MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-319L05
Chromosome	11 (Build37)
Map Location	101,309,730 - 101,429,850
singlet/doublet	doublet
Overlap gene	Ifi35, Vat1, Rnd2, Brca1, Nbr1
Upstream gene	Klhl10, Klhl11, Acly, Ttc25, Cnp1, Dnajc7, Nkiras2, A930006D11Rik, D11Lgp2e, Gcn5l2, Hspb9, Rab5c, LOC380728, Hcrt, Ghdc, Stat5b, Stat5a, Stat3, Ptrf, Atp6v0a1, Naglu, Hsd17b1, Coasy, Mlx, Psmc3ip, 1300010M03Rik, Tubg1, Tubg2, Plekhh3, Ccr10, Cntnap1, Ezh1, Ramp2, Vps25, Wnk4, Ccdc56, Cntd1, Becn1, Psme3, Aoc2, Aoc3, LOC629949, G6pc, Aarsd1, 1700113I22Rik, Rundc1, Rpl27
Downstream gene	Tmem106a, LOC667306, Rdm1, Arl4d, LOC100038842, Dhx8, Etv4, Meox1, LOC194960, Sost, Dusp3, 1700006E09Rik, Mpp3, Cd300lg, Mpp2, Ppy, Pyy, LOC100040687, LOC666411, Nags, Tmem101, Lsm12, G6pc3, Hdac5, BC030867, Asb16, 2010008E23Rik, Ubtf, Slc4a1, Rap2ip, Slc25a39, Grn, BC025575, Itga2b, Mdk-ps1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Klhl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66720 MGI:2181067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217194 MGI:2388648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acly (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104112 MGI:103251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74407 MGI:1921657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12799 MGI:88437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56354 MGI:1928373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkiras2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71966 MGI:1919216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930006D11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278304 MGI:3608347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D11Lgp2e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80861 MGI:1931560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcn5l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14534 MGI:1343101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hspb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75482 MGI:1922732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	Rab5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19345 MGI:105306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC380728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcrt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15171 MGI:1202306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ghdc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80860 MGI:1931556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20851 MGI:103035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20850 MGI:103036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stat3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ptrf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19285 MGI:1277968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11975 MGI:103286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Naglu (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27419 MGI:1351641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd17b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15485 MGI:105077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coasy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71743 MGI:1918993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21428 MGI:108398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmc3ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19183 MGI:1098610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300010M03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67998 MGI:1915248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tubg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103733 MGI:101834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tubg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103768 MGI:2144208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217198 MGI:2384950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12777 MGI:1096320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntnap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53321 MGI:1858201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ezh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14055 MGI:1097695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ramp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54409 MGI:1859650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28084 MGI:106354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wnk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69847 MGI:1917097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52469 MGI:1098757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cntd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68107 MGI:1923965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Becn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56208 MGI:1891828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psme3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19192 MGI:1096366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aoc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237940 MGI:2668431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aoc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11754 MGI:1306797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	G6pc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14377 MGI:95607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aarsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69684 MGI:1916934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700113I22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73635 MGI:1920885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rundc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217201 MGI:2144506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19942 MGI:98036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifi35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70110 MGI:1917360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26949 MGI:1349450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11858 MGI:1338755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12189 MGI:104537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17966 MGI:108498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem106a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217203 MGI:1922056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rdm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66599 MGI:1913849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl4d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80981 MGI:1933155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217207 MGI:1306823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etv4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18612 MGI:99423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Meox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17285 MGI:103220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 6 Proteins

name	Sost (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74499 MGI:1921749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72349 MGI:1919599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700006E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75437 MGI:1922687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 2 Proteins

name	Mpp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13384 MGI:1328354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd300lg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52685 MGI:1289168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50997 MGI:1858257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19064 MGI:97753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pyy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217212 MGI:99924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC666411 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 41 Proteins

name	Nags (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217214 MGI:2387600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tmem101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76547 MGI:1923797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268490 MGI:1919592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	G6pc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68401 MGI:1915651
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15184 MGI:1333784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC030867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217216 MGI:2387601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217217 MGI:2654437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010008E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72053 MGI:1919303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubtf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21429 MGI:98512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Slc4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20533 MGI:109393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rap2ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51799 MGI:1858752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68066 MGI:1196386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14824 MGI:95832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217219 MGI:2448496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itga2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16399 MGI:96601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mdk-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17243 MGI:103029
definition	gene_synonym : Mak-rs1 note : midkine pseudogene 1 pseudo : _no_value

name	Klhl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802863 GeneID:66720 MGI:2181067
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 10 (Drosophila) transcript_id : NM_025727.2

name	Klhl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803034 GeneID:217194 MGI:2388648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 11 (Drosophila) transcript_id : NM_172565.2

name	Acly (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254106 GeneID:104112 MGI:103251
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP citrate lyase transcript_id : NM_134037.2

name	Ttc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358956 GeneID:74407 MGI:1921657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 25 transcript_id : NM_028918.2

name	Cnp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753475 GeneID:12799 MGI:88437
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclic nucleotide phosphodiesterase 1 transcript_id : NM_009923.1

name	Dnajc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130620 GeneID:56354 MGI:1928373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 7 transcript_id : NM_019795.4

name	Nkiras2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130408 GeneID:71966 MGI:1919216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFKB inhibitor interacting Ras-like protein 2 transcript_id : NM_028024.2

name	A930006D11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374044 GeneID:278304 MGI:3608347
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930006D11Rik gene transcript_id : NM_177790.3

name	D11Lgp2e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70608132 GeneID:80861 MGI:1931560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 11, Lothar Hennighausen 2, expressed transcript_id : NM_030150.2

name	Gcn5l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83999996 GeneID:14534 MGI:1343101
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GCN5 general control of amino acid synthesis-like 2 (yeast) transcript_id : NM_001038010.1

name	Gcn5l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803465 GeneID:14534 MGI:1343101
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GCN5 general control of amino acid synthesis-like 2 (yeast) transcript_id : NM_020004.3

name	Hspb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262512 GeneID:75482 MGI:1922732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : heat shock protein, alpha-crystallin-related, B9 transcript_id : XM_894891.3

name	Rab5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377910 GeneID:19345 MGI:105306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB5C, member RAS oncogene family transcript_id : NM_024456.3

name	LOC380728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:124487120 GeneID:380728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily H (eag-related), member 4 transcript_id : NM_001081194.1

name	Hcrt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802328 GeneID:15171 MGI:1202306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypocretin transcript_id : NM_010410.2

name	Ghdc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994198 GeneID:80860 MGI:1931556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GH3 domain containing transcript_id : NM_031871.1

name	Stat5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543779 GeneID:20851 MGI:103035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 5B transcript_id : NM_011489.2

name	Stat5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981473 GeneID:20850 MGI:103036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 5A transcript_id : NM_011488.2

name	Stat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253928 GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 3 transcript_id : NM_213660.2

name	Stat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253924 GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 3 transcript_id : NM_011486.4

name	Stat3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253927 GeneID:20848 MGI:103038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal transducer and activator of transcription 3 transcript_id : NM_213659.2

name	Ptrf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043973 GeneID:19285 MGI:1277968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase I and transcript release factor transcript_id : NM_008986.2

name	Atp6v0a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539453 GeneID:11975 MGI:103286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit A1 transcript_id : NM_016920.2

name	Naglu (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305298 GeneID:27419 MGI:1351641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB) transcript_id : NM_013792.1

name	Hsd17b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754247 GeneID:15485 MGI:105077
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 1 transcript_id : NM_010475.1

name	Coasy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386908 GeneID:71743 MGI:1918993
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Coenzyme A synthase transcript_id : NM_027896.3

name	Mlx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560536 GeneID:21428 MGI:108398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAX-like protein X transcript_id : NM_011550.2

name	Psmc3ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982094 GeneID:19183 MGI:1098610
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein transcript_id : NM_008949.2

name	1300010M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357475 GeneID:67998 MGI:1915248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300010M03 gene transcript_id : NM_028933.2

name	1300010M03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802672 GeneID:67998 MGI:1915248
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300010M03 gene transcript_id : NM_026501.2

name	Tubg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129919 GeneID:103733 MGI:101834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, gamma 1 transcript_id : NM_134024.2

name	Tubg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527245 GeneID:103768 MGI:2144208
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, gamma 2 transcript_id : NM_134028.1

