MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-291E15
Chromosome	11 (Build37)
Map Location	95,579,113 - 95,753,666
singlet/doublet	doublet
Overlap gene	Zfp652, EG665273, Phospho1, Abi3, Gngt2, LOC100040014, B4galnt2
Upstream gene	Cdc34-ps, A430060F13Rik, Tmem92, LOC100039410, LOC544807, LOC544808, LOC665174, LOC432591, LOC100039739, Col1a1, Sgca, Hils1, Ppp1r9b, Samd14, Pdk2, Itga3, Dlx3, Dlx4, LOC100039437, Tac4, Myst2, 5730593F17Rik, Slc35b1, Spop, LOC100039483, Nxph3, Ngfr, Phb, 1110035M17Rik
Downstream gene	Igf2bp1, LOC100040040, Gip, Snf8, Ube2z, Atp5g1, Ndp52, Ttll6, Hoxb13, LOC432593, LOC100039639, Gm53, Hoxb9, Hoxb8, Hoxb7, Hoxb6, Hoxb5, Hoxb4, Hoxb3, Hoxb2, Hoxb1, LOC100040242, OTTMUSG00000001775, Skap1, Snx11, Cbx1, LOC629750, Nfe2l1, Copz2, LOC100040373, LOC665436
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cdc34-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111266 MGI:1858429
definition	note : cell division cycle 34 homolog, pseudogene (S. cerevisiae) pseudo : _no_value

name	A430060F13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217122 MGI:3026970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 98 ESTs, 2 Proteins

name	Tmem92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544806 MGI:3034723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC544807 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC544808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC665174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC432591 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein

name	LOC100039739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Col1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12842 MGI:88467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sgca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20391 MGI:894698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hils1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54388 MGI:2136691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217124 MGI:2387581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Samd14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217125 MGI:2384945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18604 MGI:1343087
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16400 MGI:96602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13393 MGI:94903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13394 MGI:94904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Tac4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93670 MGI:1931130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217127 MGI:2182799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730593F17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215512 MGI:2144564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110172 MGI:1343133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spop (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20747 MGI:1343085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Nxph3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104079 MGI:1336188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngfr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18053 MGI:97323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18673 MGI:97572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110035M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432396 MGI:3044900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	Zfp652 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268469 MGI:2442221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665273 MGI:3644307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Phospho1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237928 MGI:2447348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abi3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66610 MGI:1913860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gngt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14710 MGI:893584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	B4galnt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14422 MGI:1342058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igf2bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140486 MGI:1890357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040040 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Gip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14607 MGI:107504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27681 MGI:1343161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2z (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268470 MGI:1343160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11951 MGI:107653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndp52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76815 MGI:1343177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237930 MGI:2683461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15408 MGI:107730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432593 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC100039639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 889 ESTs, 1 Protein pseudo : _no_value

name	Gm53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193022 MGI:2684899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Hoxb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15417 MGI:96190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15416 MGI:96189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15415 MGI:96188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15414 MGI:96187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15413 MGI:96186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15412 MGI:96185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15410 MGI:96184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hoxb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103889 MGI:96183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15407 MGI:96182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 3 Proteins

name	OTTMUSG00000001775 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038600 MGI:3649352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Skap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78473 MGI:1925723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74479 MGI:1921729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12412 MGI:105369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs, 16 Proteins

name	Nfe2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18023 MGI:99421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56358 MGI:1929008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC665436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Tmem92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360342 GeneID:544806 MGI:3034723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 92 transcript_id : NM_001034896.2

name	LOC100039410 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262380 GeneID:100039410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001472839.1

name	LOC544807 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262396 GeneID:544807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical LOC544807, transcript variant 1 transcript_id : XM_001474160.1

name	LOC544807 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262398 GeneID:544807
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : hypothetical LOC544807, transcript variant 2 transcript_id : XM_001474177.1

name	LOC544808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390825 GeneID:544808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : hypothetical LOC544808, transcript variant 1 transcript_id : XM_618920.3

name	LOC665174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390764 GeneID:665174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical LOC665174 transcript_id : XM_975056.1

name	LOC432591 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262400 GeneID:432591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : hypothetical LOC432591, transcript variant 1 transcript_id : XM_001474263.1

name	LOC432591 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390766 GeneID:432591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : hypothetical LOC432591, transcript variant 2 transcript_id : XM_484066.4

name	LOC100039739 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262402 GeneID:100039739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : hypothetical protein LOC100039739 transcript_id : XM_001474282.1

name	Col1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131144 GeneID:12842 MGI:88467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type I, alpha 1 transcript_id : NM_007742.3

name	Sgca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347930 GeneID:20391 MGI:894698
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sarcoglycan, alpha (dystrophin-associated glycoprotein) transcript_id : NM_009161.2

name	Hils1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055231 GeneID:54388 MGI:2136691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone H1-like protein in spermatids 1 transcript_id : NM_018792.1

name	Ppp1r9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50053702 GeneID:217124 MGI:2387581
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory subunit 9B transcript_id : NM_172261.2

name	Samd14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130977 GeneID:217125 MGI:2384945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterile alpha motif domain containing 14 transcript_id : NM_146025.2

name	Pdk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526815 GeneID:18604 MGI:1343087
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase kinase, isoenzyme 2 transcript_id : NM_133667.1

name	Itga3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328215 GeneID:16400 MGI:96602
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 3 transcript_id : NM_013565.2

name	Dlx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254590 GeneID:13393 MGI:94903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : distal-less homeobox 3 transcript_id : NM_010055.2

name	Dlx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348376 GeneID:13394 MGI:94904
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : distal-less homeobox 4 transcript_id : NM_007867.3

name	LOC100039437 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262384 GeneID:100039437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039437 transcript_id : XM_001472884.1

