MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-303L05
Chromosome	11 (Build37)
Map Location	97,996,320 - 98,130,967
singlet/doublet	doublet
Overlap gene	Fbxl20, LOC665606, Pparbp, LOC666613, LOC100039982, Crkrs
Upstream gene	Tbkbp1, Kpnb1, Npepps, EG665490, Mrpl45, Gpr179, Socs7, 4933428G20Rik, P140, 2410003L11Rik, E130012A19Rik, Mllt6, Mel13, Pcgf2, Psmb3, Pip5k2b, 2810474C18Rik, Ccdc49, LOC100040708, 1700001P01Rik, Rpl23, Lasp1, B230217C12Rik, Fbxo47, Plxdc1, Arl5c, Cacnb1, Rpl19, Stac2
Downstream gene	Neurod2, Ppp1r1b, Stard3, Tcap, Pnmt, Perld1, Erbb2, 1810046J19Rik, Grb7, Ikzf3, Zpbp2, Ormdl3, Gm12, LOC100040117, Gsdm3, Gsdm2, Gsdm1, Psmd3, Csf3, Thrap4, Thra, Nr1d1, 4121402D02Rik, Casc3, Rapgefl1, Wipf2, Cdc6, Rara, Gjc1, Top2a, Igfbp4, Tns4, Ccr7, Smarce1, Krt222
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tbkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73174 MGI:1920424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kpnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16211 MGI:107532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npepps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19155 MGI:1101358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665490 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665490 MGI:3644866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Mrpl45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67036 MGI:1914286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217143 MGI:2443409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Socs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192157 MGI:2651588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933428G20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58996 MGI:1918475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56013 MGI:1933179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410003L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69729 MGI:1916979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	E130012A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103551 MGI:2143991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246198 MGI:1935145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mel13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217149 MGI:101788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 1 Protein

name	Pcgf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22658 MGI:99161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26446 MGI:1347014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108083 MGI:1934234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810474C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72785 MGI:1920035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67480 MGI:1914730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040708 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 334 ESTs, 5 Proteins

name	1700001P01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72215 MGI:1919465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65019 MGI:1929455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lasp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16796 MGI:109656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230217C12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68127 MGI:1915377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72973 MGI:1920223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plxdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72324 MGI:1919574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217151 MGI:3028577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12295 MGI:102522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rpl19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19921 MGI:98020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stac2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217154 MGI:2144518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72194 MGI:1919444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Pparbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC666613 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 465 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Crkrs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69131 MGI:1098802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neurod2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18013 MGI:107755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19049 MGI:94860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stard3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59045 MGI:1929618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21393 MGI:1330233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18948 MGI:97724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Perld1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320655 MGI:2444461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erbb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13866 MGI:95410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810046J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103742 MGI:1913678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14786 MGI:102683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikzf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22780 MGI:1342542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zpbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69376 MGI:1916626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ormdl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66612 MGI:1913862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192852 MGI:2684858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	LOC100040117 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 218 ESTs

name	Gsdm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:450219 MGI:3044668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsdm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76758 MGI:1921490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsdm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57911 MGI:1889509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22123 MGI:98858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12985 MGI:1339751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thrap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23989 MGI:1344385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21833 MGI:98742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217166 MGI:2444210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4121402D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74026 MGI:1921276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Casc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192160 MGI:2179723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rapgefl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268480 MGI:3611446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wipf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68524 MGI:1924462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23834 MGI:1345150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rara (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19401 MGI:97856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gjc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353155 MGI:2384150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Top2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21973 MGI:98790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16010 MGI:96439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tns4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217169 MGI:2144377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12775 MGI:103011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57376 MGI:1927347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krt222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268481 MGI:2442728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674211 GeneID:73174 MGI:1920424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBK1 binding protein 1 transcript_id : NM_198100.1

name	Kpnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014719 GeneID:16211 MGI:107532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : karyopherin (importin) beta 1 transcript_id : NM_008379.3

name	Npepps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68226730 GeneID:19155 MGI:1101358
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminopeptidase puromycin sensitive transcript_id : NM_008942.2

name	EG665490 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262404 GeneID:665490 MGI:3644866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665490 transcript_id : XM_977275.2

name	Mrpl45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368142 GeneID:67036 MGI:1914286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L45 transcript_id : NM_025927.3

name	Gpr179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487044 GeneID:217143 MGI:2443409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 179 transcript_id : NM_001081220.1

name	Socs7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253931 GeneID:192157 MGI:2651588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of cytokine signaling 7 transcript_id : NM_138657.3

name	4933428G20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796636 GeneID:58996 MGI:1918475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933428G20 gene transcript_id : NM_021493.2

name	P140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089328 GeneID:56013 MGI:1933179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : P140 gene transcript_id : NM_018873.2

name	2410003L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262438 GeneID:69729 MGI:1916979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 2410003L11 gene, transcript variant 2 transcript_id : XM_903024.3

name	E130012A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185891 GeneID:103551 MGI:2143991
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130012A19 gene transcript_id : NM_175332.3

name	Mllt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130867 GeneID:246198 MGI:1935145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed lineage-leukemia translocation to 6 homolog (Drosophila) transcript_id : NM_139311.2

name	Mel13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390859 GeneID:217149 MGI:101788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein product : melanoma nuclear protein 13, transcript variant 1 transcript_id : XM_126589.6

name	Mel13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262440 GeneID:217149 MGI:101788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 1 Protein product : melanoma nuclear protein 13, transcript variant 2 transcript_id : XM_895143.3

name	Pcgf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678634 GeneID:22658 MGI:99161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 2 transcript_id : NM_009545.1

name	Psmb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801586 GeneID:26446 MGI:1347014
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 3 transcript_id : NM_011971.3

name	Pip5k2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563293 GeneID:108083 MGI:1934234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type II, beta transcript_id : NM_054051.1

name	2810474C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262441 GeneID:72785 MGI:1920035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810474C18 gene transcript_id : XM_001476201.1

name	Ccdc49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379058 GeneID:67480 MGI:1914730
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 49 transcript_id : NM_026186.3

name	LOC100040708 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262445 GeneID:100040708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 232 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G, transcript variant 2 transcript_id : XM_001476326.1

name	LOC100040708 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262443 GeneID:100040708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 333 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G, transcript variant 1 transcript_id : XM_001476305.1

name	1700001P01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130873 GeneID:72215 MGI:1919465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001P01 gene transcript_id : NM_028156.2