name	Plekhh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130249 GeneID:217198 MGI:2384950
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family H (with MyTH4 domain) member 3 transcript_id : NM_146030.2

name	Ccr10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865996 GeneID:12777 MGI:1096320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 10 transcript_id : NM_007721.4

name	Cntnap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116063559 GeneID:53321 MGI:1858201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : contactin associated protein-like 1 transcript_id : NM_016782.2

name	Ezh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679718 GeneID:14055 MGI:1097695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enhancer of zeste homolog 1 (Drosophila) transcript_id : NM_007970.1

name	Ramp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71361672 GeneID:54409 MGI:1859650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor (calcitonin) activity modifying protein 2 transcript_id : NM_019444.2

name	Vps25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981981 GeneID:28084 MGI:106354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 25 (yeast) transcript_id : NM_026776.3

name	Wnk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793432 GeneID:69847 MGI:1917097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WNK lysine deficient protein kinase 4 transcript_id : NM_175638.2

name	Ccdc56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387850 GeneID:52469 MGI:1098757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 56 transcript_id : NM_026618.2

name	Cntd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367867 GeneID:68107 MGI:1923965
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin N-terminal domain containing 1 transcript_id : NM_026562.2

name	Becn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352751 GeneID:56208 MGI:1891828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) transcript_id : NM_019584.3

name	Psme3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130228 GeneID:19192 MGI:1096366
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteaseome (prosome, macropain) 28 subunit, 3 transcript_id : NM_011192.3

name	Aoc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34098971 GeneID:237940 MGI:2668431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amine oxidase, copper containing 2 (retina-specific) transcript_id : NM_178932.1

name	Aoc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753065 GeneID:11754 MGI:1306797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amine oxidase, copper containing 3 transcript_id : NM_009675.1

name	LOC629949 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262523 GeneID:629949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to ribosomal protein L37a transcript_id : XM_894901.2

name	G6pc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131011 GeneID:14377 MGI:95607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose-6-phosphatase, catalytic transcript_id : NM_008061.3

name	Aarsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450212 GeneID:69684 MGI:1916934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanyl-tRNA synthetase domain containing 1 transcript_id : NM_144829.1

name	1700113I22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130264 GeneID:73635 MGI:1920885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700113I22 gene transcript_id : NM_026865.2

name	Rundc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364318 GeneID:217201 MGI:2144506
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN domain containing 1 transcript_id : NM_172566.2

name	Rpl27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343887 GeneID:19942 MGI:98036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L27 transcript_id : NM_011289.2

name	Ifi35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802826 GeneID:70110 MGI:1917360
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon-induced protein 35 transcript_id : NM_027320.3

name	Vat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364129 GeneID:26949 MGI:1349450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vesicle amine transport protein 1 homolog (T californica) transcript_id : NM_012037.2

name	Rnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753115 GeneID:11858 MGI:1338755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho family GTPase 2 transcript_id : NM_009708.1

name	Brca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560811 GeneID:12189 MGI:104537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : breast cancer 1 transcript_id : NM_009764.2

name	Nbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130692 GeneID:17966 MGI:108498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neighbor of Brca1 gene 1 transcript_id : NM_008676.2

name	Tmem106a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803040 GeneID:217203 MGI:1922056
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 106A transcript_id : NM_144830.3

name	Rdm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370751 GeneID:66599 MGI:1913849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD52 motif 1 transcript_id : NM_025654.2

name	Arl4d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802517 GeneID:80981 MGI:1933155
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 4D transcript_id : NM_025404.2

name	LOC100038842 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262365 GeneID:100038842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038842 transcript_id : XM_001471772.1

name	Dhx8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699439 GeneID:217207 MGI:1306823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 8 transcript_id : NM_144831.2

name	Etv4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121582413 GeneID:18612 MGI:99423
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ets variant gene 4 (E1A enhancer binding protein, E1AF) transcript_id : NM_008815.2

name	Meox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981618 GeneID:17285 MGI:103220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mesenchyme homeobox 1 transcript_id : NM_010791.3

name	LOC194960 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262527 GeneID:194960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 119 ESTs, 6 Proteins product : similar to ribosomal protein L27 transcript_id : XM_110983.6

name	Sost (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803308 GeneID:74499 MGI:1921749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sclerostin transcript_id : NM_024449.4

name	Dusp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353670 GeneID:72349 MGI:1919599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) transcript_id : NM_028207.2

name	1700006E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390843 GeneID:75437 MGI:1922687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 2 Proteins product : RIKEN cDNA 1700006E09 gene transcript_id : XM_126493.4

name	Mpp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026922 GeneID:13384 MGI:1328354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated 3 (MAGUK p55 subfamily member 3) transcript_id : NM_007863.2

name	Cd300lg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376657 GeneID:52685 MGI:1289168
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD300 antigen like family member G transcript_id : NM_027987.2

name	Mpp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347754 GeneID:50997 MGI:1858257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) transcript_id : NM_016695.2

name	Ppy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679452 GeneID:19064 MGI:97753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pancreatic polypeptide transcript_id : NM_008918.1

name	Pyy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703867 GeneID:217212 MGI:99924
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptide YY transcript_id : NM_145435.1

name	LOC666411 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390844 GeneID:666411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 41 Proteins product : similar to Peptidyl-prolyl cis-trans isomerase H (PPIase H) (Rotamase H) transcript_id : XM_983649.1

name	Nags (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22003873 GeneID:217214 MGI:2387600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglutamate synthase transcript_id : NM_145829.1

name	Nags (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383079 GeneID:217214 MGI:2387600
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetylglutamate synthase transcript_id : NM_178053.3

name	Tmem101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313231 GeneID:76547 MGI:1923797
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 101 transcript_id : NM_029649.1

name	Lsm12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360438 GeneID:268490 MGI:1919592
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM12 homolog (S. cerevisiae) transcript_id : NM_172947.2

name	G6pc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271523 GeneID:68401 MGI:1915651
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose 6 phosphatase, catalytic, 3 transcript_id : NM_175935.3

name	Hdac5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136298 GeneID:15184 MGI:1333784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 5 transcript_id : NM_010412.3

name	Hdac5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118136294 GeneID:15184 MGI:1333784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 5 transcript_id : NM_001077696.1

name	BC030867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347504 GeneID:217216 MGI:2387601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC030867 transcript_id : NM_153544.3

name	Asb16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130162 GeneID:217217 MGI:2654437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing 16 transcript_id : NM_148953.2

name	2010008E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368789 GeneID:72053 MGI:1919303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010008E23 gene transcript_id : NM_028076.2

name	Ubtf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205056 GeneID:21429 MGI:98512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding transcription factor, RNA polymerase I transcript_id : NM_011551.5

name	Ubtf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205052 GeneID:21429 MGI:98512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding transcription factor, RNA polymerase I transcript_id : NM_001044383.1

name	Slc4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755559 GeneID:20533 MGI:109393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 4 (anion exchanger), member 1 transcript_id : NM_011403.1

name	Rap2ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802231 GeneID:51799 MGI:1858752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rap2 interacting protein transcript_id : NM_016759.2

name	Slc25a39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384727 GeneID:68066 MGI:1196386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 39 transcript_id : NM_026542.2

name	Grn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357784 GeneID:14824 MGI:95832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : granulin transcript_id : NM_008175.3

name	BC025575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347501 GeneID:217219 MGI:2448496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025575 transcript_id : NM_199200.2

name	Itga2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754375 GeneID:16399 MGI:96601
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha 2b transcript_id : NM_010575.1

name	Klhl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385188 CCDS:CCDS25423.1 GeneID:66720 MGI:2181067
definition	codon_start : 1 product : kelch-like 10 protein_id : NP_080003.1

name	Klhl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369800 CCDS:CCDS25424.1 GeneID:217194 MGI:2388648
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 11 protein_id : NP_766153.1

name	Acly (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29293809 CCDS:CCDS25425.1 GeneID:104112 MGI:103251
definition	GO_component : GO:0005622 - intracellular [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003878 - ATP citrate synthase activity [Evidence TAS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006085 - acetyl-CoA biosynthesis [Evidence TAS]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : ATP citrate lyase protein_id : NP_598798.1

name	Ttc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358957 GeneID:74407 MGI:1921657
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 25 protein_id : NP_083194.2

