MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-338A18
Chromosome	11 (Build37)
Map Location	6,184,856 - 6,300,688
singlet/doublet	doublet
Overlap gene	Ogdh, LOC100042227, Zmiz2
Upstream gene	Znrf3, LOC100042016, LOC382478, Xbp1, Ccdc117, LOC100041183, Ankrd36, LOC665181, Mrps24, 2010005J08Rik, 2210015D19Rik, Dbnl, Pgam2, Polm, Aebp1, Pold2, Myl7, Gck, Ykt6, Camk2b, LOC100042156, Nudcd3, LOC100042173, Npc1l1, LOC100041242, LOC665250, Ddx56, Tmed4
Downstream gene	Ppia, H2afv, LOC665277, LOC665283, LOC626342, Purb, Myo1g, LOC100041286, Ccm2, LOC665327, AB182283, Tbrg4, Wap, LOC100041311, Ramp3, LOC665314, LOC626419, LOC665339, LOC665343, LOC100041332, Adcy1, LOC100041347, Igfbp1, Igfbp3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Znrf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407821 MGI:3039616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042016 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC382478 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382478
definition	note : polymerase (RNA) II (DNA directed) polypeptide D pseudogene pseudo : _no_value

name	Xbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22433 MGI:98970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104479 MGI:2144383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041183 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ankrd36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76389 MGI:1923639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665181 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 116 ESTs, 6 Proteins

name	Mrps24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64660 MGI:1928142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010005J08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72046 MGI:1919296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2210015D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76508 MGI:1913774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Dbnl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13169 MGI:700006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56012 MGI:1933118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54125 MGI:1860191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aebp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11568 MGI:1197012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18972 MGI:1097163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17898 MGI:107495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103988 MGI:1270854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ykt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56418 MGI:1927550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12323 MGI:88257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Nudcd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209586 MGI:2144158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042173 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 884 ESTs, 3 Proteins

name	Npc1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237636 MGI:2685089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC665250 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Ddx56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52513 MGI:1277172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103694 MGI:1915070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18293 MGI:1098267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Zmiz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52915 MGI:106374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppia (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268373 MGI:97749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2afv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77605 MGI:1924855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 176 ESTs, 39 Proteins

name	LOC665277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 327 ESTs, 2 Proteins pseudo : _no_value

name	LOC665283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 88 ESTs, 7 Proteins

name	LOC626342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Purb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19291 MGI:1338779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo1g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246177 MGI:1927091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ccm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216527 MGI:2384924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 10 Proteins pseudo : _no_value

name	AB182283 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192950 MGI:3603030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbrg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21379 MGI:1100868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22373 MGI:98943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Ramp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56089 MGI:1860292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC626419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC665339 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 5 Proteins pseudo : _no_value

name	LOC665343 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 240 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Adcy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432530 MGI:99677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041347 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	Igfbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16006 MGI:96436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16009 MGI:96438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znrf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286865 GeneID:407821 MGI:3039616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc and ring finger 3 transcript_id : NM_001080924.1

name	LOC100042016 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261628 GeneID:100042016
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042016 transcript_id : XM_001478392.1

name	Xbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13775155 GeneID:22433 MGI:98970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-box binding protein 1 transcript_id : NM_013842.2

name	Ccdc117 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794237 GeneID:104479 MGI:2144383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 117 transcript_id : NM_134033.1

name	Ankrd36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628651 GeneID:76389 MGI:1923639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 36 transcript_id : NM_023816.2

name	LOC665181 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94389883 GeneID:665181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 116 ESTs, 6 Proteins product : similar to endothelial differentiation-related factor 1 transcript_id : XM_979372.1

name	Mrps24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117940056 GeneID:64660 MGI:1928142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S24 transcript_id : NM_026080.2

name	2010005J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938771 GeneID:72046 MGI:1919296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010005J08 gene transcript_id : NM_001077661.1

name	2010005J08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938769 GeneID:72046 MGI:1919296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010005J08 gene transcript_id : NM_178623.3

name	2210015D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94389885 GeneID:76508 MGI:1913774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 2210015D19 gene, transcript variant 2 transcript_id : XM_893272.2

name	Dbnl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130876 GeneID:13169 MGI:700006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : drebrin-like transcript_id : NM_013810.2