name	Tac4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716382 GeneID:93670 MGI:1931130
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tachykinin 4 transcript_id : NM_053093.1

name	Myst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341373 GeneID:217127 MGI:2182799
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYST histone acetyltransferase 2 transcript_id : NM_177619.2

name	5730593F17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801972 GeneID:215512 MGI:2144564
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730593F17 gene transcript_id : NM_172543.2

name	Slc35b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949136 GeneID:110172 MGI:1343133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member B1 transcript_id : NM_016752.1

name	Spop (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026916 GeneID:20747 MGI:1343085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : speckle-type POZ protein transcript_id : NM_025287.2

name	LOC100039483 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262388 GeneID:100039483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039483 transcript_id : XM_001472960.1

name	Nxph3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803004 GeneID:104079 MGI:1336188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexophilin 3 transcript_id : NM_130858.3

name	Ngfr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131161 GeneID:18053 MGI:97323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nerve growth factor receptor (TNFR superfamily, member 16) transcript_id : NM_033217.3

name	Phb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431263 GeneID:18673 MGI:97572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prohibitin transcript_id : NM_008831.3

name	1110035M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262390 GeneID:432396 MGI:3044900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : RIKEN cDNA 1110035M17 gene transcript_id : XM_001473055.1

name	Zfp652 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378027 GeneID:268469 MGI:2442221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 652 transcript_id : NM_201609.2

name	EG665273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390767 GeneID:665273 MGI:3644307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG665273 transcript_id : XM_975768.1

name	Phospho1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665717 GeneID:237928 MGI:2447348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase, orphan 1 transcript_id : NM_153104.2

name	Abi3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802686 GeneID:66610 MGI:1913860
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ABI gene family, member 3 transcript_id : NM_025659.2

name	Gngt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461991 GeneID:14710 MGI:893584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 transcript_id : NM_023121.2

name	Gngt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461989 GeneID:14710 MGI:893584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 transcript_id : NM_001038664.2

name	LOC100040014 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262407 GeneID:100040014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040014 transcript_id : XM_001474923.1

name	B4galnt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517711 GeneID:14422 MGI:1342058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,4-N-acetyl-galactosaminyl transferase 2 transcript_id : NM_008081.3

name	Igf2bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129819 GeneID:140486 MGI:1890357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 mRNA binding protein 1 transcript_id : NM_009951.3

name	LOC100040040 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262409 GeneID:100040040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040040 transcript_id : XM_001474953.1

name	Gip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982339 GeneID:14607 MGI:107504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastric inhibitory polypeptide transcript_id : NM_008119.2

name	Snf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802129 GeneID:27681 MGI:1343161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) transcript_id : NM_033568.2

name	Ube2z (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681728 GeneID:268470 MGI:1343160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2Z (putative) transcript_id : NM_172300.3

name	Atp5g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385741 GeneID:11951 MGI:107653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 transcript_id : NM_007506.4

name	Ndp52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802150 GeneID:76815 MGI:1343177
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear domain 10 protein 52 transcript_id : NM_029755.2

name	Ttll6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357013 GeneID:237930 MGI:2683461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 6 transcript_id : NM_172799.2

name	Hoxb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130864 GeneID:15408 MGI:107730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B13 transcript_id : NM_008267.3

name	LOC432593 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262392 GeneID:432593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical gene supported by AK078606 transcript_id : XM_976177.2

name	Gm53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390771 GeneID:193022 MGI:2684899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : gene model 53, (NCBI) transcript_id : XM_112540.4

name	Hoxb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680759 GeneID:15417 MGI:96190
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B9 transcript_id : NM_008270.2

name	Hoxb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709819 GeneID:15416 MGI:96189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B8 transcript_id : NM_010461.2

name	Hoxb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014651 GeneID:15415 MGI:96188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B7 transcript_id : NM_010460.2

name	Hoxb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21886812 GeneID:15414 MGI:96187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B6 transcript_id : NM_008269.1

name	Hoxb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680250 GeneID:15413 MGI:96186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B5 transcript_id : NM_008268.1

name	Hoxb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802912 GeneID:15412 MGI:96185
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B4 transcript_id : NM_010459.5

name	Hoxb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300899 GeneID:15410 MGI:96184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B3 transcript_id : NM_001079869.1

name	Hoxb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300924 GeneID:15410 MGI:96184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B3 transcript_id : NM_010458.2

name	Hoxb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158903 GeneID:103889 MGI:96183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B2 transcript_id : NM_134032.2

name	Hoxb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227197 GeneID:15407 MGI:96182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B1 transcript_id : NM_008266.4

name	LOC100040242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262413 GeneID:100040242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs, 2 Proteins product : similar to Ribosomal protein L17, transcript variant 1 transcript_id : XM_001475389.1

name	LOC100040242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262415 GeneID:100040242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 2 Proteins product : similar to Ribosomal protein L17, transcript variant 2 transcript_id : XM_001475401.1

name	OTTMUSG00000001775 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262419 GeneID:100038600 MGI:3649352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, OTTMUSG00000001775 transcript_id : XM_001475433.1

name	Skap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803165 GeneID:78473 MGI:1925723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src family associated phosphoprotein 1 transcript_id : NM_001033186.2

name	Snx11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357419 GeneID:74479 MGI:1921729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 11 transcript_id : NM_028965.3

name	Cbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606333 GeneID:12412 MGI:105369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 1 (Drosophila HP1 beta) transcript_id : NM_007622.3

name	LOC629750 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262425 GeneID:629750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 33 ESTs, 16 Proteins product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1, transcript variant 1 transcript_id : XM_001475488.1

name	LOC629750 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390841 GeneID:629750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 16 Proteins product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1, transcript variant 2 transcript_id : XM_894675.2