name	Cnp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753476 CCDS:CCDS25427.1 GeneID:12799 MGI:88437
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0004113 - 2',3'-cyclic-nucleotide 3'-phosphodiesterase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0007409 - axonogenesis [Evidence IMP]; GO:0009214 - cyclic nucleotide catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 2',3'-cyclic-nucleotide 3'-phosphodiesterase product : cyclic nucleotide phosphodiesterase 1 protein_id : NP_034053.1

name	Dnajc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980994 CCDS:CCDS25428.1 GeneID:56354 MGI:1928373
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0031072 - heat shock protein binding [Evidence IEA] codon_start : 1 note : cytoplasmic CAR retention protein; tetratricopeptide repeat domain 2 product : DnaJ (Hsp40) homolog, subfamily C, member 7 protein_id : NP_062769.2

name	Nkiras2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312616 CCDS:CCDS25429.1 GeneID:71966 MGI:1919216
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : I-kappa-B-interacting Ras-like protein 2 product : NFKB inhibitor interacting Ras-like protein 2 protein_id : NP_082300.1

name	A930006D11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244324 CCDS:CCDS25430.1 GeneID:278304 MGI:3608347
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC278304 protein_id : NP_808458.1

name	D11Lgp2e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608133 CCDS:CCDS25431.1 GeneID:80861 MGI:1931560
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : DNA segment, Chr 11, Lothar Hennighausen 2, expressed protein_id : NP_084426.2

name	Gcn5l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83999997 CCDS:CCDS25432.1 GeneID:14534 MGI:1343101
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004402 - histone acetyltransferase activity [Evidence IDA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001756 - somitogenesis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; general control of amino acid synthesis, yeast homolog-like 2; PCAF-B/GCN5; general control of amino acid synthesis-like 2 product : general control of amino acid synthesis-like 2 isoform b protein_id : NP_001033099.1

name	Gcn5l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000003 CCDS:CCDS25433.1 GeneID:14534 MGI:1343101
definition	GO_component : GO:0000123 - histone acetyltransferase complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004402 - histone acetyltransferase activity [Evidence IDA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001756 - somitogenesis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; general control of amino acid synthesis, yeast homolog-like 2; PCAF-B/GCN5; general control of amino acid synthesis-like 2 product : general control of amino acid synthesis-like 2 isoform a protein_id : NP_064388.2

name	Hspb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262513 GeneID:75482 MGI:1922732
definition	codon_start : 1 product : heat shock protein, alpha-crystallin-related, B9 protein_id : XP_899984.2

name	Rab5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866024 GeneID:19345 MGI:105306
definition	GO_component : GO:0030139 - endocytic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB5C, member RAS oncogene family protein_id : NP_077776.2

name	LOC380728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124487121 GeneID:380728
definition	codon_start : 1 product : similar to potassium voltage-gated channel, subfamily H, member 4 protein_id : NP_001074663.1

name	Hcrt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754170 CCDS:CCDS25436.1 GeneID:15171 MGI:1202306
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_process : GO:0007631 - feeding behavior [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : prepro-orexin product : hypocretin protein_id : NP_034540.1

name	Ghdc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994199 CCDS:CCDS25437.1 GeneID:80860 MGI:1931556
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] codon_start : 1 product : D11lgp1 protein_id : NP_114077.1

name	Stat5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543780 CCDS:CCDS25438.1 GeneID:20851 MGI:103035
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0004871 - signal transducer activity [Evidence IGI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0046543 - development of secondary female sexual characteristics [Evidence IMP]; GO:0046544 - development of secondary male sexual characteristics [Evidence IGI] [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0007595 - lactation [Evidence IMP]; GO:0001553 - luteinization [Evidence IGI]; GO:0001779 - natural killer cell differentiation [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0045647 - negative regulation of erythrocyte differentiation [Evidence IGI]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence IGI]; GO:0045579 - positive regulation of B cell differentiation [Evidence IGI]; GO:0040018 - positive regulation of body size [Evidence IGI] [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0050729 - positive regulation of inflammatory response [Evidence IGI]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IGI]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence IGI]; GO:0045885 - positive regulation of survival gene product activity [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IGI]; GO:0007565 - pregnancy [Evidence IMP] [Evidence IGI]; GO:0042448 - progesterone metabolism [Evidence IGI]; GO:0030155 - regulation of cell adhesion [Evidence IMP]; GO:0030856 - regulation of epithelial cell differentiation [Evidence IMP]; GO:0019218 - regulation of steroid metabolism [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019915 - sequestering of lipid [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA]; GO:0043029 - T cell homeostasis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mammary gland factor STAT5B product : signal transducer and activator of transcription 5B protein_id : NP_035619.2

name	Stat5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755672 CCDS:CCDS25439.1 GeneID:20850 MGI:103036
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IGI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0046543 - development of secondary female sexual characteristics [Evidence IMP]; GO:0046544 - development of secondary male sexual characteristics [Evidence IGI] [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence IDA]; GO:0007595 - lactation [Evidence IMP]; GO:0001553 - luteinization [Evidence IGI]; GO:0030879 - mammary gland development [Evidence IMP]; GO:0001779 - natural killer cell differentiation [Evidence IGI]; GO:0043066 - negative regulation of apoptosis [Evidence IGI]; GO:0045647 - negative regulation of erythrocyte differentiation [Evidence IGI]; GO:0042104 - positive regulation of activated T cell proliferation [Evidence IDA] [Evidence IGI]; GO:0045579 - positive regulation of B cell differentiation [Evidence IGI]; GO:0040018 - positive regulation of body size [Evidence IGI]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] [Evidence IGI]; GO:0050729 - positive regulation of inflammatory response [Evidence IGI]; GO:0045086 - positive regulation of interleukin-2 biosynthesis [Evidence IGI]; GO:0045931 - positive regulation of progression through mitotic cell cycle [Evidence IGI]; GO:0045885 - positive regulation of survival gene product activity [Evidence IGI]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IGI]; GO:0007565 - pregnancy [Evidence IGI]; GO:0030155 - regulation of cell adhesion [Evidence IMP]; GO:0030856 - regulation of epithelial cell differentiation [Evidence IMP]; GO:0019218 - regulation of steroid metabolism [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019915 - sequestering of lipid [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA]; GO:0043029 - T cell homeostasis [Evidence IGI]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : mammary gland factor STAT5A product : signal transducer and activator of transcription 5A protein_id : NP_035618.1

name	Stat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47458807 GeneID:20848 MGI:103038
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0042755 - eating behavior [Evidence IMP]; GO:0001754 - eye photoreceptor cell differentiation [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence TAS] [Evidence IDA]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019953 - sexual reproduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; acute phase response factor product : signal transducer and activator of transcription 3 isoform 2 protein_id : NP_998825.1

name	Stat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47458804 CCDS:CCDS25440.1 GeneID:20848 MGI:103038
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0042755 - eating behavior [Evidence IMP]; GO:0001754 - eye photoreceptor cell differentiation [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence TAS] [Evidence IDA]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019953 - sexual reproduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; acute phase response factor product : signal transducer and activator of transcription 3 isoform 1 protein_id : NP_998824.1

name	Stat3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094115 CCDS:CCDS25441.1 GeneID:20848 MGI:103038
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0042755 - eating behavior [Evidence IMP]; GO:0001754 - eye photoreceptor cell differentiation [Evidence IMP]; GO:0042593 - glucose homeostasis [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007259 - JAK-STAT cascade [Evidence TAS] [Evidence IDA]; GO:0040014 - regulation of body size [Evidence IMP]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0019953 - sexual reproduction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; acute phase response factor product : signal transducer and activator of transcription 3 isoform 3 protein_id : NP_035616.1

name	Ptrf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679567 CCDS:CCDS25442.1 GeneID:19285 MGI:1277968
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003716 - RNA polymerase I transcription termination factor activity [Evidence IDA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0042134 - rRNA primary transcript binding [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006361 - transcription initiation from RNA polymerase I promoter [Evidence IDA]; GO:0006353 - transcription termination [Evidence IEA] codon_start : 1 product : polymerase I and transcript release factor protein_id : NP_033012.1