name	Pgam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130705 GeneID:56012 MGI:1933118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglycerate mutase 2 transcript_id : NM_018870.2

name	Polm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8394000 GeneID:54125 MGI:1860191
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), mu transcript_id : NM_017401.1

name	Aebp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752997 GeneID:11568 MGI:1197012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AE binding protein 1 transcript_id : NM_009636.1

name	Pold2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679412 GeneID:18972 MGI:1097163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), delta 2, regulatory subunit transcript_id : NM_008894.1

name	Myl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326498 GeneID:17898 MGI:107495
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 7, regulatory transcript_id : NM_022879.2

name	Gck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129970 GeneID:103988 MGI:1270854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucokinase transcript_id : NM_010292.4

name	Ykt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893017 GeneID:56418 MGI:1927550
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YKT6 homolog (S. Cerevisiae) transcript_id : NM_019661.3

name	Camk2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349559 GeneID:12323 MGI:88257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II, beta transcript_id : NM_007595.3

name	Nudcd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803279 GeneID:209586 MGI:2144158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NudC domain containing 3 transcript_id : NM_173748.3

name	LOC100042173 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261634 GeneID:100042173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 884 ESTs, 3 Proteins product : similar to hCG1994130 transcript_id : XM_001478643.1

name	Npc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402232 GeneID:237636 MGI:2685089
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NPC1-like 1 transcript_id : NM_207242.1

name	LOC100041242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261598 GeneID:100041242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041242 transcript_id : XM_001476031.1

name	Ddx56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893145 GeneID:52513 MGI:1277172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 transcript_id : NM_026538.3

name	Tmed4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527235 GeneID:103694 MGI:1915070
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 protein transport domain containing 4 transcript_id : NM_134020.1

name	Ogdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796649 GeneID:18293 MGI:1098267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxoglutarate dehydrogenase (lipoamide) transcript_id : NM_010956.3

name	LOC100042227 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261639 GeneID:100042227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042227 transcript_id : XM_001478677.1

name	Zmiz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607099 GeneID:52915 MGI:106374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MIZ-type containing 2 transcript_id : NM_028601.2

name	Zmiz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607101 GeneID:52915 MGI:106374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MIZ-type containing 2 transcript_id : NM_001005867.1

name	Ppia (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679438 GeneID:268373 MGI:97749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase A transcript_id : NM_008907.1

name	H2afv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261600 GeneID:77605 MGI:1924855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 176 ESTs, 39 Proteins product : H2A histone family, member V transcript_id : XM_001476068.1

name	LOC665283 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94389891 GeneID:665283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 88 ESTs, 6 Proteins product : similar to SMT3B protein transcript_id : XM_975835.1

name	Purb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802243 GeneID:19291 MGI:1338779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purine rich element binding protein B transcript_id : NM_011221.2

name	Myo1g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801948 GeneID:246177 MGI:1927091
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IG transcript_id : NM_178440.3

name	LOC100041286 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261602 GeneID:100041286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041286 transcript_id : XM_001476101.1

name	Ccm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130250 GeneID:216527 MGI:2384924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cerebral cavernous malformation 2 homolog (human) transcript_id : NM_146014.2

name	AB182283 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116573 GeneID:192950 MGI:3603030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AB182283 transcript_id : NM_001081652.1

name	Tbrg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20589520 GeneID:21379 MGI:1100868
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor beta regulated gene 4 transcript_id : NM_134011.1

name	Wap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802335 GeneID:22373 MGI:98943
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : whey acidic protein transcript_id : NM_011709.4

name	Ramp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384664 GeneID:56089 MGI:1860292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor (calcitonin) activity modifying protein 3 transcript_id : NM_019511.2

name	LOC626419 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94389893 GeneID:626419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC626419 transcript_id : XM_899362.2

name	Adcy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888831 GeneID:432530 MGI:99677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 1 transcript_id : NM_009622.1

name	LOC100041347 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261605 GeneID:100041347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical protein LOC100041347 transcript_id : XM_001476212.1

name	Igfbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352345 GeneID:16006 MGI:96436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 1 transcript_id : NM_008341.3

name	Igfbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111378399 GeneID:16009 MGI:96438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor binding protein 3 transcript_id : NM_008343.2