name	Nfe2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982172 GeneID:18023 MGI:99421
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor, erythroid derived 2,-like 1 transcript_id : NM_008686.2

name	Copz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388340 GeneID:56358 MGI:1929008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit zeta 2 transcript_id : NM_019877.2

name	LOC100040373 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262432 GeneID:100040373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040373 transcript_id : XM_001475583.1

name	Tmem92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702254 GeneID:544806 MGI:3034723
definition	codon_start : 1 product : hypothetical protein LOC544806 protein_id : NP_001030068.1

name	LOC100039410 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262381 GeneID:100039410
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472889.1

name	LOC544807 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262397 GeneID:544807
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474210.1

name	LOC544807 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262399 GeneID:544807
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474227.1

name	LOC544808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63617748 GeneID:544808
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_618920.1

name	LOC665174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390765 GeneID:665174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980150.1

name	LOC432591 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51766385 GeneID:432591
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_484066.1

name	LOC432591 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262401 GeneID:432591
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474313.1

name	LOC100039739 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262403 GeneID:100039739
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474332.1

name	Col1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328108 CCDS:CCDS25265.1 GeneID:12842 MGI:88467
definition	GO_component : GO:0005581 - collagen [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005201 - extracellular matrix structural constituent [Evidence IEA]; GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : alpha-1 type I collagen; alpha-1 type 1 collagen product : procollagen, type I, alpha 1 protein_id : NP_031768.2

name	Sgca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677923 CCDS:CCDS25266.1 GeneID:20391 MGI:894698
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0016012 - sarcoglycan complex [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0016044 - membrane organization and biogenesis [Evidence TAS] codon_start : 1 note : sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein); alpha-sarcoglycan product : sarcoglycan, alpha (dystrophin-associated glycoprotein) protein_id : NP_033187.1

name	Hils1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055232 CCDS:CCDS25267.1 GeneID:54388 MGI:2136691
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone H1-like protein in spermatids 1 protein_id : NP_061262.1

name	Ppp1r9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50053703 CCDS:CCDS25268.1 GeneID:217124 MGI:2387581
definition	GO_component : GO:0030864 - cortical actin cytoskeleton [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence TAS]; GO:0007015 - actin filament organization [Evidence IPI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016358 - dendrite development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IMP] codon_start : 1 note : neurabin II; spinophilin product : protein phosphatase 1, regulatory subunit 9B protein_id : NP_758465.2

name	Samd14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122495 CCDS:CCDS25269.1 GeneID:217125 MGI:2384945
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : sterile alpha motif domain containing 14 isoform 1 protein_id : NP_666137.1

name	Pdk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526816 CCDS:CCDS25270.1 GeneID:18604 MGI:1343087
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0006086 - acetyl-CoA biosynthesis from pyruvate [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : pyruvate dehydrogenase 2 product : pyruvate dehydrogenase kinase, isoenzyme 2 protein_id : NP_598428.1

name	Itga3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305189 CCDS:CCDS25271.1 GeneID:16400 MGI:96602
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007342 - fusion of sperm to egg plasma membrane [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0007613 - memory [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP] codon_start : 1 note : integrin alpha 3 (Cd49c); VLA-3 receptor, alpha 3 subunit; alpha3-integrin; VLA-3 alpha 3 product : integrin alpha 3 protein_id : NP_038593.1

name	Dlx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753648 CCDS:CCDS25272.1 GeneID:13393 MGI:94903
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : DII C product : distal-less homeobox 3 protein_id : NP_034185.1

name	Dlx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677403 CCDS:CCDS25273.1 GeneID:13394 MGI:94904
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : distal-less homeo box 7; DII D product : distal-less homeobox 4 protein_id : NP_031893.2

name	LOC100039437 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262385 GeneID:100039437
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472934.1

name	Tac4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716383 CCDS:CCDS25274.1 GeneID:93670 MGI:1931130
definition	GO_function : GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0046878 - positive regulation of saliva secretion [Evidence IDA]; GO:0007217 - tachykinin signaling pathway [Evidence IDA] codon_start : 1 note : hemokinin I (HK-1) product : tachykinin 4 protein_id : NP_444323.1

name	Myst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244000 CCDS:CCDS25275.1 GeneID:217127 MGI:2182799
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : MYST histone acetyltransferase 2 protein_id : NP_808287.1

name	5730593F17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369768 CCDS:CCDS25276.1 GeneID:215512 MGI:2144564
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 5730593F17 protein_id : NP_766131.1

name	Slc35b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949137 CCDS:CCDS25277.1 GeneID:110172 MGI:1343133
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : UDP-galactose translocator 2 product : solute carrier family 35, member B1 protein_id : NP_058032.1

name	LOC100039483 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262389 GeneID:100039483
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473010.1

name	Spop (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026917 GeneID:20747 MGI:1343085
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : speckle-type POZ protein protein_id : NP_079563.2

name	Nxph3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18699994 CCDS:CCDS25278.1 GeneID:104079 MGI:1336188
definition	GO_function : GO:0005102 - receptor binding [Evidence IDA] codon_start : 1 product : neurexophilin 3 protein_id : NP_570928.1

name	Ngfr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794803 CCDS:CCDS25279.1 GeneID:18053 MGI:97323
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005035 - death receptor activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007411 - axon guidance [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : p75 neurotrophin receptor product : nerve growth factor receptor (TNFR superfamily, member 16) protein_id : NP_150086.2

name	Phb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679299 CCDS:CCDS25280.1 GeneID:18673 MGI:97572
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : prohibitin protein_id : NP_032857.1

name	1110035M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262391 GeneID:432396 MGI:3044900
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473105.1