name	Atp6v0a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025532 CCDS:CCDS25443.1 GeneID:11975 MGI:103286
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0030331 - estrogen receptor binding [Evidence ISS]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046965 - retinoid X receptor binding [Evidence ISS]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0007420 - brain development [Evidence ISS]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence ISS]; GO:0007507 - heart development [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0030099 - myeloid cell differentiation [Evidence ISS]; GO:0015992 - proton transport [Evidence IEA]; GO:0006367 - transcription initiation from RNA polymerase II promoter [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : V-ATPase a1; ATPase, H+ transporting, lysosomal (vacuolar proton pump) noncatalytic accessory protein 1 (110/160 kDa); ATPase, H+ transporting, lysosomal (vacuolar proton pump) noncatalytic accessory protein 1A (110/160 kDa); ATPase, H+ transporting, lysosomal V0 subunit a product : ATPase, H+ transporting, lysosomal V0 subunit a isoform 1 protein_id : NP_058616.1

name	Naglu (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305299 CCDS:CCDS25444.1 GeneID:27419 MGI:1351641
definition	GO_function : GO:0004561 - alpha-N-acetylglucosaminidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] codon_start : 1 exception : mismatches in translation function : hydrolyse alpha-N-acetylglucosaminide from glycosaminoglycans note : alpha-N-acetylglucosaminidase, lysosomal; N-acetyl-glucosaminidase product : alpha-N-acetylglucosaminidase protein_id : NP_038820.1

name	Hsd17b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754248 CCDS:CCDS25445.1 GeneID:15485 MGI:105077
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004303 - estradiol 17-beta-dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006703 - estrogen biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : hydroxysteroid 17-beta dehydrogenase 1; 17-beta-hydroxysteroid dehydrogenase; estradiol 17-beta-dehydrogenase; 17-beta-hydroxysteroid dehydrogenase type 1 product : hydroxysteroid (17-beta) dehydrogenase 1 protein_id : NP_034605.1

name	Coasy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229125 CCDS:CCDS25446.1 GeneID:71743 MGI:1918993
definition	EC_number : 2.7.7.3 EC_number : 2.7.1.24 GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004140 - dephospho-CoA kinase activity [Evidence IDA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0004595 - pantetheine-phosphate adenylyltransferase activity [Evidence IMP] [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0015937 - coenzyme A biosynthesis [Evidence ISS] [Evidence IDA] codon_start : 1 note : 4'-phosphopantetheine adenylyltransferase and dephospho-CoA kinase; CoA synthase product : Coenzyme A synthase protein_id : NP_082172.2

name	Mlx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560537 CCDS:CCDS25447.1 GeneID:21428 MGI:108398
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MAX-like bHLHZIP protein; BigMax alpha; transcription factor like 4 product : transcription factor-like 4 protein_id : NP_035680.2

name	Psmc3ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092696 CCDS:CCDS25448.1 GeneID:19183 MGI:1098610
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 product : proteasome (prosome, macropain) 26S subunit, ATPase 3, interacting protein protein_id : NP_032975.1

name	1300010M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312666 CCDS:CCDS25449.1 GeneID:67998 MGI:1915248
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC67998 isoform 1 protein_id : NP_080777.1

name	1300010M03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077025 CCDS:CCDS25450.1 GeneID:67998 MGI:1915248
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC67998 isoform 2 protein_id : NP_083209.1

name	Tubg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527242 CCDS:CCDS25451.1 GeneID:103733 MGI:101834
definition	GO_component : GO:0000794 - condensed nuclear chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] [Evidence ISS]; GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0000930 - gamma-tubulin complex [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA]; GO:0000242 - pericentriolar material [Evidence IDA]; GO:0005827 - polar microtubule [Evidence ISS]; GO:0043234 - protein complex [Evidence IEA]; GO:0005876 - spindle microtubule [Evidence IDA]; GO:0005816 - spindle pole body [Evidence ISS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] [Evidence ISS] [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0000212 - meiotic spindle organization and biogenesis [Evidence IEP]; GO:0007020 - microtubule nucleation [Evidence TAS]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA]; GO:0007052 - mitotic spindle organization and biogenesis [Evidence TAS]; GO:0051258 - protein polymerization [Evidence IEA]; GO:0007088 - regulation of mitosis [Evidence TAS] codon_start : 1 note : tubulin, gamma polypeptide product : tubulin, gamma 1 protein_id : NP_598785.1

name	Tubg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527246 CCDS:CCDS25452.1 GeneID:103768 MGI:2144208
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA]; GO:0000242 - pericentriolar material [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 product : tubulin, gamma 2 protein_id : NP_598789.1

name	Plekhh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122503 CCDS:CCDS25453.1 GeneID:217198 MGI:2384950
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : pleckstrin homology domain containing, family H (with MyTH4 domain) member 3 protein_id : NP_666142.1

name	Ccr10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11024708 CCDS:CCDS25454.1 GeneID:12777 MGI:1096320
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0004950 - chemokine receptor activity [Evidence IDA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 2 product : chemokine (C-C motif) receptor 10 protein_id : NP_031747.2

name	Cntnap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116063560 CCDS:CCDS25455.1 GeneID:53321 MGI:1858201
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : neurexin IV; paranodin; neurexin 4 (contactin associated protein) product : contactin associated protein 1 protein_id : NP_058062.2

name	Ezh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679719 GeneID:14055 MGI:1097695
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : enhancer of zeste homolog 1 protein_id : NP_031996.1

name	Ramp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507029 CCDS:CCDS25457.1 GeneID:54409 MGI:1859650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015027 - coreceptor, soluble ligand activity [Evidence IDA]; GO:0008565 - protein transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IPI]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : receptor activity modifying protein 2 protein_id : NP_062317.1

name	Vps25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092662 CCDS:CCDS25458.1 GeneID:28084 MGI:106354
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 25 protein_id : NP_081052.2

name	Wnk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316732 CCDS:CCDS25459.1 GeneID:69847 MGI:1917097
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005923 - tight junction [Evidence IEP] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030644 - chloride ion homeostasis [Evidence TAS]; GO:0006821 - chloride transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0008104 - protein localization [Evidence IDA]; GO:0050794 - regulation of cellular process [Evidence IDA] codon_start : 1 note : protein kinase, lysine deficient 4; WNK4 protein kinase product : WNK lysine deficient protein kinase 4 protein_id : NP_783569.1

name	Ccdc56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311867 CCDS:CCDS25460.1 GeneID:52469 MGI:1098757
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : coiled-coil domain containing 56 protein_id : NP_080894.1

name	Cntd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311935 CCDS:CCDS25461.1 GeneID:68107 MGI:1923965
definition	codon_start : 1 product : cyclin N-terminal domain containing 1 protein_id : NP_080838.1

name	Becn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27764875 CCDS:CCDS25462.1 GeneID:56208 MGI:1891828
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence ISS]; GO:0005802 - Golgi trans face [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006914 - autophagy [Evidence IDA] [Evidence IMP] [Evidence IEA]; GO:0051707 - response to other organism [Evidence IDA]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : Bcl-2-interacting protein beclin product : beclin 1 protein_id : NP_062530.2

name	Psme3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755214 CCDS:CCDS25463.1 GeneID:19192 MGI:1096366
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 product : proteasome activator subunit 3 protein_id : NP_035322.1

name	Aoc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34098972 CCDS:CCDS25464.1 GeneID:237940 MGI:2668431
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008131 - amine oxidase activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006584 - catecholamine metabolism [Evidence IEA] codon_start : 1 note : retina-specific amine oxidase product : amine oxidase, copper containing 2 (retina-specific) protein_id : NP_849263.1

name	Aoc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753066 CCDS:CCDS25465.1 GeneID:11754 MGI:1306797
definition	GO_component : GO:0009986 - cell surface [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0008131 - amine oxidase activity [Evidence ISS] [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0048038 - quinone binding [Evidence ISS] GO_process : GO:0009308 - amine metabolism [Evidence ISS]; GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0006118 - electron transport [Evidence ISS]; GO:0006954 - inflammatory response [Evidence ISS] codon_start : 1 note : semicarbazide-sensitive amine oxidase product : amine oxidase, copper containing 3 protein_id : NP_033805.1

name	LOC629949 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82935345 GeneID:629949
definition	codon_start : 1 product : similar to ribosomal protein L37a protein_id : XP_899994.1

name	G6pc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982353 CCDS:CCDS25466.1 GeneID:14377 MGI:95607
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004346 - glucose-6-phosphatase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0005978 - glycogen biosynthesis [Evidence IEA] codon_start : 1 note : Glc-6-Pase-alpha product : glucose-6-phosphatase, catalytic subunit protein_id : NP_032087.2

