 21 37 9 8 23 21 18 31 29 30 34 42 42 32 16 31 15 27 29 8 10 12 7 29 11 30 33 18 33 11 25 47 37 42 29 44 30 31 31 32 31 22 37 25 11 20 31 29 18 18 32 25 28 31 12 6 17 31 30 28 13 11 16 10 9 25 9 14 36 7 36 13 29 36 32 30 32 10 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_73071606_73072557
seq2: B6Ng01-278I20.b_43_996

seq1  GAATTCAGGGGAGAAAGGCCAGGGAAGGAAGGTGGGAACTGGAAGGACTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGGGGAGAAAGGCCAGGGAAGGAAGGTGGGAACTGGAAGGACTA  50

seq1  GGAAGTGTGTGGGAGCTTCAGTGAATGGCTTCTCTACTGGTATAACAAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGTGTGTGGGAGCTTCAGTGAATGGCTTCTCTACTGGTATAACAAGT  100

seq1  CGAACTGAGCTGAACTTATAGTTCGTTGTGGGTAGCTCTCAGGCAGGTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAACTGAGCTGAACTTATAGTTCGTTGTGGGTAGCTCTCAGGCAGGTTC  150

seq1  ACTGACCTCACAGGAGGGGGTCAGTGGAATCACAAGGCTGGGCTGAGGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGACCTCACAGGAGGGGGTCAGTGGAATCACAAGGCTGGGCTGAGGCA  200

seq1  AGGCTTCCTAAAGGGGTGTGGGTAGATCTTCAATGTGATGGTGGGGGTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTTCCTAAAGGGGTGTGGGTAGATCTTCAATGTGATGGTGGGGGTAC  250

seq1  AAATAAGGTTATATTATAACCTTATTTTGTGATTTTAGGGCCCTGTAGGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAGGTTATATTATAACCTTATTTTGTGATTTTAGGGCCCTGTAGGT  300

seq1  GGGACTTAGAACCAGTGGTCAGTTTTGAGAATCCTGAACTAGGAGCTGGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACTTAGAACCAGTGGTCAGTTTTGAGAATCCTGAACTAGGAGCTGGC  350

seq1  TTTGTCCAGCGTTTTGTGTGGGCTTTTGAAAGCGAGGGCTCCTGATCAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTCCAGCGTTTTGTGTGGGCTTTTGAAAGCGAGGGCTCCTGATCAGA  400

seq1  AGAGAAGGGTGGGGATCTCTTGGCCCAGGCCATCTTGCCTTTGTTCCAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAGGGTGGGGATCTCTTGGCCCAGGCCATCTTGCCTTTGTTCCAAA  450

seq1  CCCTCTGGCCTAACACTTGGTATTAGAATATGATGGATGGTGATGGGAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTGGCCTAACACTTGGTATTAGAATATGATGGATGGTGATGGGAAC  500

seq1  CTCAGCTACCTCTGGAGACCCTGGAACTGGCTAGGTCAACAGTTCCCAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGCTACCTCTGGAGACCCTGGAACTGGCTAGGTCAACAGTTCCCAAA  550

seq1  CTGGGTGTCTCTACTTCCTAGCCAATTAGTCCAGATCTCAACAGGCAGTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGTGTCTCTACTTCCTAGCCAATTAGTCCAGATCTCAACAGGCAGTG  600

seq1  GTAACTGAGTCTTCCTTAAGAGCTCCCTGGAACTTTAGGTCATGCCAAAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAACTGAGTCTTCCTTAAGAGCTCCCTGGAACTTTAGGTCATGCCAAAG  650

seq1  TTCTTATTTGAAGCCCAGTGTCACCATGTCTCCCTTGGCATTTTCTTCTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTATTTGAAGCCCAGTGTCACCATGTCTCCCTTGGCATTTTCTTCTA  700

seq1  TGCCCTGGTGGGGCCTTGACTCTAAGTCTTGATGTTTTTTGGCTGCTGTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCCTGGTGGGGCCTTGACTCTAAGTCTTGATGTTTTTTGGCTGCTGTT  750

seq1  CATCACTTTAGGATTGCCCAATGTGGAGTTGTGTTGCAGAAATCTCTTTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCACTTTAGGATTGCCCAATGTGGAGTTGTGTTGCAGAAATCTCTTTA  800

seq1  CCCTCTCATTTGGGCAGAGAGGCAATAAAGCCTGAAGCAGGTGTGAGATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTCATTTGGGCAGAGAGGCAATAAAGCCTGAAGCAGGTGTGAGATA  850

seq1  GACT-CATGAATTATCAGGTTTACCAGGGCCTGGGGGAGAAAGGAAGTAT  899
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCCATGAATTATCAGGTTTACCAGGGCCTGGGGGAGAAAGGAAGTAT  900

seq1  AAACTGGGTGAATGAGCTCAACTGTCAAAGAAG--AGGAAATTTCATGGG  947
      ||||||| || ||||||||||||||||||||||  || ||||||||||||
seq2  AAACTGGTTG-ATGAGCTCAACTGTCAAAGAAGAAAGAAAATTTCATGGG  949

seq1  TCTAA  952
      | |||
seq2  TTTAA  954

seq1: chr11_73196343_73197305
seq2: B6Ng01-278I20.g_66_1035 (reverse)