name	Znrf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286866 GeneID:407821 MGI:3039616
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc and ring finger 3 protein_id : NP_001074393.1

name	LOC100042016 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261629 GeneID:100042016
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478442.1

name	Xbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13775156 CCDS:CCDS24400.1 GeneID:22433 MGI:98970
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : X-box binding protein 1 protein_id : NP_038870.2

name	Ccdc117 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794238 CCDS:CCDS24401.1 GeneID:104479 MGI:2144383
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 117 protein_id : NP_598794.1

name	Ankrd36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628652 GeneID:76389 MGI:1923639
definition	codon_start : 1 note : GC3 product : ankyrin repeat domain 48 protein_id : NP_076305.2

name	LOC665181 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94389884 GeneID:665181
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984466.1

name	Mrps24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385578 CCDS:CCDS24402.1 GeneID:64660 MGI:1928142
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] codon_start : 1 note : ribosomal protein, mitochondrial, S24 product : mitochondrial ribosomal protein S24 protein_id : NP_080356.1

name	2010005J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938770 GeneID:72046 MGI:1919296
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : up-regulated gene 4 isoform 1 protein_id : NP_848738.2

name	2010005J08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938772 GeneID:72046 MGI:1919296
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : up-regulated gene 4 isoform 2 protein_id : NP_001071129.1

name	2210015D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82933680 GeneID:76508 MGI:1913774
definition	codon_start : 1 product : hypothetical protein LOC76508 isoform 2 protein_id : XP_898365.1

name	Dbnl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304993 CCDS:CCDS24403.1 GeneID:13169 MGI:700006
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IDA] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051014 - actin filament severing [Evidence IDA]; GO:0051016 - barbed-end actin filament capping [Evidence IDA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0016601 - Rac protein signal transduction [Evidence IDA] codon_start : 1 product : drebrin-like protein_id : NP_038838.1

name	Pgam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256624 CCDS:CCDS24404.1 GeneID:56012 MGI:1933118
definition	GO_function : GO:0004082 - bisphosphoglycerate mutase activity [Evidence IEA]; GO:0004083 - bisphosphoglycerate phosphatase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016868 - intramolecular transferase activity, phosphotransferases [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0004619 - phosphoglycerate mutase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phosphoglycerate mutase muscle-specific subunit product : phosphoglycerate mutase 2 protein_id : NP_061358.1

name	Polm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394001 CCDS:CCDS24405.1 GeneID:54125 MGI:1860191
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003912 - DNA nucleotidylexotransferase activity [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030183 - B cell differentiation [Evidence IMP]; GO:0006260 - DNA replication [Evidence IEA]; GO:0016446 - somatic hypermutation of immunoglobulin genes [Evidence IMP] codon_start : 1 exception : mismatches in translation function : somatic mutation note : DNA polymerase mu product : polymerase (DNA directed), mu protein_id : NP_059097.1

name	Aebp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752998 CCDS:CCDS24406.1 GeneID:11568 MGI:1197012
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 exception : mismatches in translation note : AE-binding protein 1 product : AE binding protein 1 protein_id : NP_033766.1

name	Pold2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679413 CCDS:CCDS24407.1 GeneID:18972 MGI:1097163
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 exception : mismatches in translation note : polymerase (DNA directed), delta 2, regulatory subunit (50 kDa) product : polymerase (DNA directed), delta 2, regulatory subunit protein_id : NP_032920.1

name	Myl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114326499 CCDS:CCDS24408.1 GeneID:17898 MGI:107495
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence ISS] [Evidence IEA] GO_function : GO:0042623 - ATPase activity, coupled [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence ISS]; GO:0000146 - microfilament motor activity [Evidence ISS]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0030048 - actin filament-based movement [Evidence ISS]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0006939 - smooth muscle contraction [Evidence ISS] codon_start : 1 note : myosin light chain, regulatory A product : myosin, light polypeptide 7, regulatory protein_id : NP_075017.2

name	Gck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982798 CCDS:CCDS24409.1 GeneID:103988 MGI:1270854
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004340 - glucokinase activity [Evidence IDA]; GO:0004396 - hexokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001678 - cell glucose homeostasis [Evidence IMP]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 note : hexokinase 4 product : glucokinase protein_id : NP_034422.2