name	Zfp652 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378028 GeneID:268469 MGI:2442221
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 652 protein_id : NP_963903.2

name	EG665273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390768 GeneID:665273 MGI:3644307
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980862.1

name	Phospho1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346533 GeneID:237928 MGI:2447348
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : phosphatase, orphan 1 protein_id : NP_694744.1

name	Abi3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313408 CCDS:CCDS25283.1 GeneID:66610 MGI:1913860
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030334 - regulation of cell migration [Evidence ISS] codon_start : 1 product : ABI gene family, member 3 protein_id : NP_079935.1

name	Gngt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461990 CCDS:CCDS25284.1 GeneID:14710 MGI:893584
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : guanine nucleotide binding protein (G protein), gamma transducing polypeptide 2 product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 protein_id : NP_001033753.2

name	Gngt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21327663 GeneID:14710 MGI:893584
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : guanine nucleotide binding protein (G protein), gamma transducing polypeptide 2 product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 protein_id : NP_075610.1

name	LOC100040014 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262408 GeneID:100040014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474973.1

name	B4galnt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679931 CCDS:CCDS25285.1 GeneID:14422 MGI:1342058
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0030259 - lipid glycosylation [Evidence IEA] codon_start : 1 note : dolichos lectin binding 1; CT-Gal NAc transferase; N-acetylgalactosaminyltransferase; UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)- galactosyl-N-acetylglucosaminylpolypeptide-beta-1, 4-N-acetylgalactosaminyltransferase; UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneura minyl)-galactosyl-N-acetylglucosaminylpolypeptide-beta-1, 4-N-acetylgalactosaminyltransferase product : beta-1,4-N-acetyl-galactosaminyl transferase 2 protein_id : NP_032107.1

name	Igf2bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753518 CCDS:CCDS25286.1 GeneID:140486 MGI:1890357
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zipcode-binding protein 1; coding region determinant binding protein; zipcode binding protein 1 product : insulin-like growth factor 2, binding protein 1 protein_id : NP_034081.1

name	LOC100040040 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262410 GeneID:100040040
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475003.1

name	Gip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982340 CCDS:CCDS25287.1 GeneID:14607 MGI:107504
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : glucose-dependent insulinotropic polypeptide product : gastric inhibitory polypeptide protein_id : NP_032145.2

name	Snf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809002 CCDS:CCDS25288.1 GeneID:27681 MGI:1343161
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : EAP30 subunit of ELL complex protein_id : NP_291046.1

name	Ube2z (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681729 GeneID:268470 MGI:1343160
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2Z protein_id : NP_758504.3

name	Atp5g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982497 CCDS:CCDS25289.1 GeneID:11951 MGI:107653
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c, isoform 1 protein_id : NP_031532.2

name	Ndp52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626078 GeneID:76815 MGI:1343177
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016605 - PML body [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : nuclear domain 10 protein 52 like 1 protein_id : NP_084031.1

name	Ttll6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370188 CCDS:CCDS25290.1 GeneID:237930 MGI:2683461
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : tubulin tyrosine ligase-like family, member 6 protein_id : NP_766387.1

name	Hoxb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680247 CCDS:CCDS25291.1 GeneID:15408 MGI:107730
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0040008 - regulation of growth [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox B13 protein_id : NP_032293.1

name	LOC432593 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262393 GeneID:432593
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981271.2

name	Gm53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38091774 GeneID:193022 MGI:2684899
definition	codon_start : 1 product : hypothetical protein protein_id : XP_112540.2

name	Hoxb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680760 CCDS:CCDS25292.1 GeneID:15417 MGI:96190
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B9 protein_id : NP_032296.2

name	Hoxb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362265 CCDS:CCDS25293.1 GeneID:15416 MGI:96189
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B8 protein_id : NP_034591.1

name	Hoxb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014652 CCDS:CCDS25294.1 GeneID:15415 MGI:96188
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B7 protein_id : NP_034590.2

name	Hoxb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21886813 CCDS:CCDS25295.1 GeneID:15414 MGI:96187
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B6 protein_id : NP_032295.1

name	Hoxb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680251 CCDS:CCDS25296.1 GeneID:15413 MGI:96186
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045446 - endothelial cell differentiation [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeo box B5 protein_id : NP_032294.1

name	Hoxb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625619 CCDS:CCDS25297.1 GeneID:15412 MGI:96185
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048103 - somatic stem cell division [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B4 protein_id : NP_034589.3

name	Hoxb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300900 GeneID:15410 MGI:96184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B3 protein_id : NP_001073338.1

name	Hoxb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300925 CCDS:CCDS25299.1 GeneID:15410 MGI:96184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B3 protein_id : NP_034588.2

name	Hoxb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94158904 GeneID:103889 MGI:96183
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : homeo box B2 protein_id : NP_598793.2

name	Hoxb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45598392 CCDS:CCDS25300.1 GeneID:15407 MGI:96182
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeobox B1 protein_id : NP_032292.2

name	LOC100040242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262414 GeneID:100040242
definition	codon_start : 1 product : similar to Ribosomal protein L17 isoform 1 protein_id : XP_001475439.1

name	LOC100040242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262416 GeneID:100040242
definition	codon_start : 1 product : similar to Ribosomal protein L17 isoform 2 protein_id : XP_001475451.1

name	OTTMUSG00000001775 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262420 GeneID:100038600 MGI:3649352
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475483.1

name	Skap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794544 CCDS:CCDS25301.1 GeneID:78473 MGI:1925723
definition	GO_function : GO:0019904 - protein domain specific binding [Evidence ISS] codon_start : 1 note : ortholog of human src family associated phosphoprotein 1 SCAP1 product : src family associated phosphoprotein 1 protein_id : NP_001028358.1