name	Aarsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450213 CCDS:CCDS25467.1 GeneID:69684 MGI:1916934
definition	GO_function : GO:0004813 - alanine-tRNA ligase activity [Evidence IEA]; GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006419 - alanyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 product : alanyl-tRNA synthetase domain containing 1 protein_id : NP_659078.1

name	1700113I22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21902523 CCDS:CCDS25468.1 GeneID:73635 MGI:1920885
definition	codon_start : 1 product : hypothetical protein LOC73635 protein_id : NP_081141.1

name	Rundc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369794 CCDS:CCDS25469.1 GeneID:217201 MGI:2144506
definition	codon_start : 1 exception : mismatches in translation product : RUN domain containing 1 protein_id : NP_766154.1

name	Rpl27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567400 CCDS:CCDS25470.1 GeneID:19942 MGI:98036
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L27 protein_id : NP_035419.1

name	Ifi35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312544 CCDS:CCDS25471.1 GeneID:70110 MGI:1917360
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : interferon-induced protein 35 protein_id : NP_081596.1

name	Vat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859662 CCDS:CCDS25472.1 GeneID:26949 MGI:1349450
definition	GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : membrane protein of cholinergic synaptic vesicles product : vesicle amine transport protein 1 homolog (T californica) protein_id : NP_036167.1

name	Rnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753116 CCDS:CCDS25473.1 GeneID:11858 MGI:1338755
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007266 - Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : aplysia ras-related homolog N (RhoN); ras homolog N (RhoN); ras homolog gene family, member N product : Rho family GTPase 2 protein_id : NP_033838.1

name	Brca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560812 CCDS:CCDS25474.1 GeneID:12189 MGI:104537
definition	GO_component : GO:0005813 - centrosome [Evidence TAS]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0008274 - gamma-tubulin ring complex [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence TAS]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0015631 - tubulin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007098 - centrosome cycle [Evidence IGI]; GO:0051298 - centrosome duplication [Evidence TAS]; GO:0006978 - DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator [Evidence ISS]; GO:0008630 - DNA damage response, signal transduction resulting in induction of apoptosis [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IMP]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence IDA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0045739 - positive regulation of DNA repair [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0006359 - regulation of transcription from RNA polymerase III promoter [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : breast cancer 1 protein_id : NP_033894.2

name	Nbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679020 CCDS:CCDS25475.1 GeneID:17966 MGI:108498
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : next to the Brca1 product : neighbor of Brca1 gene 1 protein_id : NP_032702.1

name	Tmem106a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450215 CCDS:CCDS25476.1 GeneID:217203 MGI:1922056
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217203 protein_id : NP_659079.1

name	Rdm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385116 CCDS:CCDS25477.1 GeneID:66599 MGI:1913849
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : RAD52B homolog; RAD52 homolog B product : RAD52 motif 1 protein_id : NP_079930.1

name	Arl4d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384792 GeneID:80981 MGI:1933155
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : ADP-ribosylation factor-like 5 product : ADP-ribosylation factor 4-like protein_id : NP_079680.1

name	LOC100038842 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262366 GeneID:100038842
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471822.1

name	Dhx8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699440 CCDS:CCDS25479.1 GeneID:217207 MGI:1306823
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 8; RNA helicase product : DEAH (Asp-Glu-Ala-His) box polypeptide 8 protein_id : NP_659080.2

name	Etv4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121582414 GeneID:18612 MGI:99423
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IPI] [Evidence IDA] GO_process : GO:0008045 - motor axon guidance [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0045941 - positive regulation of transcription [Evidence IDA] [Evidence IPI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : polyomavirus enhancer activator 3 product : ets variant gene 4 (E1A enhancer binding protein, E1AF) protein_id : NP_032841.2

name	Meox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754680 CCDS:CCDS25480.1 GeneID:17285 MGI:103220
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001757 - somite specification [Evidence IGI] codon_start : 1 product : mesenchyme homeobox 1 protein_id : NP_034921.1

name	LOC194960 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:20344851 GeneID:194960
definition	codon_start : 1 product : hypothetical protein protein_id : XP_110983.1

name	Sost (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14209688 CCDS:CCDS25481.1 GeneID:74499 MGI:1921749
definition	GO_process : GO:0030514 - negative regulation of BMP signaling pathway [Evidence ISS]; GO:0001503 - ossification [Evidence IDA] codon_start : 1 exception : mismatches in translation product : sclerostin protein_id : NP_077769.2

name	Dusp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312314 CCDS:CCDS25482.1 GeneID:72349 MGI:1919599
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IDA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) protein_id : NP_082483.1

name	1700006E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20913257 GeneID:75437 MGI:1922687
definition	codon_start : 1 product : hypothetical protein LOC75437 protein_id : XP_126493.1

name	Mpp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026923 GeneID:13384 MGI:1328354
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : membrane protein palmitoylated 3 (MAGUK p55 subfamily member 3) product : Mpp3 membrane protein, palmitoylated 3 protein_id : NP_031889.2

name	Cd300lg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61696144 CCDS:CCDS25484.1 GeneID:52685 MGI:1289168
definition	codon_start : 1 exception : mismatches in translation note : nepmucin product : CMRF-35-like molecule-9 protein_id : NP_082263.1

name	Mpp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710062 CCDS:CCDS25485.1 GeneID:50997 MGI:1858257
definition	GO_component : GO:0016020 - membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006461 - protein complex assembly [Evidence ISS] codon_start : 1 note : p55 subfamily member of MAGUK family; membrane protein palmitoylated 2 (MAGUK p55 subfamily member 2) product : membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2) protein_id : NP_057904.1

name	Ppy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679453 CCDS:CCDS25486.1 GeneID:19064 MGI:97753
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0001664 - G-protein-coupled receptor binding [Evidence IDA]; GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : pancreatic polypeptide protein_id : NP_032944.1

name	Pyy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703868 GeneID:217212 MGI:99924
definition	GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0042755 - eating behavior [Evidence IDA] codon_start : 1 note : Peptide tyrosine tyrosine product : peptide YY protein_id : NP_663410.1

name	LOC666411 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390845 GeneID:666411
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988743.1

name	Nags (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22003874 CCDS:CCDS25488.1 GeneID:217214 MGI:2387600
definition	EC_number : 2.3.1.1 GO_component : GO:0005739 - mitochondrion [Evidence TAS] GO_function : GO:0003991 - acetylglutamate kinase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004042 - amino-acid N-acetyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0006536 - glutamate metabolism [Evidence IDA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; amino-acid N-acetyltransferase; N-acetylglutamate synthase (Nags) product : N-acetylglutamate synthase isoform 1 protein_id : NP_665828.1

name	Nags (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017345 GeneID:217214 MGI:2387600
definition	EC_number : 2.3.1.1 GO_component : GO:0005739 - mitochondrion [Evidence TAS] GO_function : GO:0003991 - acetylglutamate kinase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004042 - amino-acid N-acetyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0006536 - glutamate metabolism [Evidence IDA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; amino-acid N-acetyltransferase; N-acetylglutamate synthase (Nags) product : N-acetylglutamate synthase isoform 2 protein_id : NP_835154.1

name	Tmem101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313232 CCDS:CCDS25489.1 GeneID:76547 MGI:1923797
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC76547 protein_id : NP_083925.1

name	Lsm12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31711990 CCDS:CCDS25490.1 GeneID:268490 MGI:1919592
definition	codon_start : 1 product : LSM12 homolog protein_id : NP_766535.1

name	G6pc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47271524 CCDS:CCDS25491.1 GeneID:68401 MGI:1915651
definition	codon_start : 1 note : glucose-6-phosphatase catalytic subunit-related; glucose 6 phosphatase catalytic 3 product : glucose-6-phosphatase catalytic subunit 3 protein_id : NP_787949.2

name	Hdac5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136299 GeneID:15184 MGI:1333784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016566 - specific transcriptional repressor activity [Evidence TAS]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030183 - B cell differentiation [Evidence TAS]; GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0007507 - heart development [Evidence IGI]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0045843 - negative regulation of striated muscle development [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence TAS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; histone deacetylase 4 product : histone deacetylase 5 isoform 2 protein_id : NP_034542.3