name	Rpl23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893219 GeneID:65019 MGI:1929455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L23 transcript_id : NM_022891.2

name	Lasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349718 GeneID:16796 MGI:109656
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM and SH3 protein 1 transcript_id : NM_010688.3

name	B230217C12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286857 GeneID:68127 MGI:1915377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230217C12 gene transcript_id : NM_001080935.1

name	Fbxo47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487430 GeneID:72973 MGI:1920223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 47 transcript_id : NM_001081435.1

name	Plxdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560780 GeneID:72324 MGI:1919574
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin domain containing 1 transcript_id : NM_028199.2

name	Arl5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402216 GeneID:217151 MGI:3028577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 5C transcript_id : NM_207231.1

name	Cacnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281727 GeneID:12295 MGI:102522
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 1 subunit transcript_id : NM_145121.1

name	Cacnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130728 GeneID:12295 MGI:102522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, beta 1 subunit transcript_id : NM_031173.2

name	Rpl19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677772 GeneID:19921 MGI:98020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L19 transcript_id : NM_009078.1

name	Stac2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801886 GeneID:217154 MGI:2144518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3 and cysteine rich domain 2 transcript_id : NM_146028.3

name	Fbxl20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494220 GeneID:72194 MGI:1919444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 20 transcript_id : NM_028149.1

name	LOC665606 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390779 GeneID:665606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical LOC665606 transcript_id : XM_978106.1

name	Pparbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583905 GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor binding protein transcript_id : NM_134027.2

name	Pparbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582397 GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor binding protein transcript_id : NM_001080118.1

name	Pparbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582429 GeneID:19014 MGI:1100846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisome proliferator activated receptor binding protein transcript_id : NM_013634.2

name	LOC100039982 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262405 GeneID:100039982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039982 transcript_id : XM_001473891.1

name	Crkrs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794423 GeneID:69131 MGI:1098802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc2-related kinase, arginine/serine-rich transcript_id : NM_026952.1

name	Neurod2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982780 GeneID:18013 MGI:107755
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurogenic differentiation 2 transcript_id : NM_010895.2

name	Ppp1r1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21536255 GeneID:19049 MGI:94860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 1B transcript_id : NM_144828.1

name	Stard3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892541 GeneID:59045 MGI:1929618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : START domain containing 3 transcript_id : NM_021547.2

name	Tcap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248559 GeneID:21393 MGI:1330233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : titin-cap transcript_id : NM_011540.2

name	Pnmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679404 GeneID:18948 MGI:97724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phenylethanolamine-N-methyltransferase transcript_id : NM_008890.1

name	Perld1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326507 GeneID:320655 MGI:2444461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : per1-like domain containing 1 transcript_id : NM_001033537.2

name	Erbb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54873609 GeneID:13866 MGI:95410
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) transcript_id : NM_001003817.1

name	1810046J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074525 GeneID:103742 MGI:1913678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810046J19 gene transcript_id : NM_025559.2

name	Grb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116325997 GeneID:14786 MGI:102683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 7 transcript_id : NM_010346.2

name	Ikzf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374151 GeneID:22780 MGI:1342542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IKAROS family zinc finger 3 transcript_id : NM_011771.1

name	Zpbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40786388 GeneID:69376 MGI:1916626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida binding protein 2 transcript_id : NM_027061.1

name	Zpbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789100 GeneID:69376 MGI:1916626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zona pellucida binding protein 2 transcript_id : NM_199419.2

name	Ormdl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373134 GeneID:66612 MGI:1913862
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ORM1-like 3 (S. cerevisiae) transcript_id : NM_025661.2

name	Gm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262454 GeneID:192852 MGI:2684858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : gene model 12, (NCBI) transcript_id : XM_001476985.1

name	LOC100040117 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262411 GeneID:100040117
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 218 ESTs product : hypothetical protein LOC100040117 transcript_id : XM_001474109.1

name	Gsdm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55925615 GeneID:450219 MGI:3044668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin 3 transcript_id : NM_001007461.1

name	Gsdm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270962 GeneID:76758 MGI:1921490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin 2 transcript_id : NM_029727.2

name	Gsdm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385860 GeneID:57911 MGI:1889509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gasdermin 1 transcript_id : NM_021347.3

name	Psmd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19705423 GeneID:22123 MGI:98858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 transcript_id : NM_009439.1

name	Csf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753535 GeneID:12985 MGI:1339751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : colony stimulating factor 3 (granulocyte) transcript_id : NM_009971.1

name	Thrap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119220578 GeneID:23989 MGI:1344385
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor associated protein 4 transcript_id : NM_011869.2

name	Thra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130347 GeneID:21833 MGI:98742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor alpha transcript_id : NM_178060.3

name	Nr1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625907 GeneID:217166 MGI:2444210
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group D, member 1 transcript_id : NM_145434.2

name	4121402D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311987 GeneID:74026 MGI:1921276
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4121402D02 gene transcript_id : NM_028722.1

name	Casc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149743 GeneID:192160 MGI:2179723
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cancer susceptibility candidate 3 transcript_id : NM_138660.1

name	Rapgefl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124257962 GeneID:268480 MGI:3611446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap guanine nucleotide exchange factor (GEF)-like 1 transcript_id : NM_001080925.1

name	Wipf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537555 GeneID:68524 MGI:1924462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAS/WASL interacting protein family, member 2 transcript_id : NM_197940.1

name	Cdc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061452 GeneID:23834 MGI:1345150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 6 homolog (S. cerevisiae) transcript_id : NM_001025779.1

name	Cdc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061472 GeneID:23834 MGI:1345150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 6 homolog (S. cerevisiae) transcript_id : NM_011799.2

name	Rara (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116734872 GeneID:19401 MGI:97856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinoic acid receptor, alpha transcript_id : NM_009024.2

name	Gjc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174743 GeneID:353155 MGI:2384150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein chi 1 transcript_id : NM_178596.2

name	Top2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755848 GeneID:21973 MGI:98790
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : topoisomerase (DNA) II alpha transcript_id : NM_011623.1

name	Igfbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130042 GeneID:16010 MGI:96439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 4 transcript_id : NM_010517.3

name	Tns4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382709 GeneID:217169 MGI:2144377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tensin 4 transcript_id : NM_172564.2

name	Ccr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268120 GeneID:12775 MGI:103011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 7 transcript_id : NM_007719.2

name	Smarce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41055974 GeneID:57376 MGI:1927347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 transcript_id : NM_020618.3