name	Ykt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543971 CCDS:CCDS24410.1 GeneID:56418 MGI:1927550
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0019706 - protein-cysteine S-palmitoleyltransferase activity [Evidence ISS]; GO:0005485 - v-SNARE activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS]; GO:0006904 - vesicle docking during exocytosis [Evidence ISS]; GO:0006903 - vesicle targeting [Evidence ISS] codon_start : 1 note : prenylated SNARE protein; prenylated SNARE protein (Ykt6) product : YKT6 v-SNARE protein protein_id : NP_062635.2

name	Camk2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982483 CCDS:CCDS24411.1 GeneID:12323 MGI:88257
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : CaMK II; calcium/calmodulin-dependent protein kinase II, delta product : calcium/calmodulin-dependent protein kinase II, beta protein_id : NP_031621.2

name	Nudcd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424587 CCDS:CCDS24412.1 GeneID:209586 MGI:2144158
definition	codon_start : 1 product : NudC domain containing 3 protein_id : NP_776109.1

name	LOC100042173 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261635 GeneID:100042173
definition	codon_start : 1 product : similar to hCG1994130 protein_id : XP_001478693.1

name	Npc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402233 CCDS:CCDS24413.1 GeneID:237636 MGI:2685089
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008158 - hedgehog receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0042632 - cholesterol homeostasis [Evidence IMP]; GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0030301 - cholesterol transport [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Niemann-Pick disease, type C1-like 1 product : NPC1-like 1 protein_id : NP_997125.1

name	LOC100041242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261599 GeneID:100041242
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476081.1

name	Ddx56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312650 CCDS:CCDS24414.1 GeneID:52513 MGI:1277172
definition	GO_component : GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : DEAD-box RNA helicase product : nucleolar RNA helicase homolog protein_id : NP_080814.1

name	Tmed4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527236 CCDS:CCDS24415.1 GeneID:103694 MGI:1915070
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane emp24 protein transport domain containing 4 protein_id : NP_598781.1

name	LOC100042227 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261640 GeneID:100042227
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478727.1

name	Ogdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861164 GeneID:18293 MGI:1098267
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA]; GO:0004591 - oxoglutarate dehydrogenase (succinyl-transferring) activity [Evidence IEA]; GO:0030976 - thiamin pyrophosphate binding [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : alpha-ketoglutarate dehydrogenase product : oxoglutarate dehydrogenase (lipoamide) protein_id : NP_035086.2

name	Zmiz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607100 CCDS:CCDS24418.1 GeneID:52915 MGI:106374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : zinc finger, MIZ-type containing 2 isoform 1 protein_id : NP_082877.2

name	Zmiz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607102 CCDS:CCDS24417.1 GeneID:52915 MGI:106374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : zinc finger, MIZ-type containing 2 isoform 2 protein_id : NP_001005867.1

name	Ppia (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679439 CCDS:CCDS24419.1 GeneID:268373 MGI:97749
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence ISS]; GO:0046790 - virion binding [Evidence ISS] GO_process : GO:0006457 - protein folding [Evidence ISS] [Evidence IEA]; GO:0045069 - regulation of viral genome replication [Evidence ISS] codon_start : 1 note : cyclophilin A product : peptidylprolyl isomerase A protein_id : NP_032933.1

name	H2afv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261601 GeneID:77605 MGI:1924855
definition	codon_start : 1 product : H2A histone family, member V protein_id : XP_001476118.1

name	LOC665283 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94389892 GeneID:665283
definition	codon_start : 1 product : similar to SMT3B protein protein_id : XP_980929.1

name	Purb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755252 CCDS:CCDS24420.1 GeneID:19291 MGI:1338779
definition	GO_component : GO:0005662 - DNA replication factor A complex [Evidence IDA]; GO:0000784 - nuclear chromosome, telomeric region [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003690 - double-stranded DNA binding [Evidence IDA]; GO:0003691 - double-stranded telomeric DNA binding [Evidence ISS]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003705 - RNA polymerase II transcription factor activity, enhancer binding [Evidence ISS]; GO:0003697 - single-stranded DNA binding [Evidence ISS] [Evidence IDA]; GO:0046332 - SMAD binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence NAS]; GO:0030154 - cell differentiation [Evidence NAS]; GO:0008283 - cell proliferation [Evidence NAS]; GO:0006270 - DNA replication initiation [Evidence ISS]; GO:0006268 - DNA unwinding during replication [Evidence ISS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045637 - regulation of myeloid cell differentiation [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : vascular actin single-stranded DNA-binding factor 2 p44 component; PurB beta; purine-rich single-stranded DNA-binding protein beta product : purine rich element binding protein B protein_id : NP_035351.1