name	Hdac5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118136295 GeneID:15184 MGI:1333784
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0004407 - histone deacetylase activity [Evidence TAS] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016566 - specific transcriptional repressor activity [Evidence TAS]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence TAS]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030183 - B cell differentiation [Evidence TAS]; GO:0016568 - chromatin modification [Evidence IEA] [Evidence TAS]; GO:0007507 - heart development [Evidence IGI]; GO:0006954 - inflammatory response [Evidence TAS]; GO:0045843 - negative regulation of striated muscle development [Evidence TAS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0007399 - nervous system development [Evidence TAS]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; histone deacetylase 4 product : histone deacetylase 5 isoform 1 protein_id : NP_001071164.1

name	BC030867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347505 GeneID:217216 MGI:2387601
definition	codon_start : 1 product : hypothetical protein LOC217216 protein_id : NP_705772.3

name	Asb16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507369 CCDS:CCDS25493.1 GeneID:217217 MGI:2654437
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : ankyrin repeat domain-containing SOCS box protein Asb-16 product : ankyrin repeat and SOCS box-containing 16 protein_id : NP_683755.1

name	2010008E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625900 CCDS:CCDS25494.1 GeneID:72053 MGI:1919303
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : hypothetical protein LOC72053 protein_id : NP_082352.1

name	Ubtf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205053 GeneID:21429 MGI:98512
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; transcription factor UBF product : upstream binding transcription factor, RNA polymerase I isoform 2 protein_id : NP_001037848.1

name	Ubtf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205057 CCDS:CCDS25495.1 GeneID:21429 MGI:98512
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; transcription factor UBF product : upstream binding transcription factor, RNA polymerase I isoform 1 protein_id : NP_035681.2

name	Slc4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755560 CCDS:CCDS25496.1 GeneID:20533 MGI:109393
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015380 - anion exchanger activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0005452 - inorganic anion exchanger activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : erythrocyte membrane protein band 3 product : solute carrier family 4 (anion exchanger), member 1 protein_id : NP_035533.1

name	Rap2ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949125 CCDS:CCDS25497.1 GeneID:51799 MGI:1858752
definition	codon_start : 1 note : Rap2 interacting protein 8 product : Rap2 interacting protein protein_id : NP_058039.1

name	Slc25a39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386046 CCDS:CCDS25498.1 GeneID:68066 MGI:1196386
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to human CGI-69 protein product : solute carrier family 25, member 39 protein_id : NP_080818.1

name	Grn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680107 GeneID:14824 MGI:95832
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0001835 - blastocyst hatching [Evidence IDA]; GO:0007566 - embryo implantation [Evidence IDA]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IDA] codon_start : 1 note : acrogranulin; progranulin; PC cell-derived growth factor product : granulin protein_id : NP_032201.1

name	BC025575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347502 GeneID:217219 MGI:2448496
definition	codon_start : 1 product : hypothetical protein LOC217219 protein_id : NP_954670.2

name	Itga2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754376 CCDS:CCDS25500.1 GeneID:16399 MGI:96601
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0050840 - extracellular matrix binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : integrin alpha 2b (Cd41b); platelet glycoprotein IIb of IIb/II Ia complex; GP IIb; alpha IIb product : integrin alpha 2b protein_id : NP_034705.1

name	LOC100040687 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040687
definition	number : 2 pseudo : _no_value

name	LOC100040687 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040687
definition	number : 1 pseudo : _no_value

name	Mdk-ps1 (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition	gene_synonym : Mak-rs1

name	(CDS detail)
type	repeat_region
link
xref
definition	satellite : microsatellite:DNA

name	Mdk-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Mak-rs1 note : Mrg, highly homologous to exons (II, III, IV and V) of Mdk. pseudo : _no_value

name	LOC667306 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262524 GeneID:667306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC667306 transcript_id : XR_035353.1