seq1  TAAAAAAATCCCTGAGCAACCCAATAAAAAAATTA-GGTATAAAACTAAA  49
      ||||||||||||||||| ||||||||||||||||| ||||| ||||||||
seq2  TAAAAAAATCCCTGAGCCACCCAATAAAAAAATTAGGGTAT-AAACTAAA  49

seq1  CTGAGAATTCACAACAGGGGAATCTCCAGAGGCTGAGAAGTACC-TAAAG  98
      ||||| |||||||||||||||||||||||||||||||||||||| |||||
seq2  CTGAGGATTCACAACAGGGGAATCTCCAGAGGCTGAGAAGTACCTTAAAG  99

seq1  AAATGTTCAAAGT-CGTTAGTGATTAGAGAAATGCAAATACAAATG-ACC  146
      ||||||||||||| ||||||||||||||  |||||||||||||||| |||
seq2  AAATGTTCAAAGTCCGTTAGTGATTAGAAGAATGCAAATACAAATGAACC  149

seq1  CTGAG-ATTCTGCC-TTATACAAATCAGAATGGCTAAGATCAAAACCTCA  194
      ||||| |||||||| |||||||||||||||||||||||||||||||||||
seq2  CTGAGAATTCTGCCTTTATACAAATCAGAATGGCTAAGATCAAAACCTCA  199

seq1  GGTGACAAC-ACATGTT-GGAGAGGATTGTAGAAAGAGGAACACTCCTCC  242
      ||||||||| ||||||| ||||||||||||||||||||||||||||||||
seq2  GGTGACAACAACATGTTGGGAGAGGATTGTAGAAAGAGGAACACTCCTCC  249

seq1  ATTGTTGGTGGGATTGCAAACTGGTACAATCACTCTGGAAATCAATCTGG  292
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTGGTGGGATTGCAAACTGGTACAATCACTCTGGAAATCAATCTGG  299

seq1  AGGTTCCCCAGAAAATTAGAAATAGATCTATTATAGCCTCCAAATTACTG  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTCCCCAGAAAATTAGAAATAGATCTATTATAGCCTCCAAATTACTG  349

seq1  ATGCTAACTCTCTGTGGTTTATTTTCCTGCTTCTTAGAAGCCTCACCAAA  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTAACTCTCTGTGGTTTATTTTCCTGCTTCTTAGAAGCCTCACCAAA  399

seq1  GAGACTCCAGTGTTGTGTATAGACGGTTTGCCTCTGTGTTGTTTCCTCCA  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTCCAGTGTTGTGTATAGACGGTTTGCCTCTGTGTTGTTTCCTCCA  449

seq1  GCAAAAGTTCCCATCTTCCCTCCCTTCTGTGGCAAGTGCAATATGCAGGC  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAAGTTCCCATCTTCCCTCCCTTCTGTGGCAAGTGCAATATGCAGGC  499

seq1  AGTTGGTTTCCATGCTGCGTCCCCTTGCAGCAAGCTCAGGGCTCCCTTCC  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGGTTTCCATGCTGCGTCCCCTTGCAGCAAGCTCAGGGCTCCCTTCC  549

seq1  TCTCCCTGGTCATTCCAAGGGAACCCAATCTGGTCTTAGAATTGTACTGC  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCTGGTCATTCCAAGGGAACCCAATCTGGTCTTAGAATTGTACTGC  599

seq1  CCATAAAACCCCCCTTAATGCAAACACCCAGAGGAGTCAGATGCTAGCTT  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATAAAACCCCCCTTAATGCAAACACCCAGAGGAGTCAGATGCTAGCTT  649

seq1  AAGACAGCCTCCCTGCCTCTGTGTCACCAAAAACTAGCTCTCCCTCTGAT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAGCCTCCCTGCCTCTGTGTCACCAAAAACTAGCTCTCCCTCTGAT  699

seq1  AAATGGTTGAACTCTCCAAGTGCCTGTTCTTGGGACCTTAAAGAAATAAC  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGGTTGAACTCTCCAAGTGCCTGTTCTTGGGACCTTAAAGAAATAAC  749

seq1  AAACTCAAAGAAGATTAAGGCCTCACATTTAAATCATAGAGAAAAGGTAA  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCAAAGAAGATTAAGGCCTCACATTTAAATCATAGAGAAAAGGTAA  799

seq1  TCAGAGGTCACAGACAATTATGGCAGGCCATAAAAATTAGTTCCTGATAA  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAGGTCACAGACAATTATGGCAGGCCATAAAAATTAGTTCCTGATAA  849

seq1  CCTCACAAAAGACACTTTTTTATCTCCCTCCCAGCTTCAGTCCCATCCCA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACAAAAGACACTTTTTTATCTCCCTCCCAGCTTCAGTCCCATCCCA  899

seq1  CCAAATGGTATCTTGATTGAGTTACAACCTGCTGCTTATCCCTGCCTCCA  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAATGGTATCTTGATTGAGTTACAACCTGCTGCTTATCCCTGCCTCCA  949

seq1  CCCTAAGCAGTCAAAGAATTC  963
      |||||||||||||||||||||
seq2  CCCTAAGCAGTCAAAGAATTC  970

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information