name	Snx11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094999 CCDS:CCDS25302.1 GeneID:74479 MGI:1921729
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 11 protein_id : NP_083241.1

name	LOC629750 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262426 GeneID:629750
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 isoform 1 protein_id : XP_001475538.1

name	LOC629750 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262427 GeneID:629750
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 isoform 2 protein_id : XP_899768.2

name	Cbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671696 CCDS:CCDS25303.1 GeneID:12412 MGI:105369
definition	GO_component : GO:0005721 - centric heterochromatin [Evidence IDA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0001940 - male pronucleus [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005701 - polytene chromosome chromocenter [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : chromobox homolog 1 protein_id : NP_031648.1

name	Nfe2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982173 CCDS:CCDS25304.1 GeneID:18023 MGI:99421
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : nuclear factor, erythroid derived 2,-like 1 protein_id : NP_032712.2

name	Copz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845242 CCDS:CCDS25305.1 GeneID:56358 MGI:1929008
definition	GO_component : GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0030126 - COPI vesicle coat [Evidence ISS]; GO:0030137 - COPI-coated vesicle [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nonclathrin coat protein zeta2-COP product : coatomer protein complex, subunit zeta 2 protein_id : NP_063930.1

name	LOC100040373 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262433 GeneID:100040373
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475633.1

name	LOC665436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665436
definition	number : 1 pseudo : _no_value

name	LOC665436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665436
definition	number : 2 pseudo : _no_value

name	LOC665436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665436
definition	number : 3 pseudo : _no_value

name	Cdc34-ps (CDS detail)
type	polyA_site
link	vega ensembl
xref
definition

name	Cdc34-ps (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition

name	A430060F13Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262395 GeneID:217122 MGI:3026970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 97 ESTs, 2 Proteins product : RIKEN cDNA A430060F13 gene transcript_id : XR_035209.1

name	LOC100039639 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262394 GeneID:100039639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 889 ESTs, 1 Protein product : similar to ribosomal protein L18 pseudo : _no_value transcript_id : XR_031108.1