name	Krt222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348964 GeneID:268481 MGI:2442728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin 222 transcript_id : NM_172946.2

name	Tbkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674212 GeneID:73174 MGI:1920424
definition	codon_start : 1 product : ProSAPiP2 protein protein_id : NP_932768.1

name	Kpnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014720 CCDS:CCDS25316.1 GeneID:16211 MGI:107532
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0006606 - protein import into nucleus [Evidence ISS] [Evidence IDA]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006610 - ribosomal protein import into nucleus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : importin beta product : karyopherin (importin) beta 1 protein_id : NP_032405.3

name	Npepps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68226731 CCDS:CCDS25317.1 GeneID:19155 MGI:1101358
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004179 - membrane alanyl aminopeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : puromycin-sensitive aminopeptidase product : aminopeptidase puromycin sensitive protein_id : NP_032968.2

name	EG665490 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390773 GeneID:665490 MGI:3644866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982369.1

name	Mrpl45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385418 CCDS:CCDS25318.1 GeneID:67036 MGI:1914286
definition	GO_component : GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence ISS] codon_start : 1 product : mitochondrial ribosomal protein L45 protein_id : NP_080203.1

name	Gpr179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487045 GeneID:217143 MGI:2443409
definition	codon_start : 1 product : GPR158-like 1 receptor protein_id : NP_001074689.1

name	Socs7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149738 CCDS:CCDS25319.1 GeneID:192157 MGI:2651588
definition	GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045444 - fat cell differentiation [Evidence IMP]; GO:0008286 - insulin receptor signaling pathway [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : SH2 domain containing SOCS box protein SOCS7; Nck, Ash and phospholipase C binding protein product : suppressor of cytokine signaling 7 protein_id : NP_619598.1

name	4933428G20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114796637 GeneID:58996 MGI:1918475
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 23 protein_id : NP_067468.2

name	P140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089329 GeneID:56013 MGI:1933179
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0007162 - negative regulation of cell adhesion [Evidence IDA] codon_start : 1 product : Snap-25-interacting protein protein_id : NP_061361.2

name	2410003L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82934981 GeneID:69729 MGI:1916979
definition	codon_start : 1 product : hypothetical protein LOC69729 isoform 2 protein_id : XP_908117.1

name	E130012A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185892 CCDS:CCDS25322.1 GeneID:103551 MGI:2143991
definition	codon_start : 1 product : hypothetical protein LOC103551 protein_id : NP_780541.2

name	Mllt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130868 CCDS:CCDS25323.1 GeneID:246198 MGI:1935145
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : myeloid/lymphoid or mixed lineage-leukemia translocation to 6 homolog protein_id : NP_647472.2

name	Mel13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262439 GeneID:217149 MGI:101788
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_126589.5

name	Mel13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82934983 GeneID:217149 MGI:101788
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_900236.1

name	Pcgf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678635 CCDS:CCDS25327.1 GeneID:22658 MGI:99161
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI]; GO:0016573 - histone acetylation [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 144; ring finger protein 110 product : polycomb group ring finger 2 protein_id : NP_033571.1

name	Psmb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755202 CCDS:CCDS25328.1 GeneID:26446 MGI:1347014
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence TAS]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome beta 3 subunit protein_id : NP_036101.1

name	Pip5k2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563294 CCDS:CCDS25329.1 GeneID:108083 MGI:1934234
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046488 - phosphatidylinositol metabolism [Evidence IDA] codon_start : 1 product : phosphatidylinositol-4-phosphate 5-kinase, type II, beta protein_id : NP_473392.1

name	2810474C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262442 GeneID:72785 MGI:1920035
definition	codon_start : 1 product : hypothetical protein LOC72785 protein_id : XP_001476251.1

name	Ccdc49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312952 CCDS:CCDS25330.1 GeneID:67480 MGI:1914730
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 49 protein_id : NP_080462.1

name	LOC100040708 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262444 GeneID:100040708
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476355.1

name	LOC100040708 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262446 GeneID:100040708
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476376.1

name	1700001P01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130874 GeneID:72215 MGI:1919465
definition	codon_start : 1 product : hypothetical protein LOC72215 protein_id : NP_082432.2

name	Rpl23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12584986 CCDS:CCDS25331.1 GeneID:65019 MGI:1929455
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS] codon_start : 1 note : snoRNA MBI-3; snoRNA MBI-5 product : ribosomal protein L23 protein_id : NP_075029.1

name	Lasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754508 CCDS:CCDS25332.1 GeneID:16796 MGI:109656
definition	GO_component : GO:0030864 - cortical actin cytoskeleton [Evidence ISS]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0015075 - ion transporter activity [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030865 - cortical cytoskeleton organization and biogenesis [Evidence ISS]; GO:0006811 - ion transport [Evidence ISS] [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : LIM and SH3 protein 1 protein_id : NP_034818.1

name	B230217C12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286858 GeneID:68127 MGI:1915377
definition	codon_start : 1 product : hypothetical protein LOC68127 protein_id : NP_001074404.1

name	Fbxo47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487431 GeneID:72973 MGI:1920223
definition	codon_start : 1 product : F-box protein 47 protein_id : NP_001074904.1

name	Plxdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560781 CCDS:CCDS25333.1 GeneID:72324 MGI:1919574
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : tumor endothelial marker 7 product : plexin domain containing 1 protein_id : NP_082475.2

name	Arl5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402217 CCDS:CCDS25334.1 GeneID:217151 MGI:3028577
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : ADP-ribosylation factor-like 12 product : ADP-ribosylation-like factor 12 protein protein_id : NP_997114.1

name	Cacnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281728 CCDS:CCDS25335.1 GeneID:12295 MGI:102522
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015270 - dihydropyridine-sensitive calcium channel activity [Evidence IDA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform B is encoded by transcript variant variant 2; voltage-dependent calcium channel beta1 subunit product : calcium channel, voltage-dependent, beta 1 isoform B protein_id : NP_660099.1

name	Cacnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626026 CCDS:CCDS25336.1 GeneID:12295 MGI:102522
definition	GO_component : GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0015270 - dihydropyridine-sensitive calcium channel activity [Evidence IDA]; GO:0008331 - high voltage-gated calcium channel activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform A is encoded by transcript variant variant 1; voltage-dependent calcium channel beta1 subunit product : calcium channel, voltage-dependent, beta 1 isoform A protein_id : NP_112450.1