name	Myo1g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410767 CCDS:CCDS24421.1 GeneID:246177 MGI:1927091
definition	GO_component : GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myosin IG protein_id : NP_848534.1

name	LOC100041286 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261603 GeneID:100041286
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476151.1

name	Ccm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122481 CCDS:CCDS24422.1 GeneID:216527 MGI:2384924
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cerebral cavernous malformation 2 homolog protein_id : NP_666126.1

name	AB182283 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116574 GeneID:192950 MGI:3603030
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC192950 protein_id : NP_001075121.1

name	Tbrg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20589521 CCDS:CCDS24423.1 GeneID:21379 MGI:1100868
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : cell cycle progression 2 protein product : transforming growth factor beta regulated gene 4 protein_id : NP_598772.1

name	Wap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:93204854 CCDS:CCDS24424.1 GeneID:22373 MGI:98943
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : whey acidic protein protein_id : NP_035839.3

name	Ramp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507031 CCDS:CCDS24425.1 GeneID:56089 MGI:1860292
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015027 - coreceptor, soluble ligand activity [Evidence IDA]; GO:0008565 - protein transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IPI]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : receptor activity modifying protein 3 protein_id : NP_062384.1

name	LOC626419 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82933748 GeneID:626419
definition	codon_start : 1 product : hypothetical protein protein_id : XP_904455.1

name	Adcy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888832 CCDS:CCDS24426.1 GeneID:432530 MGI:99677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA] codon_start : 1 note : barrelless product : adenylate cyclase 1 protein_id : NP_033752.1

name	LOC100041347 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261606 GeneID:100041347
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476262.1

name	Igfbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328135 CCDS:CCDS24427.1 GeneID:16006 MGI:96436
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 exception : mismatches in translation product : insulin-like growth factor binding protein 1 protein_id : NP_032367.2

name	Igfbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111378400 CCDS:CCDS24428.1 GeneID:16009 MGI:96438
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence ISS]; GO:0008160 - protein tyrosine phosphatase activator activity [Evidence ISS] GO_process : GO:0009968 - negative regulation of signal transduction [Evidence ISS]; GO:0043065 - positive regulation of apoptosis [Evidence ISS]; GO:0045663 - positive regulation of myoblast differentiation [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 product : insulin-like growth factor binding protein 3 protein_id : NP_032369.2

name	LOC100041183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041183
definition	number : 3 pseudo : _no_value

name	LOC100041183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041183
definition	number : 2 pseudo : _no_value

name	LOC100041183 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041183
definition	number : 1 pseudo : _no_value

name	LOC626342 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626342
definition	number : 1 pseudo : _no_value

name	LOC100041311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041311
definition	number : 5 pseudo : _no_value

name	LOC100041311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041311
definition	number : 4 pseudo : _no_value

name	LOC100041311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041311
definition	number : 3 pseudo : _no_value

name	LOC100041311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041311
definition	number : 2 pseudo : _no_value

name	LOC100041311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041311
definition	number : 1 pseudo : _no_value

name	LOC665314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665314
definition	number : 1 pseudo : _no_value

name	LOC100041332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041332
definition	number : 3 pseudo : _no_value

name	LOC100041332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041332
definition	number : 2 pseudo : _no_value

name	LOC100041332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041332
definition	number : 1 pseudo : _no_value

name	LOC100042156 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261633 GeneID:100042156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to LOC629446 protein pseudo : _no_value transcript_id : XR_033781.1

name	LOC665250 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261636 GeneID:665250
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to RNA polymerase II transcription factor SIII p18 subunit pseudo : _no_value transcript_id : XR_033814.1