clone name	MSMg01-140F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302K09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-319L05.b	B6Ng01-319L05.g
ACC	GA109265	GA109266
length	1,090	1,152
definition	B6Ng01-319L05.b	B6Ng01-319L05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(101,428,760 - 101,429,850)	(101,309,730 - 101,310,896)
sequence	gaattccataaatgaatcttcctgtggagtttaagctgctttttaagctc tttgacctctgccttccgctgtttcttctcagcccgcaacctttgctttt ctgctttcacaaagttcttgtccacctgtttttggagcctgtgggataat gaatgaatgccttgaaacatttggcactgcaatcatgtcaacaatgcatc tagtttctttcttttcttttctttttttaaaaaagattttatttatttat gttatgtgagtacattgttgctgcctttagacacaccagaagaaggcatc agatcccattacagatagttgtgagccaccatgtggttgccaggaattga acttaggacctttggaagagcagtgagtactcttaacatctgagccatct ctccagcccagcatctactttcttaatttctttcatactcatcatttcca tttgatgagtctcagacaattgtttcattacacatcaattgagaaggaac aaggagactattaataattttgtgatactatacactaccattgcactctt cttttgctatgagactgactcactacatagcttagcctggctaagactca ggatggttctgagtgctggggattacatctgattttttttttctcttgag ataaggtttctttttgtgtcctggaacttgctctgcagaacaggttggcc tcgaactcacagagatctggctgcctctgtcttgtgagtgctaggattaa aggcatcttgccagatttttaagatagatttatttatttttaattcatgt gtatgagtgtacacgtgtgcctgatgctcacaaaagccagaaacgtgtgt cagatcgcctggaactggagttcagactgttgtgagctgccaaagtagat gttgggaagtgaaccaaaggtcttgggtaaaagcagcctgtgctcttacc atgagacacctcttcagcccactcagatatttcttttctttttttttttt ttttagatttaatttattattaatttatatatgtagttacattgaagctg tctcagaacacttcagagaggggtcagatccttggttacg	gaattcacagaaatgaaagtggaagtgaggccggcaagcaagcaacagca gtggaagtgtgtttcagacgctgctggaggctgaggagaccagagccacc tctgaggggtcaaagagtttagtccttcagaactcttcactgccaaccct gctctgaagccccagcttctgccagacgtgagagccatgtctgtgaccct gcaaactgtaagtacgggagcaggggagcatttgtcgcatgtggggaggg gcgggaacacagtgttctaggcttagacctgctcggctcaagcctgctaa gggtggaagagaagtagagcgcttagggtaccttggtctgtggatcttgt catttacctattgtcaaaaccaggactctgacacctaaagtaaggacctt gatcattctttttggtttttcgagacggggtttctctgtttagccctggc tgtcctggaactcactctggagaccaggctggcctcgaactcagaaatct gcctgcctgtgcctcccaagtgctgggattaaaggtgtgcgccaccactg cccggccttgatctttctttatgtggatgtatgcttcagggttgtagaga gctgtaagcatcaaaggtttctggctattctaaacagcaaagggaatact ctgaggtacttcccagccaaaaactcctcccctcagaatgccatgtcaac ctgaccattggtcctctctgggacaggtggtctttctaagtgcctctgac tgaggccacctcagataggctaggttgagctgtgaagtctgcctgccaac agccagtgaggcctcagaggaagcacagtgggcagccaccttcgaggagg gatccaatgcagcttgtcctcagcagctctgcctccccttgttagtcttc tggcacggaaaacttcatttatctcccagatacaataaaaaaaggagcga tttggagccaaataaggaaaagcattattgagagccaacctgcctggttt cagatcctagtttcttcagacatgtgcactgaccaaacattagcttttct aaagttgacagtctaattccttcacttactatgtagatataccacttcct taccaagaacttaagcaaaggcttaggagctagctcagtctaactgctac ct
quality values	Open. Hide. 58 31 14 27 62 62 41 16 62 62 62 62 47 54 62 51 47 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 54 62 62 62 62 49 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 52 58 44 58 58 54 46 58 58 54 58 58 58 54 52 58 58 58 58 58 58 58 52 58 58 58 58 54 58 51 50 58 39 58 35 58 58 49 26 58 51 40 58 58 36 58 58 58 58 58 37 51 58 51 58 58 58 58 58 45 22 54 53 51 50 58 58 58 58 39 30 58 58 58 58 58 58 58 58 58 50 53 58 58 50 51 51 39 51 30 49 50 29 51 37 58 58 51 58 58 58 58 49 50 53 58 50 50 58 50 58 40 58 41 42 51 49 54 50 54 51 52 54 52 52 29 58 50 41 39 26 51 39 51 51 31 22 44 51 45 32 54 54 40 54 51 40 50 49 47 51 53 44 44 54 51 54 54 41 52 49 42 54 52 52 46 54 44 47 39 38 54 52 52 51 29 42 53 39 45 42 40 47 39 20 25 33 54 39 37 44 22 32 52 53 52 45 41 25 28 29 39 32 13 51 53 53 34 31 46 31 53 23 31 34 21 16 51 52 35 29 49 40 32 32 51 46 46 32 31 37 31 51 31 24 31 51 31 42 34 30 30 31 46 21 31 51 29 32 40 32 41 30 31 38 32 42 32 33 25 32 35 31 43 36 42 36 38 38 38 48 48 42 21 24 38 31 29 46 47 31 36 31 36 42 31 37 32 38 34 17 36 26 32 24 26 36 24 32 35 32 31 32 29 32 30 41 28 37 31 31 32 18 37 25 31 31 27 37 38 31 29 29 26 32 24 29 25 30 25 48 32 29 30 27 11 31 33 37 28 23 35 44 23 10 33 24 31 32 21 26 21 20 7 33 8 25 22 27 33 19 12 8 36 24 25 30 43 34 27 16 30 30 15 17 14 27 34 26 33 27 29 19 8 18 31 16 14 23 21 22 30 13 20 16 18 21 27 21 13 10 38 28 17 6 14 34 16 22 13 20 22 20 11 20 9 23 24 47 20 24 24 47 38 31 23 13 28 34 33 40 28 40 34 34 40 34 21 18 30 27 4 6 3 5 8 28 23 7 7 17 30 13 17 13 10 3 3 14 5 6 17 25 4 10 11 3 6 22 9 19 9 11 5 4 8 10 15 7 14 8 9 7 9 13 25 10 16 20 10 11 9 6 8 8 17 6 3 6 12 5 22 5 7 9 1 8 8 28 17 9 2 7 9 10 25 9 6 13 10 21 5 6 11 15 17 7 4	Open. Hide. 49 44 62 59 62 59 43 62 59 62 62 62 59 54 54 56 59 56 59 62 62 54 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 49 42 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 54 59 59 59 62 59 62 59 59 62 62 62 62 62 62 62 59 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 32 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 56 62 62 62 62 62 62 62 43 47 47 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 58 58 54 58 58 58 58 58 58 54 39 49 54 58 58 58 49 39 58 58 58 58 58 58 58 54 54 58 52 58 58 58 58 58 58 54 58 41 58 58 58 58 54 58 54 58 58 58 54 58 49 58 46 54 58 53 58 58 45 39 58 54 52 54 58 54 58 58 54 52 35 49 58 51 58 58 51 58 46 58 52 58 50 51 58 51 50 58 58 50 58 50 51 51 30 9 18 30 49 34 47 58 53 53 58 58 37 54 50 47 41 53 53 50 58 58 52 53 39 51 32 39 48 43 46 48 49 50 46 50 48 54 54 51 54 39 25 39 25 35 50 51 46 52 51 44 36 37 49 50 31 58 36 58 25 47 53 50 58 47 52 58 58 58 53 50 52 32 58 50 38 50 33 50 29 50 54 39 49 46 39 53 54 50 50 53 40 42 37 52 37 50 50 37 49 41 49 42 45 39 35 44 34 35 31 37 37 19 51 42 44 44 25 53 53 54 40 45 35 24 54 41 53 49 38 49 44 32 39 41 31 19 37 47 42 21 45 31 47 31 38 51 53 39 29 25 35 24 39 34 52 31 39 39 34 46 17 28 42 54 18 31 37 52 38 33 44 35 35 34 43 40 45 28 33 18 32 19 45 24 32 34 21 30 31 37 31 32 31 37 41 29 32 7 52 34 32 9 7 26 16 30 32 33 20 30 23 30 30 27 21 30 41 36 21 30 31 31 41 22 31 31 28 31 30 25 31 21 31 38 19 51 32 18 25 41 27 32 17 31 42 32 31 26 19 16 38 32 24 36 42 29 31 32 21 37 32 25 32 24 22 27 24 31 31 31 31 37 31 12 18 7 29 14 29 32 16 13 23 29 18 21 21 25 25 17 21 23 11 8 29 41 46 19 14 46 12 27 9 18 46 31 15 28 27 21 18 38 21 25 9 31 18 11 20 8 33 31 31 42 41 41 36 44 16 12 15 6 8 23 16 31 30 42 26 18 12 31 8 19 26 13 41 33 21 12 12 24 15 16 43 43 31 7 7 8 7 13 12 32 21 18 12 4 31 13 23 22 16 22 17 25 32 33 22 17 10 22 19 15 48 17 28 12 11 12 11 14 20 17 28 6 19 27 10 26 7 27 10 6 9 29 20 20 10 6 7 8 10 8 11 19 7 3 5 18 16 34 26 13 7 9 15 19 6 14 20 40 38 19 21 16 16 33 11 11 13 11 20 28 8 6 14 10 26 17 9 27 10 12 19 25 14 9 9 7 14 9 18 16 18 12 15 5 9 5 2 4 2 4 4 3 2 4 6 4 5 4 10 9 6 23 14 4 6 4 5 7 3 3 2 2 3 5 13 4 3 1 3 12 7 12 13 7 8 5 13 4 7 9 5 22 17 16 7 16 6 7 16 7 4 3 2 3 8 4 5 6 4 3 4 11 11 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_101428760_101429850
seq2: B6Ng01-319L05.b_51_1140 (reverse)

seq1  CGTAAC--AAGATCTGACCCCCTCTTCTGGAGTG-TCTGAAGACAGCTAC  47
      ||||||  | ||||||| |||||| |||| |||| |||| |||||||| |
seq2  CGTAACCAAGGATCTGA-CCCCTC-TCTGAAGTGTTCTG-AGACAGCTTC  47

seq1  AATGTACTTACATATAATAAATAAATAAATAAATAAATCTTTAAAAAAAA  97
      ||||||  ||||||| |||||| |||||  || |||||||  ||||||||
seq2  AATGTAACTACATAT-ATAAATTAATAATAAATTAAATCTAAAAAAAAAA  96

seq1  AAAAAGAAAAAGAAAATATCTGAGTGGGCTGAAGAGGTGTCTCATGGTAA  147
      |||||  ||||| |||||||||||||||||||||||||||||||||||||
seq2  AAAAAAGAAAAG-AAATATCTGAGTGGGCTGAAGAGGTGTCTCATGGTAA  145

seq1  GAGCACAGGCTGCTTTTACCAAAGACC-TTGGTTCACTTCCCAACATCTA  196
      |||||||||||||||||||| |||||| ||||||||||||||||||||||
seq2  GAGCACAGGCTGCTTTTACCCAAGACCTTTGGTTCACTTCCCAACATCTA  195

seq1  CTTTGGCAGCTCACAACAGTCTGAACTCCAGTTCCAGGCGATCTGACACA  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGGCAGCTCACAACAGTCTGAACTCCAGTTCCAGGCGATCTGACACA  245

seq1  CGTTTCTGGCTTTTGTGAGCATCAGGCACACGTGTACACTCATACACATG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTTCTGGCTTTTGTGAGCATCAGGCACACGTGTACACTCATACACATG  295

seq1  AATTAAAAATAAATAAATCTATCTTAAAAATCTGGCAAGATGCCTTTAAT  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAAAAATAAATAAATCTATCTTAAAAATCTGGCAAGATGCCTTTAAT  345

seq1  CCTAGCACTCACAAGACAGAGGCAGCCAGATCTCTGTGAGTTCGAGGCCA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGCACTCACAAGACAGAGGCAGCCAGATCTCTGTGAGTTCGAGGCCA  395

seq1  ACCTGTTCTGCAGAGCAAGTTCCAGGACACAAAAAGAAACCTTATCTCAA  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGTTCTGCAGAGCAAGTTCCAGGACACAAAAAGAAACCTTATCTCAA  445

seq1  GAGAAAAAAAAAATCAGATGTAATCCCCAGCACTCAGAACCATCCTGAGT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAAAAAAAATCAGATGTAATCCCCAGCACTCAGAACCATCCTGAGT  495

seq1  CTTAGCCAGGCTAAGCTATGTAGTGAGTCAGTCTCATAGCAAAAGAAGAG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGCCAGGCTAAGCTATGTAGTGAGTCAGTCTCATAGCAAAAGAAGAG  545

seq1  TGCAATGGTAGTGTATAGTATCACAAAATTATTAATAGTCTCCTTGTTCC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAATGGTAGTGTATAGTATCACAAAATTATTAATAGTCTCCTTGTTCC  595