name	Rpl19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677773 CCDS:CCDS25337.1 GeneID:19921 MGI:98020
definition	GO_component : GO:0005842 - cytosolic large ribosomal subunit (sensu Eukaryota) [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IDA] GO_process : GO:0006412 - protein biosynthesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ribosomal protein L19 protein_id : NP_033104.1

name	Stac2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122509 CCDS:CCDS25338.1 GeneID:217154 MGI:2144518
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : SH3 and cysteine rich domain 2 protein_id : NP_666140.1

name	Fbxl20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111494221 CCDS:CCDS25339.1 GeneID:72194 MGI:1919444
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 20 protein_id : NP_082425.1

name	LOC665606 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390780 GeneID:665606
definition	codon_start : 1 product : hypothetical protein protein_id : XP_983200.1

name	Pparbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583906 GeneID:19014 MGI:1100846
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0035257 - nuclear hormone receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence TAS] [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP] [Evidence ISS]; GO:0007507 - heart development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence IMP] [Evidence IDA]; GO:0006590 - thyroid hormone generation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Ppar binding protein isoform 2 protein_id : NP_598788.2

name	Pparbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582398 GeneID:19014 MGI:1100846
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0035257 - nuclear hormone receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence TAS] [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP] [Evidence ISS]; GO:0007507 - heart development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence IMP] [Evidence IDA]; GO:0006590 - thyroid hormone generation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : Ppar binding protein isoform 3 protein_id : NP_001073587.1

name	Pparbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582430 CCDS:CCDS25341.1 GeneID:19014 MGI:1100846
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0035257 - nuclear hormone receptor binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence TAS] [Evidence IDA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007275 - development [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045444 - fat cell differentiation [Evidence IMP] [Evidence ISS]; GO:0007507 - heart development [Evidence IMP]; GO:0001889 - liver development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS] [Evidence IMP] [Evidence IDA]; GO:0006590 - thyroid hormone generation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IC] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Ppar binding protein isoform 1 protein_id : NP_038662.2

name	LOC100039982 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262406 GeneID:100039982
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473941.1

name	Crkrs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794424 CCDS:CCDS25342.1 GeneID:69131 MGI:1098802
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : protein kinase for splicing component; CDC2-related kinase 7 product : CDC2-related protein kinase 7 protein_id : NP_081228.1

name	Neurod2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982781 CCDS:CCDS25343.1 GeneID:18013 MGI:107755
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008306 - associative learning [Evidence IMP]; GO:0001662 - behavioral fear response [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048666 - neuron development [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : neurogenic differentiation 2 protein_id : NP_035025.2

name	Ppp1r1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536256 CCDS:CCDS25344.1 GeneID:19049 MGI:94860
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS] GO_function : GO:0004864 - protein phosphatase inhibitor activity [Evidence TAS]; GO:0008599 - protein phosphatase type 1 regulator activity [Evidence IEA]; GO:0004865 - type 1 serine/threonine specific protein phosphatase inhibitor activity [Evidence TAS] GO_process : GO:0007621 - negative regulation of female receptivity [Evidence IMP] [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006350 - transcription [Evidence IMP] codon_start : 1 product : protein phosphatase 1, regulatory (inhibitor) subunit 1B protein_id : NP_659077.1

name	Stard3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946984 CCDS:CCDS25345.1 GeneID:59045 MGI:1929618
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005770 - late endosome [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015485 - cholesterol binding [Evidence IEA]; GO:0017127 - cholesterol transporter activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : steroidogenic acute regulatory protein related product : START domain containing 3 protein_id : NP_067522.1

name	Tcap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248560 CCDS:CCDS25346.1 GeneID:21393 MGI:1330233
definition	GO_component : GO:0030018 - Z disc [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045214 - sarcomere organization [Evidence ISS] codon_start : 1 note : Telethonin product : titin-cap protein_id : NP_035670.2

name	Pnmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679405 CCDS:CCDS25347.1 GeneID:18948 MGI:97724
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0004603 - phenylethanolamine N-methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042423 - catecholamine biosynthesis [Evidence IEA] codon_start : 1 product : phenylethanolamine-N-methyltransferase protein_id : NP_032916.1

name	Perld1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326508 CCDS:CCDS25348.1 GeneID:320655 MGI:2444461
definition	codon_start : 1 product : per1-like domain containing 1 protein_id : NP_001028709.2

name	Erbb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873610 CCDS:CCDS25349.1 GeneID:13866 MGI:95410
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence NAS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0007507 - heart development [Evidence IMP]; GO:0042552 - myelination [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0045765 - regulation of angiogenesis [Evidence NAS]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 note : Neu oncogene; avian erythroblastosis oncogene B 2 product : v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog protein_id : NP_001003817.1

name	1810046J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384990 CCDS:CCDS25350.1 GeneID:103742 MGI:1913678
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 note : novel protein similar to C17orf37 product : hypothetical protein LOC103742 protein_id : NP_079835.1

name	Grb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754066 CCDS:CCDS25351.1 GeneID:14786 MGI:102683
definition	GO_component : GO:0005829 - cytosol [Evidence TAS] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005070 - SH3/SH2 adaptor activity [Evidence TAS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 product : growth factor receptor bound protein 7 protein_id : NP_034476.1

name	Ikzf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374152 CCDS:CCDS25352.1 GeneID:22780 MGI:1342542
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein, subfamily 1A, 3 (Aiolos) product : aiolos protein_id : NP_035901.1

name	Zpbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40786389 CCDS:CCDS25353.1 GeneID:69376 MGI:1916626
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : zona pellucida binding protein 2 isoform 1 protein_id : NP_081337.1

name	Zpbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40786536 CCDS:CCDS25354.1 GeneID:69376 MGI:1916626
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : zona pellucida binding protein 2 isoform 2 protein_id : NP_955451.1

name	Ormdl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385128 CCDS:CCDS25355.1 GeneID:66612 MGI:1913862
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : ORM1-like 3 protein_id : NP_079937.1

name	Gm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262455 GeneID:192852 MGI:2684858
definition	codon_start : 1 product : similar to hCG2044133 protein_id : XP_001477035.1

name	LOC100040117 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262412 GeneID:100040117
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474159.1

name	Gsdm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925616 CCDS:CCDS25356.1 GeneID:450219 MGI:3044668
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0042637 - catagen [Evidence IMP]; GO:0042633 - hair cycle [Evidence IMP]; GO:0001942 - hair follicle development [Evidence IMP]; GO:0031069 - hair follicle morphogenesis [Evidence IMP]; GO:0001949 - sebaceous gland cell differentiation [Evidence IMP] codon_start : 1 note : bare skin; defolliculated product : gasdermin 3 protein_id : NP_001007462.1