name	LOC665277 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261642 GeneID:665277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 327 ESTs, 2 Proteins product : similar to ribosomal protein L36a pseudo : _no_value transcript_id : XR_033842.1

name	LOC665327 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261647 GeneID:665327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 10 Proteins product : similar to hCG2016451 pseudo : _no_value transcript_id : XR_033883.1

name	LOC665339 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261648 GeneID:665339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 5 Proteins product : similar to RBBP5 protein pseudo : _no_value transcript_id : XR_033922.1

name	LOC665343 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261604 GeneID:665343
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 240 ESTs, 2 Proteins product : similar to HSP-90 pseudo : _no_value transcript_id : XR_032579.1

clone name	MSMg01-299H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514E23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-372I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508H16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509N06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-118O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548O22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075B14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-080F04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-444H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128A05
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-338A18.b	B6Ng01-338A18.g
ACC	GA122472	GA122473
length	1,220	1,189
definition	B6Ng01-338A18.b	B6Ng01-338A18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(6,299,454 - 6,300,688)	(6,184,856 - 6,186,049)
sequence	gaattcaaggagtgcaggcacagagggaaggaagagcttagtatggaaga aagccaagccagccaccatcctggcagcgaggctctcctgagtgctgaca cataggcaggggcttttctattttgttaccacactgcctcagccctcagc agagcactctggtattgctcgaccactgtctagttttctgtcaagacact cctggcatgctatggcttctgagccactctatctctgtgccacctcaatc agcatggctcctgctggcctgcagctcaaggtctacttgggaccctgccc actggagcctggtgaggcccagacagtacagatgggacatcttccatgag cttggtttctctgacataatcaacaggagcattaaatctttttaatgtaa cagagcgtatttaactggttcccttttctttttctttttctttttttctt cttctttttttttttttctttctgagacagggtttctctgtatagctgtc ctggaactcactttgtagaccaggctagcctggaactcagaaacccgcct gcctctgcctcccaagtgctgggattaaaggcgtggtggtgtccggttcc cttttcttaaagggcaagaacagagtaaaatggaaaagcaacatcttgct tctcaaggagacagaccctcacccacaagctcccgaaccccataggagag acgacaatctgggggtatataccagccctgcccacagtcccacactacgc acacagcagcaggcggtgacagtgatctggatggtgttgcgacctgggct ggcacacatgcttcaggtagaggggcttgtgcgaggtcttgttgtctcca cgctcaatgctgaggggtgtggcattgacgctgacctgcacagatgctgg ccagttggtgttcatctgccggtcctcatggtgatagcacttaaactgca ggctccaggtcagcctagtagggaagaagatgatggaagcccacactgtg cagccaggaccaggggcaagatggcagtgagactcacctcagcatcaggt ctatagaacagaatcctcggagctggaagactgttgctccacagccagtg ttgcttgcaagccgaggctccagaccctcccaatctcgaacttggagtca