clone name	MSMg01-379D18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-102H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-107K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036I19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-291E15.b	B6Ng01-291E15.g
ACC	GA088215	GA088216
length	1,084	1,116
definition	B6Ng01-291E15.b	B6Ng01-291E15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(95,752,584 - 95,753,666)	(95,579,113 - 95,580,226)
sequence	gaattcaaggccagtatgatctacatggtgaattccaggccagccaggct tatatggtgggacctgtctcaaacaaaacaaagtaagactaatgaagatt attactattgagagtgcgaatgtccgtgagcaaatgccacggctcgggta ttggtgtcagaggacaactcgttagactcggtcctgtccttctaccccgg gttctcaaatgaagtctttagggttgcacggtgagcgctcttgtccattg aaccattcccagctttttacgtggttgcaggagactgcactcaggcccct cctgtgcagcgttactgtctacaccttctatctccccagatcttgacatc aaacattctaatgtgttttgctttttcagcgtgtcttttgccagcttcag gtttccatggctcctcaagacatttgtcctcatggtaggacttgccactg ttgcgtttatggtgagaaaggtgtcccttacaacagacttcagcaccttc aagccaaagtttccagagcctgcaagggttgacccagtgctgaagcttct accagaggagcatctgaggaaactctttacctacagtgacatctggtgag actctgggtgctccagcctcactgttgtccccctcaaggtcacttccctg attctccttgagccttagacatcgtagacaactcagaatgggtgctggtt actaaagtgagtctcagagaccaggggtggtctgtgggatccagtgtctg tttcccacaacaccaggtaaccttgcaacttcactgggagggcttggttc ctgccatctgccctaatgggactagctgccaactgaagtgcctatggctc ttaaagacgcaagatagaagggataattctagagagggctgttaggcacg gtagtgcactcagcagctaaaggcaggggagttaccatgagtttgaagcc agcctgggccacatagacaagatctcgtctcaagaaagaaaaggaaagag gacgaaagaaagagggaatagttctttagtccctccctttcatccccact ccctcatctgtctctggggggggggggggggagg	gaattctgtgtcagagtcaaatcatgtggaaagccttgtgtaaattatca tggttaatgcacccataaagtactcggtagagttagtagagacatcaaat gcttattttagtaaatctgtttatttatatagcagttgtgttcgacttga aaatacttgtgtatattttgtgaaaatacttatgagaaatcccagtgctt gtctgaatttttgatcatgaactgtcaataggactaaaagtttgtatgtg ccttatacatttttgccttagtgggaaaagggatgaaaagtaagattcca tctgttaaatttaattaactatgtgctatagattgtctatgtggccttgc ttatcatttaaataaaataagtcaggcgtggtgttgcacacctttaatcc agcacttgggaggcagaggcaggcggatttctgagtttgaggtcagcctg gtctacaaagtgagttccaggacagccagagctacacagagaaaccctgt ctcgaaaaaccaaaacaaacccaaaaaaacaaaaaaggcagttttatggt aaaacatgacaccatatttccttttaaagatagattatcaattgctttga aaaataacgggctgtggtggtgcacatctttaatcccagcatttaggagg cagagatagagtttgaggccaacctggtctaccaaatgagttccagggct atatagagaaaccctgtctcaaaaagaaaacaaacaaataaacaaaaaga aagaaagggggctggagatatggcttagcggttaagagcactgactgttc ttccaaaggtcctgagttcaaatcccagcaaccacatggtggctcacaac catctatctgtaataagatcttttaccctcttctggtgtgtctgaagaca gctacgtgtacttagatattataattaaatcttaaaaaaaaaaaagaaag gaagggaggaaaaattaaaaaaaattaagaagaacaagtttagttaaagt catgtatgcatattatttggtggcacgaagacaatttaaaatagatctct ttggctaatggtagagtaaaattaactctgcaccttttgcaggatagcat taatgtatgttctctg
quality values	Open. Hide. 58 36 18 25 58 26 21 39 58 58 62 41 31 62 62 43 47 62 38 47 62 62 62 62 51 54 62 46 62 62 62 54 47 56 56 47 20 28 38 34 29 44 59 62 59 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 42 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 58 58 58 54 58 54 58 54 54 52 58 34 58 58 52 58 52 58 58 58 58 54 39 58 58 58 48 45 58 58 58 58 44 52 54 58 58 54 58 54 58 58 58 46 52 51 58 58 58 58 58 52 58 58 54 54 48 58 58 58 58 58 58 54 58 48 54 54 54 46 52 58 58 54 52 52 51 58 58 50 54 58 50 47 38 38 41 47 54 52 50 50 50 58 48 50 50 42 58 54 49 58 58 50 51 45 41 51 53 53 53 54 54 51 52 58 39 54 49 49 52 54 32 52 52 46 51 50 49 50 51 23 54 40 40 58 52 58 53 49 17 58 28 32 58 58 42 47 58 50 50 54 37 28 51 37 46 41 34 58 39 39 52 51 49 36 51 50 53 39 53 30 44 22 33 24 33 33 38 58 58 52 42 54 51 33 39 50 52 32 49 58 50 49 39 53 39 23 39 52 58 40 42 41 49 47 54 39 28 54 40 37 42 47 41 41 35 40 54 31 39 54 31 24 24 29 25 37 35 32 37 21 40 39 53 46 35 30 35 37 44 49 28 34 14 36 34 25 20 25 49 39 32 51 28 40 29 52 21 34 30 42 37 37 37 26 49 42 28 20 51 32 47 54 46 30 19 32 26 32 32 32 35 31 31 21 32 31 32 31 29 33 32 31 32 26 36 31 32 32 33 34 24 45 40 41 31 31 52 45 32 32 32 23 47 34 27 29 32 23 35 24 33 33 24 46 19 8 17 30 22 15 42 32 36 34 28 45 22 41 24 51 31 23 37 38 33 35 26 27 27 13 26 31 30 33 13 31 17 31 36 31 23 23 31 32 7 7 12 29 29 28 30 11 48 17 33 27 13 27 31 46 46 24 25 13 19 33 17 31 31 17 31 31 31 19 36 48 32 11 23 33 20 28 32 13 26 31 31 31 31 41 28 29 17 18 29 22 31 27 20 21 11 23 6 11 25 24 24 27 41 14 20 14 21 20 19 30 21 38 48 31 13 38 48 41 33 13 13 24 33 44 10 24 6 10 26 11 11 22 41 43 10 21 47 18 6 24 11 47 18 25 8 10 23 10 11 10 25 8 48 34 31 28 23 31 48 17 11 7 31 31 10 39 5 4 10 21 21 24 37 20 14 13 13 13 39 19 20 27 18 21 33 24 21 18 12 6 4 7 21 39 43 39 48 43 39 30 29 34 28 27 29 21 19 6 17 6 6	Open. Hide. 62 47 51 59 62 62 59 59 62 62 62 43 32 23 43 27 32 28 28 32 48 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 59 62 59 50 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 62 62 56 62 62 51 56 54 62 62 62 62 62 56 62 56 51 62 62 54 62 62 54 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 56 54 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 54 62 62 62 62 52 62 62 62 62 62 62 62 62 58 58 58 58 58 54 54 58 58 52 58 46 58 52 54 47 58 54 54 58 52 54 54 54 58 54 54 54 48 52 54 58 58 58 46 42 50 58 46 58 58 58 54 58 58 47 45 49 37 58 58 52 58 52 42 54 52 58 58 58 58 58 46 49 52 49 48 48 42 38 54 40 58 46 52 39 47 58 37 34 58 40 49 37 46 27 32 39 50 47 54 39 51 51 50 51 54 34 28 18 53 39 48 42 48 50 51 49 51 53 53 34 34 34 35 37 49 43 42 54 34 36 29 40 50 32 50 58 49 46 54 42 53 39 46 36 13 44 40 52 58 40 36 38 54 52 58 50 50 41 37 24 46 46 49 54 53 46 54 53 49 50 41 37 49 52 26 40 38 54 31 40 30 41 26 43 51 51 46 29 53 45 33 38 42 50 50 52 54 54 54 54 34 49 47 54 52 32 35 32 29 33 52 44 26 45 37 31 18 53 31 32 31 30 26 41 32 37 10 42 33 37 40 37 33 28 39 52 32 31 37 18 14 11 33 27 34 19 18 31 20 31 31 28 39 41 22 31 28 23 12 37 32 33 28 47 41 33 26 39 22 36 36 32 31 31 24 35 31 51 32 37 42 31 34 31 26 9 7 19 33 29 13 31 31 29 31 28 30 30 51 15 9 34 33 16 32 28 26 21 35 31 46 46 41 32 36 42 46 31 43 21 27 27 9 32 34 21 31 21 31 25 34 28 31 30 31 26 31 18 13 17 26 38 10 9 7 11 31 36 26 20 32 30 9 20 9 6 12 26 11 11 23 25 37 6 14 13 31 29 18 25 26 31 23 28 38 31 31 41 16 41 38 38 21 14 11 14 27 33 14 28 8 17 10 29 11 38 7 7 17 17 28 21 24 11 14 14 6 13 22 24 41 18 29 8 11 11 8 4 5 13 10 19 15 33 10 13 34 17 36 26 7 8 25 21 16 31 18 8 4 14 14 15 9 4 4 20 19 17 24 10 7 7 7 28 7 31 25 10 28 8 5 10 5 8 8 6 13 6 4 15 6 5 6 21 30 16 14 27 21 5 11 7 12 25 10 13 12 9 5 6 10 7 15 27 7 7 30 7 14 21 8 15 6 9 16 6 15 27 38 16 16 17 14 11 13 21 24 28 6 5 3 4 11 27 30 21 8 4 6 6 15 7 6 4 8 4 6 14 17 8 7 7 10 2 2 2 5 11 8 6 11 5 8 10 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_95752584_95753666
seq2: B6Ng01-291E15.b_47_1130 (reverse)