name	Gsdm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270963 GeneID:76758 MGI:1921490
definition	codon_start : 1 product : gasdermin 2 protein_id : NP_084003.2

name	Gsdm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946666 CCDS:CCDS25358.1 GeneID:57911 MGI:1889509
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] codon_start : 1 product : gasdermin 1 protein_id : NP_067322.1

name	Psmd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19705424 CCDS:CCDS25359.1 GeneID:22123 MGI:98858
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : tissue specific transplantation antigen P91A product : proteasome 26S non-ATPase subunit 3 protein_id : NP_033465.1

name	Csf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753536 CCDS:CCDS25360.1 GeneID:12985 MGI:1339751
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] [Evidence NAS]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005138 - interleukin-6 receptor binding [Evidence IEA] GO_process : GO:0030851 - granulocyte differentiation [Evidence NAS]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : colony stimulating factor 3 protein_id : NP_034101.1

name	Thrap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119220579 CCDS:CCDS25361.1 GeneID:23989 MGI:1344385
definition	GO_component : GO:0000119 - mediator complex [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006366 - transcription from RNA polymerase II promoter [Evidence IMP] codon_start : 1 note : peroxisome proliferation activation receptor binding protein 2; thyroid hormone receptor-associated protein 100 kDa; genetic suppressor element 2 product : thyroid hormone receptor-associated protein 4 protein_id : NP_035999.2

name	Thra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017357 CCDS:CCDS25362.1 GeneID:21833 MGI:98742
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence TAS]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001502 - cartilage condensation [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0001503 - ossification [Evidence IMP]; GO:0007582 - physiological process [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TR alpha 1; c-erbAalpha; TR alpha 2 product : thyroid hormone receptor alpha protein_id : NP_835161.1

name	Nr1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625908 CCDS:CCDS25363.1 GeneID:217166 MGI:2444210
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007623 - circadian rhythm [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : rev-erbA(alpha); REV-ERBalpha; Rev-ErbA-alpha protein; nuclear receptor protein; rev-erb alpha; rev-erbA alpha; orphan nuclear receptor product : nuclear receptor subfamily 1, group D, member 1 protein_id : NP_663409.2

name	4121402D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311988 CCDS:CCDS25364.1 GeneID:74026 MGI:1921276
definition	codon_start : 1 exception : mismatches in translation note : male-specific lethal-1 homolog product : hampin protein_id : NP_082998.1

name	Casc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149744 GeneID:192160 MGI:2179723
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008298 - intracellular mRNA localization [Evidence IDA]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : Barentsz product : metastatic lymph node 51 protein_id : NP_619601.1

name	Rapgefl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124257963 GeneID:268480 MGI:3611446
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : Rap guanine nucleotide exchange factor (GEF)-like 1 protein_id : NP_001074394.1

name	Wipf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537556 CCDS:CCDS25366.1 GeneID:68524 MGI:1924462
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : WASP-binding protein; novel protein similar to WIRE protein product : Wire protein protein_id : NP_922922.1

name	Cdc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753368 CCDS:CCDS25367.1 GeneID:23834 MGI:1345150
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CDC18(S.pombe); cell division cycle 18 homolog (S.pombe)-like product : cell division cycle 6 homolog isoform a protein_id : NP_035929.1

name	Cdc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061453 CCDS:CCDS25368.1 GeneID:23834 MGI:1345150
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CDC18(S.pombe); cell division cycle 18 homolog (S.pombe)-like product : cell division cycle 6 homolog isoform b protein_id : NP_001020950.1

name	Rara (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116734873 GeneID:19401 MGI:97856
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003708 - retinoic acid receptor activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA]; GO:0001657 - ureteric bud development [Evidence IMP] codon_start : 1 note : RAR alpha 1 product : retinoic acid receptor, alpha protein_id : NP_033050.2

name	Gjc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174744 CCDS:CCDS25369.1 GeneID:353155 MGI:2384150
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0005922 - connexon complex [Evidence ISS]; GO:0005921 - gap junction [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0015285 - connexon channel activity [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007154 - cell communication [Evidence ISS]; GO:0016264 - gap junction assembly [Evidence ISS] codon_start : 1 note : connexin-30.2; connexin 30.2 product : gap junction membrane channel protein chi 1 protein_id : NP_848711.2

name	Top2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755849 CCDS:CCDS25370.1 GeneID:21973 MGI:98790
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003918 - DNA topoisomerase (ATP-hydrolyzing) activity [Evidence IGI] [Evidence IDA]; GO:0003916 - DNA topoisomerase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030261 - chromosome condensation [Evidence IMP]; GO:0007059 - chromosome segregation [Evidence IMP] [Evidence IDA]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006265 - DNA topological change [Evidence IDA]; GO:0006268 - DNA unwinding during replication [Evidence IEA]; GO:0040016 - embryonic cleavage [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DNA Topoisomerase II alpha product : topoisomerase (DNA) II alpha protein_id : NP_035753.1

name	Igfbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6981086 CCDS:CCDS25371.1 GeneID:16010 MGI:96439
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : differentially expressed in B16F10 2; Band 3A product : insulin-like growth factor binding protein 4 protein_id : NP_034647.1

name	Tns4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369790 CCDS:CCDS25372.1 GeneID:217169 MGI:2144377
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : C-terminal tensin-like protein_id : NP_766152.1

name	Ccr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268121 CCDS:CCDS25373.1 GeneID:12775 MGI:103011
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-C) receptor 7 product : chemokine (C-C motif) receptor 7 protein_id : NP_031745.2

name	Smarce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181166 CCDS:CCDS25374.1 GeneID:57376 MGI:1927347
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA] codon_start : 1 note : BAF57 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 protein_id : NP_065643.1

name	Krt222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370460 CCDS:CCDS25375.1 GeneID:268481 MGI:2442728
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : RIKEN cDNA 6330509G02 protein_id : NP_766534.1

name	LOC666613 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262451 GeneID:666613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 465 ESTs, 5 Proteins product : similar to ribosomal protein S6 pseudo : _no_value transcript_id : XR_035670.1