gcccacctcattccaatggacactgcctagcagtgctgccaatgaatggc tccttggccaagggagcctg	gaattcccttcaaaagctgtaaaatatacagggcggtcatggcgcatgcc tttaatcccagcacttgggaggcagaggcaggcggatttctgagtttgag gccagcctggtttaaagagtgagttccaggacagccagggctacacagag aaaccctgtctcaaaaacaaaacaaaacaaaaacaaaaacaaaaacaaaa acaaacaaaacataaaataaatgaaatcttaaaaaaagaaaaagaacaaa tgatttaaaaactagacagatgggagaacatatgcatgtagtgccagctg tttggaagacaggaggatggcttacgtccaggggttgaaggacagcctag gttaaaaagtaggacccatctcaatttaaaaagtcagagatcaggctgga gaaatggctcagcggttaagagcaccaaccactctttgagaggttctgaa tttaatttccagcaaccacatggtggctcacaaccatccgtaaaggggtc tgatgcccaattctggtgtgtctgaagggagcaatggtggtgtattcata tgcctaacataaataaataaacctttttttttttaaaagaaaagtcagag atcagaggattaggagttcaagaccagtctaggccatctatatagttaaa ccctcccttcaaagaacaaataaacaggtaaaaaaacaaacaaacaaaac cctcccctagttttgtttttaaagaacattatcaagaaaatgaagacaac gcacaaaatgggggtgggagtgagaaatatttgcaaatcacatatctggc agggtttaaataaccaaagcaagtaaataactcttacaactcaacaaaac aaaaacaactaccacaagctttgaattctgacaggagcctggaatagaat atatacaaatgggaaaaaaaaaaagcaagggggggcgtggggtaaaacac ttgaaagggtactgaaaaagctagctttcaggaaagtctgtatctgtgtc atatgtgtcatatgtgtcatatgtgtcatatgtggtggtgctgcatgttg atgacactctgagctagaagactgaatgtgctgtcttcttcacttccccc acttatctttggaaatggatctcctcacttgaaacaggaaccatgaactg ccttacctggctgacagtgacctctctggatctcctctg
quality values	Open. Hide. 58 47 27 34 62 41 31 41 62 62 47 62 54 47 62 47 62 62 62 56 62 47 62 54 59 62 51 39 39 22 32 28 27 25 38 34 46 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 62 62 54 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 59 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 56 62 50 35 46 56 62 62 46 56 62 56 46 46 46 56 56 62 62 62 62 56 62 62 62 62 62 62 62 62 56 62 62 62 62 52 47 38 62 62 62 62 62 62 52 62 62 62 62 52 54 54 62 54 52 52 62 62 62 42 52 52 48 52 52 52 16 46 54 58 54 58 58 52 54 58 54 54 50 47 47 41 47 52 52 54 54 52 58 42 42 58 54 54 58 54 54 58 46 46 36 39 47 52 58 58 58 58 49 58 54 58 49 52 58 58 49 58 54 52 58 52 58 52 54 52 38 41 54 54 58 58 52 58 49 52 58 58 54 58 58 50 58 58 50 58 43 49 54 50 58 30 51 51 58 58 41 49 58 58 58 58 58 58 52 49 37 30 47 34 58 52 49 50 51 52 49 37 37 53 50 52 50 32 58 46 28 41 46 40 50 49 32 51 54 52 53 39 42 33 35 39 50 50 50 40 44 50 44 27 39 37 58 36 22 39 41 43 37 50 54 30 49 54 24 54 29 39 29 28 47 29 23 58 49 53 47 44 58 58 58 43 40 35 52 45 53 39 54 26 22 34 44 37 44 50 49 37 50 50 32 40 35 40 40 33 34 44 36 40 37 42 39 34 42 49 49 52 42 39 52 32 32 31 53 28 53 26 19 54 37 52 53 28 34 19 20 25 29 37 53 37 32 37 41 47 34 39 24 33 53 29 39 41 35 31 40 31 33 16 33 22 23 49 6 26 40 32 47 25 26 32 32 32 28 45 32 39 33 34 34 28 7 51 28 32 26 31 22 53 53 34 25 34 31 32 25 31 32 26 42 29 31 26 31 31 25 35 20 32 31 31 34 32 18 14 12 32 26 31 29 24 20 41 21 41 26 31 18 45 24 51 51 51 31 43 28 19 19 16 25 32 38 31 21 19 15 30 28 20 19 19 26 34 33 31 31 32 25 30 37 32 31 26 27 35 32 22 31 29 23 22 41 41 31 20 28 19 17 31 34 36 34 36 36 21 16 8 19 19 37 29 28 23 30 35 31 23 15 26 25 20 33 28 30 24 25 27 29 32 47 22 20 