seq1  TTCTCAATTGATGTGTAATGAAACAATTGTCTGAGACTCATCAAATGGAA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCAATTGATGTGTAATGAAACAATTGTCTGAGACTCATCAAATGGAA  645

seq1  ATGATGAGTATGAAAGAAATTAAGAAAGTAGATGCTGGGCTGGAGAGATG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATGAGTATGAAAGAAATTAAGAAAGTAGATGCTGGGCTGGAGAGATG  695

seq1  GCTCAGATGTTAAGAGTACTCACTGCTCTTCCAAAGGTCCTAAGTTCAAT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAGATGTTAAGAGTACTCACTGCTCTTCCAAAGGTCCTAAGTTCAAT  745

seq1  TCCTGGCAACCACATGGTGGCTCACAACTATCTGTAATGGGATCTGATGC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGGCAACCACATGGTGGCTCACAACTATCTGTAATGGGATCTGATGC  795

seq1  CTTCTTCTGGTGTGTCTAAAGGCAGCAACAATGTACTCACATAACATAAA  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTTCTGGTGTGTCTAAAGGCAGCAACAATGTACTCACATAACATAAA  845

seq1  TAAATAAAATCTTTTTTAAAAAAAGAAAAGAAAAGAAAGAAACTAGATGC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATAAAATCTTTTTTAAAAAAAGAAAAGAAAAGAAAGAAACTAGATGC  895

seq1  ATTGTTGACATGATTGCAGTGCCAAATGTTTCAAGGCATTCATTCATTAT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTGACATGATTGCAGTGCCAAATGTTTCAAGGCATTCATTCATTAT  945

seq1  CCCACAGGCTCCAAAAACAGGTGGACAAGAACTTTGTGAAAGCAGAAAAG  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACAGGCTCCAAAAACAGGTGGACAAGAACTTTGTGAAAGCAGAAAAG  995

seq1  CAAAGGTTGCGGGCTGAGAAGAAACAGCGGAAGGCAGAGGTCAAAGAGCT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGTTGCGGGCTGAGAAGAAACAGCGGAAGGCAGAGGTCAAAGAGCT  1045

seq1  TAAAAAGCAGCTTAAACTCCACAGGAAGATTCATTTATGGAATTC  1091
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAAGCAGCTTAAACTCCACAGGAAGATTCATTTATGGAATTC  1090

seq1: chr11_101309730_101310896
seq2: B6Ng01-319L05.g_70_1221

seq1  GAATTCACAGAAATGAAAGTGGAAGTGAGGCCGGCAAGCAAGCAACAGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGAAATGAAAGTGGAAGTGAGGCCGGCAAGCAAGCAACAGCA  50

seq1  GTGGAAGTGTGTTTCAGACGCTGCTGGAGGCTGAGGAGACCAGAGCCACC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGAAGTGTGTTTCAGACGCTGCTGGAGGCTGAGGAGACCAGAGCCACC  100

seq1  TCTGAGGGGTCAAAGAGTTTAGTCCTTCAGAACTCTTCACTGCCAACCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAGGGGTCAAAGAGTTTAGTCCTTCAGAACTCTTCACTGCCAACCCT  150

seq1  GCTCTGAAGCCCCAGCTTCTGCCAGACGTGAGAGCCATGTCTGTGACCCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGAAGCCCCAGCTTCTGCCAGACGTGAGAGCCATGTCTGTGACCCT  200

seq1  GCAAACTGTAAGTACGGGAGCAGGGGAGCATTTGTCGCATGTGGGGAGGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACTGTAAGTACGGGAGCAGGGGAGCATTTGTCGCATGTGGGGAGGG  250

seq1  GCGGGAACACAGTGTTCTAGGCTTAGACCTGCTCGGCTCAAGCCTGCTAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGGAACACAGTGTTCTAGGCTTAGACCTGCTCGGCTCAAGCCTGCTAA  300

seq1  GGGTGGAAGAGAAGTAGAGCGCTTAGGGTACCTTGGTCTGTGGATCTTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGGAAGAGAAGTAGAGCGCTTAGGGTACCTTGGTCTGTGGATCTTGT  350

seq1  CATTTACCTATTGTCAAAACCAGGACTCTGACACCTAAAGTAAGGACCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTACCTATTGTCAAAACCAGGACTCTGACACCTAAAGTAAGGACCTT  400

seq1  GATCATTCTTTTTGGTTTTTCGAGACGGGGTTTCTCTGTTTAGCCCTGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCATTCTTTTTGGTTTTTCGAGACGGGGTTTCTCTGTTTAGCCCTGGC  450

seq1  TGTCCTGGAACTCACTCTGGAGACCAGGCTGGCCTCGAACTCAGAAATCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTGGAACTCACTCTGGAGACCAGGCTGGCCTCGAACTCAGAAATCT  500

seq1  GCCTGCCTGTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCGCCACCACTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGCCTGTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCGCCACCACTG  550

seq1  CCCGGCCTTGATCTTTCTTTATGTGGATGTATGCTTCAGGGTTGTAGAGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGGCCTTGATCTTTCTTTATGTGGATGTATGCTTCAGGGTTGTAGAGA  600

seq1  GCTGTAAGCATCAAAGGTTTCTGGCTATTCTAAACAGCAAAGGGAATACT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTAAGCATCAAAGGTTTCTGGCTATTCTAAACAGCAAAGGGAATACT  650

seq1  CTGAGGTACTTCCCAGCCAAAAACTCCTCCCCTCAGAATGCCATGTCAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGGTACTTCCCAGCCAAAAACTCCTCCCCTCAGAATGCCATGTCAAC  700

seq1  CTGACCATTGGTCCTCTCTGGGACAGGTGGTCTTTCTAAGTGCCTCTGAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACCATTGGTCCTCTCTGGGACAGGTGGTCTTTCTAAGTGCCTCTGAC  750

seq1  TGAGGCCACCTCAGATAGGCTAGGTTGAGCTGTGAAGTCTGCCTGCCAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCCACCTCAGATAGGCTAGGTTGAGCTGTGAAGTCTGCCTGCCAAC  800

seq1  AGCCAGTGAGGCCTCAGGAGGAAGCACAGTGGGCAGCCACCTTCGAGGAG  850
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  AGCCAGTGAGGCCTCA-GAGGAAGCACAGTGGGCAGCCACCTTCGAGGAG  849

seq1  GGATCCAATGCAGCTTGTCCTCAGCAGCTCTGCCTCCCCTTGTTAGTCTT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATCCAATGCAGCTTGTCCTCAGCAGCTCTGCCTCCCCTTGTTAGTCTT  899

seq1  CTGGCACGGAAAACTTCCATTTATCTCCCAGATACAATAAAAAAAGGGAG  950
      |||||||||||||||| |||||||||||||||||||||||||||| ||||
seq2  CTGGCACGGAAAACTT-CATTTATCTCCCAGATACAATAAAAAAA-GGAG  947

seq1  CGATTTGGAGCCAAATAAGGAAAAAGCAATATTGAAGAGCCAACCTGCCT  1000
      |||||||||||||||||||| ||||||| ||||| |||||||||||||||
seq2  CGATTTGGAGCCAAATAAGG-AAAAGCATTATTG-AGAGCCAACCTGCCT  995

seq1  GGTTTCAGATCCTAGTTTCTTCAGACATGTTGCACTGGACCAAACATTAG  1050
      ||||||||||||||||||||||||||||| |||||| |||||||||||||
seq2  GGTTTCAGATCCTAGTTTCTTCAGACATG-TGCACT-GACCAAACATTAG  1043

seq1  CTTTTCTAAAGTTGACAGTCTAATCCCTTCACTTACTATGTAGGGATATT  1100
      |||||||||||||||||||||||| |||||||||||||||||  ||||| 
seq2  CTTTTCTAAAGTTGACAGTCTAATTCCTTCACTTACTATGTA--GATATA  1091

seq1  ACACTTCTTCACAAAGATACCTAGAGGGAAGGCTAGAGAGCTAGCTCAGT  1150
       |||||| | || |||| || || ||  ||||||   |||||||||||||
seq2  CCACTTCCTTACCAAGA-ACTTA-AGCAAAGGCTTAGGAGCTAGCTCAGT  1139

seq1  CTATAAACTGCTTACCT  1167
      ||   |||||| |||||
seq2  CT---AACTGC-TACCT  1152

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information