clone name	MSMg01-417J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389B06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304H22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358N18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-173B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-428B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-394L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388O06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164D13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-172P12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-452B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-300D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-174N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-324A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271G16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-303L05.b	B6Ng01-303L05.g
ACC	GA097439	GA097440
length	923	1,024
definition	B6Ng01-303L05.b	B6Ng01-303L05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(97,996,320 - 97,997,223)	(98,129,945 - 98,130,967)
sequence	gaattccaaggtgtggccttaaccaacactgaagcacactcccaattcat tcctgctgtcatctaagaaagtctagctacacttcagaacagcaaaagat catgtgggaacagaatcagctgacagcaaccccagcgtctcagactctaa tcacggcctattacacactccaaaagcagtcagttgccagaggccttggc ctcctgagtgaccttttaaaaagagaaacacaacgtaaactgccaacgta aactcattcttccaagctactccatggtaacttaccattgatggtaagag taccagatgctggacagcaaatactaccaaaaataaataaataaataaat aaaagttcttcattgaaaaaaactactagccaggcagtggcagtacacac ctttaatcccagtacttgggaggcagatttctgagttcgaggccagcctg atctacagaatgagttccaggacagccagggctacacagagaaacccagt ctggaaaaaccaaaacaaacaaacaaacaaatgtacaaccagtggtatca ttttcagagatctgaacaaactttgtaacatccaatggtagcctgactag gtcaaatctttatggcatctggaatattctgaagagagattttaggacag aatattcataaagaaacccatagctaaagctgcaagattttctgcttttt cttctttttggttttcaagagacaggctttctctgtattgcccctagctg ttctggaactcaccctgtatgtagaccagactggccctcaaaccaaaaga tctgcctgctttctgcctttccaagtactgtgtattaatggtgcatgtta tcaccgggcccagcctgataaaggtttctttttcatgaaaaaccttcccc tggaaagtaattttttcacaatg	gaattcttggtgctgctatctttttctactatatttatttcatatctagg tattttcccacaaagggcctgagtttcttctggacttcttagcaggttct agtcttggacttaaggctatagatctgacaccctgggataaccttggaag tgggtgtcaggcctggcagaattagaaggagggaaagcagctctagtccc tcaaaggacattcagaatgcacggtgactgctttcctgtgcctccaacac ctggagcagaggtgacccagtcaccaaggcctataaagagaggaggaggc ttttctttttttttttttttttttttttttaaatttatttatttattata tgtaagtacactgtagctgtcctcagacactccagaagagggagtcagac ctcgttagggatggttgtgagccaccatgtggttgctgggatttgaactc ctgacctttggaagagcagtcgggtgctcttacccactgagccatctcac cagccccggaggaggcttttctacagagaatagatacctttcttcctttg ctttgtgctatcttcactgctctgtatgtcagacttgaaagagcagctct gtcaacagtagccacctatcctcaaacaatattcactatgactgtcctgc actacattgagcagccagtcccatgggtggaacgacaggtctcagttcta aagcatcaacactatcttctcttcttcctcatccccctgacaggacaggt tttggcacagtttcttgataccaacagccctgaggcacttggatgcagga tggggcctagaaaggattttttttccagactgtccctaggggaataatga gggcttctcacccctgtctgtgagtacagaccatgacagcccctgacagt ctaaggcagatcagaaaaggttggagctagaggcagatcctggtgtttct caaggccctgaggttactaaaaaaagaaagacaggttctaggagtgtaga agtaggatgggagtcggaagcgtg
quality values	Open. Hide. 58 33 27 28 58 58 25 22 36 58 58 58 58 58 58 38 58 58 62 62 62 62 62 38 38 62 54 62 62 62 54 47 62 56 62 56 56 56 28 62 62 62 47 47 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 51 47 51 62 62 62 62 62 62 62 62 62 56 62 62 51 62 62 62 62 56 62 62 56 56 62 62 62 56 62 56 62 50 62 56 62 62 56 62 62 39 62 43 47 38 56 43 54 62 62 62 62 62 62 47 62 62 62 56 62 38 62 62 47 33 52 54 62 62 52 48 52 52 43 52 46 62 54 62 49 54 36 43 42 62 42 52 42 52 43 62 52 52 62 52 52 62 62 62 62 54 54 62 43 62 32 62 42 62 62 46 62 31 46 52 54 41 52 58 42 47 54 58 42 44 48 54 58 32 54 46 52 42 52 52 48 42 32 58 42 58 36 20 9 47 52 28 31 33 48 54 39 38 35 41 42 46 42 22 21 52 34 50 37 52 46 23 14 47 13 15 28 35 25 52 41 32 46 42 29 50 47 33 39 52 52 32 25 39 33 32 11 52 52 46 39 52 38 37 18 52 25 24 18 17 13 9 17 10 13 14 52 39 52 52 23 52 34 39 40 33 35 24 48 25 29 27 21 18 29 26 49 50 42 31 50 36 42 51 50 29 33 34 46 13 12 21 15 16 25 15 47 41 19 14 9 20 14 50 40 30 42 32 53 32 25 28 19 29 25 51 21 39 12 23 13 6 9 18 13 9 10 21 30 41 20 29 37 16 31 30 31 46 29 46 29 31 36 42 37 28 19 12 40 23 22 18 15 17 11 13 25 21 13 50 19 39 18 12 12 12 7 37 15 28 26 11 22 21 16 31 16 18 24 7 19 8 18 13 10 15 14 8 39 26 15 21 11 7 9 6 13 8 6 6 10 21 12 15 10 19 20 13 34 30 18 6 9 16 26 17 13 7 8 16 10 15 15 25 26 21 16 7 13 31 23 16 10 9 14 18 21 40 26 27 12 32 24 17 17 13 25 16 15 6 15 17 17 21 28 12 12 23 16 13 14 14 17 13 19 23 11 8 6 6 6 19	Open. Hide. 62 47 51 39 62 62 62 62 62 62 62 56 51 41 38 24 44 45 59 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 51 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 49 49 59 62 62 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 51 51 50 34 45 43 43 50 45 34 45 50 56 34 36 45 34 28 27 28 32 34 43 50 34 34 37 45 25 32 24 27 24 27 19 35 38 38 30 38 38 35 42 26 16 32 27 22 27 22 39 39 24 15 38 25 14 37 23 41 38 40 31 28 31 30 13 24 24 28 27 31 24 38 50 51 51 56 51 42 39 50 51 32 42 43 27 38 40 39 43 43 38 43 43 27 22 38 17 38 32 27 38 38 42 38 56 56 46 41 39 41 35 25 47 50 42 38 43 41 34 40 38 43 50 46 47 43 43 42 50 43 17 40 18 22 19 14 43 52 52 42 42 22 50 29 29 34 32 40 34 43 52 40 40 52 33 40 37 27 33 30 24 33 35 33 30 27 39 43 35 33 46 52 52 52 40 32 25 19 34 35 20 29 27 35 52 47 50 50 42 35 37 25 13 34 22 37 37 19 40 22 50 35 30 34 50 50 48 37 47 46 43 30 38 33 50 34 47 37 37 37 28 48 32 53 50 40 42 40 50 40 41 46 31 28 29 50 35 37 37 39 48 46 50 41 43 33 32 42 11 42 19 18 22 25 50 40 42 27 52 26 34 31 21 41 51 50 50 42 35 40 37 41 43 35 50 52 51 30 39 54 23 39 51 49 39 50 41 50 38 41 36 42 50 32 26 53 53 39 39 43 41 37 41 37 38 28 35 38 30 37 49 37 40 44 40 51 39 30 42 53 36 49 21 44 50 37 42 32 49 29 29 45 52 21 40 39 49 52 54 29 52 54 54 53 32 41 37 51 46 19 21 40 37 32 38 54 27 32 42 37 37 22 49 45 31 33 31 40 47 31 31 31 32 37 31 46 32 32 45 53 33 21 18 23 51 33 32 32 31 33 31 32 52 31 45 32 32 29 36 37 53 52 52 32 37 32 39 22 32 32 46 29 21 28 14 31 15 51 45 31 33 42 28 21 30 29 34 32 51 42 31 30 31 31 33 33 33 25 42 21 32 31 28 27 28 48 42 28 31 25 9 46 19 25 31 21 46 31 38 25 22 34 34 15 10 26 31 31 42 46 46 41 31 36 24 31 18 27 33 7 16 27 30 22 43 48 48 41 41 37 19 14 25 15 15 25 18 31 28 16 21 48 18 32 35 23 41 37 21 30 12 19 7 6 6 15 23 7 41 31 21 22 29 31 31 31 16 24 44 37 6 6 17 30 25 19 31 28 31 42 24 15 36 9 12 16 37 20 27 30 24 16 33 21 20 27 38 48 48 32 13 26 23 19 17 24 20 14 16 22 25 24 33 19 27 17 21 22 17 7 7 9 26 31 19 5 17 32 10 19 9 4 7 12 23 21 28 34 14 33 10 6 10 21 13 11 16 13 11 5 5 6 5 27 38 8 6 5 6 5 20 25 5 27 8 24 13 11 5 13 8 14 6 6 9 14 19 16 30 28 40 24 6 19 28 5 5 11 11 20 13 9 38 20 24 24 19 11 20 7 5 14 4 3 3 3 4 19 3 4 5 3 7 8 6 17 34 7 11 5 6 12 6 6 14 5 2 4 10 9 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_97996320_97997223
seq2: B6Ng01-303L05.b_41_963