seq1  ----CCTCCCCCCCCCCCCAGAGACAGGATGAGGGAGTGGGGATG-AAGG  45
          || ||||||||||||||||||| |||||||||||||||||| ||||
seq2  CCTCCCCCCCCCCCCCCCCAGAGACA-GATGAGGGAGTGGGGATGAAAGG  49

seq1  GAGGGACTAAAG-ACTATTCCCTCTTTCTTTTCGTTCTTCTTTTCCTTTT  94
      |||||||||||| ||||||||||||||| |||||| ||   |||||||||
seq2  GAGGGACTAAAGAACTATTCCCTCTTTC-TTTCGTCCT--CTTTCCTTTT  96

seq1  CTTTCTTGAGACGGAGATCTTGTCTATGTGGCCCAGGCTGGCTTCAAACT  144
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  CTTTCTTGAGAC-GAGATCTTGTCTATGTGGCCCAGGCTGGCTTCAAACT  145

seq1  CATGGTAACTCCCCTGCC-TTAGCTGCCTGAGTGCACTACCGTGCCTAAC  193
      |||||||||||||||||| ||||||| |||||||||||||||||||||||
seq2  CATGGTAACTCCCCTGCCTTTAGCTG-CTGAGTGCACTACCGTGCCTAAC  194

seq1  AGCCCTCTCTAGAATTATCCCTTCTATCTTGCGTCTTTAAGAGCCATAGG  243
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCTCTCTAGAATTATCCCTTCTATCTTGCGTCTTTAAGAGCCATAGG  244

seq1  CACTTCAGTTGGCAGCTAGTCCCATTAGGGCAGATGGCAGGAACCAAGCC  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTCAGTTGGCAGCTAGTCCCATTAGGGCAGATGGCAGGAACCAAGCC  294

seq1  CTCCCAGTGAAGTTGCAAGGTTACCTGGTGTTGTGGGAAACAGACACTGG  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCAGTGAAGTTGCAAGGTTACCTGGTGTTGTGGGAAACAGACACTGG  344

seq1  ATCCCACAGACCACCCCTGGTCTCTGAGACTCACTTTAGTAACCAGCACC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCACAGACCACCCCTGGTCTCTGAGACTCACTTTAGTAACCAGCACC  394

seq1  CATTCTGAGTTGTCTACGATGTCTAAGGCTCAAGGAGAATCAGGGAAGTG  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTGAGTTGTCTACGATGTCTAAGGCTCAAGGAGAATCAGGGAAGTG  444

seq1  ACCTTGAGGGGGACAACAGTGAGGCTGGAGCACCCAGAGTCTCACCAGAT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGAGGGGGACAACAGTGAGGCTGGAGCACCCAGAGTCTCACCAGAT  494

seq1  GTCACTGTAGGTAAAGAGTTTCCTCAGATGCTCCTCTGGTAGAAGCTTCA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACTGTAGGTAAAGAGTTTCCTCAGATGCTCCTCTGGTAGAAGCTTCA  544

seq1  GCACTGGGTCAACCCTTGCAGGCTCTGGAAACTTTGGCTTGAAGGTGCTG  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGGGTCAACCCTTGCAGGCTCTGGAAACTTTGGCTTGAAGGTGCTG  594

seq1  AAGTCTGTTGTAAGGGACACCTTTCTCACCATAAACGCAACAGTGGCAAG  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTGTTGTAAGGGACACCTTTCTCACCATAAACGCAACAGTGGCAAG  644

seq1  TCCTACCATGAGGACAAATGTCTTGAGGAGCCATGGAAACCTGAAGCTGG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTACCATGAGGACAAATGTCTTGAGGAGCCATGGAAACCTGAAGCTGG  694

seq1  CAAAAGACACGCTGAAAAAGCAAAACACATTAGAATGTTTGATGTCAAGA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAGACACGCTGAAAAAGCAAAACACATTAGAATGTTTGATGTCAAGA  744

seq1  TCTGGGGAGATAGAAGGTGTAGACAGTAACGCTGCACAGGAGGGGCCTGA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGGAGATAGAAGGTGTAGACAGTAACGCTGCACAGGAGGGGCCTGA  794

seq1  GTGCAGTCTCCTGCAACCACGTAAAAAGCTGGGAATGGTTCAATGGACAA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAGTCTCCTGCAACCACGTAAAAAGCTGGGAATGGTTCAATGGACAA  844

seq1  GAGCGCTCACCGTGCAACCCTAAAGACTTCATTTGAGAACCCGGGGTAGA  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCGCTCACCGTGCAACCCTAAAGACTTCATTTGAGAACCCGGGGTAGA  894

seq1  AGGACAGGACCGAGTCTAACGAGTTGTCCTCTGACACCAATACCCGAGCC  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACAGGACCGAGTCTAACGAGTTGTCCTCTGACACCAATACCCGAGCC  944

seq1  GTGGCATTTGCTCACGGACATTCGCACTCTCAATAGTAATAATCTTCATT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCATTTGCTCACGGACATTCGCACTCTCAATAGTAATAATCTTCATT  994