seq1  GAATTCCAAGGTGTGGCCTTAACCAACACTGAAGCACACTCCCAATTCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAGGTGTGGCCTTAACCAACACTGAAGCACACTCCCAATTCAT  50

seq1  TCCTGCTGTCATCTAAGAAAGTCTAGCTACACTTCAGAACAGCAAAAGAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCTGTCATCTAAGAAAGTCTAGCTACACTTCAGAACAGCAAAAGAT  100

seq1  CATGTGGGAACAGAATCAGCTGACAGCAACCCCAGCGTCTCAGACTCTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGGGAACAGAATCAGCTGACAGCAACCCCAGCGTCTCAGACTCTAA  150

seq1  TCACGGCCTATTACACACTCCAAAAGCAGTCAGTTGCCAGAGGCCTTGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGGCCTATTACACACTCCAAAAGCAGTCAGTTGCCAGAGGCCTTGGC  200

seq1  CTCCTGAGTGACCTTTTAAAAAGAGAAACACAACGTAAACTGCCAACGTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGAGTGACCTTTTAAAAAGAGAAACACAACGTAAACTGCCAACGTA  250

seq1  AACTCATTCTTCCAAGCTACTCCATGGTAACTTACCATTGATGGTAAGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCATTCTTCCAAGCTACTCCATGGTAACTTACCATTGATGGTAAGAG  300

seq1  TACCAGATGCTGGACAGCAAATACTACCAAAAATAAATAAATAAATAAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAGATGCTGGACAGCAAATACTACCAAAAATAAATAAATAAATAAAT  350

seq1  AAAAGTTCTTCATTGAAAAAAACTACTAGCCAGGCAGTGGCAGTACACAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGTTCTTCATTGAAAAAAACTACTAGCCAGGCAGTGGCAGTACACAC  400

seq1  CTTTAATCCCAGTACTTGGGAGGCAGATTTCTGAGTTCGAGGCCAGCCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAATCCCAGTACTTGGGAGGCAGATTTCTGAGTTCGAGGCCAGCCTG  450

seq1  ATCTACAGAATGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTACAGAATGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCAGT  500

seq1  CTGGAAAAACCAAAACAAACAAACAAACAAATGTACAACCAGTGGTATCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAAAAACCAAAACAAACAAACAAACAAATGTACAACCAGTGGTATCA  550

seq1  TTTTCAGAGATCTGAACAAACTTTGTAACATCCAATGGTAGCCTGACTAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCAGAGATCTGAACAAACTTTGTAACATCCAATGGTAGCCTGACTAG  600

seq1  GTCAAATCTTTATGGCATCTGGAATATTCTGAAGAGAGATTTTAGGACAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAAATCTTTATGGCATCTGGAATATTCTGAAGAGAGATTTTAGGACAG  650

seq1  AATATTCATAAAGAAACCCATAGCTAAAGCTGCAAGA-TTTCTGC-TTTT  698
      ||||||||||||||||||||||||||||||||||||| ||||||| ||||
seq2  AATATTCATAAAGAAACCCATAGCTAAAGCTGCAAGATTTTCTGCTTTTT  700

seq1  CTTC-TTTTGGTTTTCAAGAGACAGGCTTTCTCTGTATTG-CCCTAGCTG  746
      |||| ||||||||||||||||||||||||||||||||||| |||||||||
seq2  CTTCTTTTTGGTTTTCAAGAGACAGGCTTTCTCTGTATTGCCCCTAGCTG  750

seq1  TCCTGGAACTCACCCTGTATGTAGACCAGACTGG-CCTCAAACCAAAAGA  795
      | |||||||||||||||||||||||||||||||| |||||||||||||||
seq2  TTCTGGAACTCACCCTGTATGTAGACCAGACTGGCCCTCAAACCAAAAGA  800