seq1  AGTCTTACTTTGTTTTGTTTGAGACAGGTCCCACCATATAAGCCTGGCTG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTACTTTGTTTTGTTTGAGACAGGTCCCACCATATAAGCCTGGCTG  1044

seq1  GCCTGGAATTCACCATGTAGATCATACTGGCCTTGAATTC  1083
      ||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGGAATTCACCATGTAGATCATACTGGCCTTGAATTC  1084

seq1: chr11_95579113_95580226
seq2: B6Ng01-291E15.g_71_1186

seq1  GAATTCTGTGTCAGAGTCAAATCATGTGGAAAGCCTTGTGTAAATTATCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTGTCAGAGTCAAATCATGTGGAAAGCCTTGTGTAAATTATCA  50

seq1  TGGTTAATGCACCCATAAAGTACTCGGTAGAGTTAGTAGAGACATCAAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTAATGCACCCATAAAGTACTCGGTAGAGTTAGTAGAGACATCAAAT  100

seq1  GCTTATTTTAGTAAATCTGTTTATTTATATAGCAGTTGTGTTCGACTTGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTATTTTAGTAAATCTGTTTATTTATATAGCAGTTGTGTTCGACTTGA  150

seq1  AAATACTTGTGTATATTTTGTGAAAATACTTATGAGAAATCCCAGTGCTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATACTTGTGTATATTTTGTGAAAATACTTATGAGAAATCCCAGTGCTT  200

seq1  GTCTGAATTTTTGATCATGAACTGTCAATAGGACTAAAAGTTTGTATGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGAATTTTTGATCATGAACTGTCAATAGGACTAAAAGTTTGTATGTG  250

seq1  CCTTATACATTTTTGCCTTAGTGGGAAAAGGGATGAAAAGTAAGATTCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTATACATTTTTGCCTTAGTGGGAAAAGGGATGAAAAGTAAGATTCCA  300

seq1  TCTGTTAAATTTAATTAACTATGTGCTATAGATTGTCTATGTGGCCTTGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTTAAATTTAATTAACTATGTGCTATAGATTGTCTATGTGGCCTTGC  350

seq1  TTATCATTTAAATAAAATAAGTCAGGCGTGGTGTTGCACACCTTTAATCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCATTTAAATAAAATAAGTCAGGCGTGGTGTTGCACACCTTTAATCC  400

seq1  AGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGTCAGCCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAGGTCAGCCTG  450

seq1  GTCTACAAAGTGAGTTCCAGGACAGCCAGAGCTACACAGAGAAACCCTGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTACAAAGTGAGTTCCAGGACAGCCAGAGCTACACAGAGAAACCCTGT  500

seq1  CTCGAAAAACCAAAACAAACCCAAAAAAACAAAAAAGGCAGTTTTATGGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGAAAAACCAAAACAAACCCAAAAAAACAAAAAAGGCAGTTTTATGGT  550

seq1  AAAACATGACACCATATTTCCTTTTAAAGATAGATTATCAATTGCTTTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACATGACACCATATTTCCTTTTAAAGATAGATTATCAATTGCTTTGA  600

seq1  AAAATAACGGGCTGTGGTGGTGCACATCTTTAATCCCAGCATTTAGGAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAACGGGCTGTGGTGGTGCACATCTTTAATCCCAGCATTTAGGAGG  650

seq1  CAGAGATAGAGTTTGAGGCCAACCTGGTCTACCAAATGAGTTCCAGGGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGATAGAGTTTGAGGCCAACCTGGTCTACCAAATGAGTTCCAGGGCT  700

seq1  ATATAGAGAAACCCTGTCTCAAAAAGAAAACAAACAAATAAACAAAAAGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAGAGAAACCCTGTCTCAAAAAGAAAACAAACAAATAAACAAAAAGA  750

seq1  AAGAAAGGGGGCTGGAGATATGGCTTAGCGGTTAAGAGCACTGACTGTTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAGGGGGCTGGAGATATGGCTTAGCGGTTAAGAGCACTGACTGTTC  800

seq1  TTCCAAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAAC  850

seq1  CATCTATCTGTAATAAGATCTTTTACCCTCTTCTGGTGTGTCTGAAGACA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTATCTGTAATAAGATCTTTTACCCTCTTCTGGTGTGTCTGAAGACA  900

seq1  GCTACAGTGTACTTAGATATAATAAATAAATCTTAAAAAAAAAAAAAGAA  950
      ||||| |||||||||||||| |||| |||||||| |||||||||||||||
seq2  GCTAC-GTGTACTTAGATATTATAATTAAATCTT-AAAAAAAAAAAAGAA  948

seq1  AGGAA-GGAAGAAAAAATAAAAAAAATAAAGAAGAACAAGTTTAGTTAAA  999
      ||||| ||| |||||| |||||||||| ||||||||||||||||||||||
seq2  AGGAAGGGAGGAAAAATTAAAAAAAATTAAGAAGAACAAGTTTAGTTAAA  998

seq1  GTCATGTATGCAATATAATTTGGT-GCACG-AGAC-ATTTAAAATAGAAT  1046
      ||||||||||| |||| ||||||| ||||| |||| ||||||||||| ||
seq2  GTCATGTATGC-ATATTATTTGGTGGCACGAAGACAATTTAAAATAG-AT  1046

seq1  CTCTTTGGCTAAT-GTAGAGT-AAATTAACTCTGCCACCTTTTGCAGGAT  1094
      ||||||||||||| ||||||| |||||||||||| |||||||||||||||
seq2  CTCTTTGGCTAATGGTAGAGTAAAATTAACTCTG-CACCTTTTGCAGGAT  1095

seq1  AGCATTATGGTATG-TCTCTG  1114
      |||||||  ||||| ||||||
seq2  AGCATTAATGTATGTTCTCTG  1116

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information