seq1  TCTGCCTGC-TTCTGCC-TTCCAAGTACTG-GGATTAATGGTGCATGTCA  842
      ||||||||| ||||||| |||||||||||| | ||||||||||||||| |
seq2  TCTGCCTGCTTTCTGCCTTTCCAAGTACTGTGTATTAATGGTGCATGTTA  850

seq1  GCAC--GGCCCAG-CTGA-GAAGGTTTC--TTTCAAG-AAAACCTTCCC-  884
       |||  ||||||| ||||  ||||||||  ||||| | ||||||||||| 
seq2  TCACCGGGCCCAGCCTGATAAAGGTTTCTTTTTCATGAAAAACCTTCCCC  900

seq1  -TGTAAGTA--GTTTTCACAAGG  904
        | |||||   ||||||||| |
seq2  TGGAAAGTAATTTTTTCACAATG  923

seq1: chr11_98129945_98130967
seq2: B6Ng01-303L05.g_66_1089 (reverse)

seq1  CACGCTTTCCGACTCCCATCCTTACCTTCCTTCCACTCCTAGAA-CTGTC  49
      ||||| ||||||||||||||||   ||||  | ||||||||||| |||||
seq2  CACGC-TTCCGACTCCCATCCT--ACTTC--TACACTCCTAGAACCTGTC  45

seq1  TT--CTTTTTTAGTAACCTCAGGCCCTTGAGAAACA-CAGGATCTGCCTC  96
      ||   |||||||||||||||||| |||||||||||| |||||||||||||
seq2  TTTCTTTTTTTAGTAACCTCAGGGCCTTGAGAAACACCAGGATCTGCCTC  95

seq1  TAGCTTCCAACCTTTTCCTGATCTGCCTTAGACTGTCAGGGGCTGTCATG  146
      |||| ||||||||||| |||||||||||||||||||||||||||||||||
seq2  TAGC-TCCAACCTTTT-CTGATCTGCCTTAGACTGTCAGGGGCTGTCATG  143

seq1  GTCTGTTACTCACAGACA-GGGTGAGAAGCCCTCA-TATTCCCCTA-GGA  193
      ||||| |||||||||||| |||||||||||||||| |||||||||| |||
seq2  GTCTG-TACTCACAGACAGGGGTGAGAAGCCCTCATTATTCCCCTAGGGA  192

seq1  CAGTCTGG-AAAAAAATCC-TTCTAGGCCCCATCCTGCATCCAAGTGCCT  241
      |||||||| |||||||||| ||||||||||||||||||||||||||||||
seq2  CAGTCTGGAAAAAAAATCCTTTCTAGGCCCCATCCTGCATCCAAGTGCCT  242

seq1  CAGGGCTGTTGGTATCAAGAAACTGTGCCAAAACCTGTCCTGTCAGGGGG  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCTGTTGGTATCAAGAAACTGTGCCAAAACCTGTCCTGTCAGGGGG  292

seq1  ATGAGGAAGAAGAGAAGATAGTGTTGATGCTTTAGAACTGAGACCTGTCG  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGAAGAAGAGAAGATAGTGTTGATGCTTTAGAACTGAGACCTGTCG  342

seq1  TTCCACCCATGGGACTGGCTGCTCAATGTAGTGCAGGACAGTCATAGTGA  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCACCCATGGGACTGGCTGCTCAATGTAGTGCAGGACAGTCATAGTGA  392

seq1  ATATTGTTTGAGGATAGGTGGCTACTGTTGACAGAGCTGCTCTTTCAAGT  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGTTTGAGGATAGGTGGCTACTGTTGACAGAGCTGCTCTTTCAAGT  442

seq1  CTGACATACAGAGCAGTGAAGATAGCACAAAGCAAAGGAAGAAAGGTATC  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACATACAGAGCAGTGAAGATAGCACAAAGCAAAGGAAGAAAGGTATC  492

seq1  TATTCTCTGTAGAAAAGCCTCCTCCGGGGCTGGTGAGATGGCTCAGTGGG  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCTCTGTAGAAAAGCCTCCTCCGGGGCTGGTGAGATGGCTCAGTGGG  542

seq1  TAAGAGCACCCGACTGCTCTTCCAAAGGTCAGGAGTTCAAATCCCAGCAA  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAGCACCCGACTGCTCTTCCAAAGGTCAGGAGTTCAAATCCCAGCAA  592

seq1  CCACATGGTGGCTCACAACCATCCCTAACGAGGTCTGACTCCCTCTTCTG  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACATGGTGGCTCACAACCATCCCTAACGAGGTCTGACTCCCTCTTCTG  642

seq1  GAGTGTCTGAGGACAGCTACAGTGTACTTACATATAATAAATAAATAAAT  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGTCTGAGGACAGCTACAGTGTACTTACATATAATAAATAAATAAAT  692

seq1  TTAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAGCCTCCTCCTCTCTTTAT  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAGCCTCCTCCTCTCTTTAT  742

seq1  AGGCCTTGGTGACTGGGTCACCTCTGCTCCAGGTGTTGGAGGCACAGGAA  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCTTGGTGACTGGGTCACCTCTGCTCCAGGTGTTGGAGGCACAGGAA  792

seq1  AGCAGTCACCGTGCATTCTGAATGTCCTTTGAGGGACTAGAGCTGCTTTC  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGTCACCGTGCATTCTGAATGTCCTTTGAGGGACTAGAGCTGCTTTC  842

seq1  CCTCCTTCTAATTCTGCCAGGCCTGACACCCACTTCCAAGGTTATCCCAG  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTTCTAATTCTGCCAGGCCTGACACCCACTTCCAAGGTTATCCCAG  892

seq1  GGTGTCAGATCTATAGCCTTAAGTCCAAGACTAGAACCTGCTAAGAAGTC  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTCAGATCTATAGCCTTAAGTCCAAGACTAGAACCTGCTAAGAAGTC  942

seq1  CAGAAGAAACTCAGGCCCTTTGTGGGAAAATACCTAGATATGAAATAAAT  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGAAACTCAGGCCCTTTGTGGGAAAATACCTAGATATGAAATAAAT  992

seq1  ATAGTAGAAAAAGATAGCAGCACCAAGAATTC  1023
      ||||||||||||||||||||||||||||||||
seq2  ATAGTAGAAAAAGATAGCAGCACCAAGAATTC  1024

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information