25 31 31 20 11 6 12 21 13 26 18 25 21 31 31 8 7 8 17 32 31 20 21 21 9 44 31 23 24 17 26 33 10 27 16 23 21 14 23 24 22 30 26 29 36 19 18 16 10 13 19 25 15 18 17 21 14 23 22 19 34 9 8 18 20 26 21 40 48 25 8 24 18 11 30 18 21 29 18 23 24 22 32 18 5 4 5 6 4 4 6 9 24 16 16 6 16 16 20 16 11 21 21 4 4 11 4 7 5 5 7 6 9 4 7 8 19 16 9 6 9 6 11 8 23 9 20 28 16 13 17 15 5 5 5 9 14 4 9 15 20 8 5 5 4 6 9 11 14 13 9 4 2 1 4 7 18 6 4 12 10 10 9 5 22 6 5 21 15 12 10 9 6 5 22 9 21 7 8 6 3 4 15 26 24 4 5 11 7 4 5 9 14 17 10 16 9 16 5 2 3 5 14 7 13 3 8 6 5 4 7 10 6 2 3 5 4 7 6 16 5 11 6 18 9 17 6 3 5 4 6 7 9 2 3 2 2 2 2 7 11 6 1 2 5 7 11 15 6 4 2 3 5 8 8 4 8 7 13 8 5 12 16 5 16 5 22 9 6 3 2 3 4 4	Open. Hide. 62 38 37 47 62 62 56 42 36 28 35 28 22 34 33 32 43 49 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 59 54 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 47 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 49 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 52 58 58 54 54 58 54 58 58 58 58 58 51 58 51 54 58 47 58 49 51 58 58 54 49 49 58 58 43 38 58 58 58 58 58 58 58 58 58 58 53 40 58 58 58 50 58 49 49 58 50 51 53 58 46 58 39 37 46 51 51 37 58 37 58 37 32 58 48 58 58 58 48 58 50 50 40 58 50 39 24 41 35 52 52 52 52 52 39 51 54 40 40 51 50 58 50 51 39 47 50 50 58 50 35 58 50 44 43 50 53 39 39 39 50 53 42 23 58 38 38 51 43 50 49 58 50 52 50 58 49 37 31 53 51 38 39 54 54 54 54 54 40 38 19 54 33 52 32 54 40 50 37 34 23 27 19 33 44 46 32 33 28 28 44 52 32 54 54 54 54 51 35 54 54 54 33 31 54 35 30 51 37 37 37 49 35 40 42 37 32 54 42 54 54 54 33 33 40 51 54 31 31 26 13 42 44 25 41 37 39 32 51 52 53 32 36 51 53 52 41 32 42 52 34 35 21 52 42 42 31 47 51 28 31 36 31 51 47 35 32 29 49 25 35 32 31 32 28 45 30 31 33 31 42 51 20 8 17 46 26 31 51 43 25 47 33 27 23 31 26 31 26 51 46 31 32 15 8 18 31 38 51 31 19 6 19 27 30 31 30 25 27 25 12 33 27 42 26 21 20 6 14 46 46 31 31 31 46 46 46 31 27 25 12 28 31 28 30 28 24 17 8 28 27 28 31 47 22 30 32 21 32 30 25 31 31 31 28 32 37 37 31 19 15 29 25 27 33 18 28 31 31 27 32 24 31 21 27 31 30 23 27 20 24 25 31 35 47 33 36 48 48 48 47 48 48 44 44 48 29 21 18 9 8 24 47 48 48 44 47 27 26 32 24 32 44 43 26 24 32 48 44 24 21 24 22 22 22 10 21 47 25 13 43 24 4 16 14 30 7 13 6 5 10 16 16 23 24 15 25 24 37 48 33 12 9 20 20 31 48 32 17 10 25 15 24 6 14 21 34 10 11 9 20 12 22 8 9 13 13 20 8 13 10 26 27 20 26 10 28 11 23 10 23 10 5 7 8 28 8 20 11 20 19 6 7 5 11 9 9 14 13 16 10 5 4 14 7 12 9 6 4 3 3 5 13 8 8 22 27 7 17 10 23 11 10 8 4 4 9 14 10 4 10 7 4 6 8 20 23 9 17 5 7 27 10 16 5 7 6 12 7 10 13 4 8 4 6 6 7 17 6 6 15 10 5 6 7 7 5 8 5 6 9 28 19 5 5 14 25 10 7 22 17 3 6 4 6 4 6 12 8 4 5 4 8 10 14 28 5 14 4 6 8 3 4 14 14 3 2 3 5 6 11 7 4 1 4 12 4 24 5 5 8 16 11 7 7 10 17 7 1 4 1 2 4 4 6 8 6 16 9 5 8 18 16 8 4 5 7 6 4 10 8 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_6299454_6300688
seq2: B6Ng01-338A18.b_47_1266 (reverse)

seq1  CAGGCTCCCTTGGCAAGGTAGCAAACTCATGGCCAGCATACCTCTGCCCT  50
      |||||||||||||| | | |||  | |||| | |||||     ||||   
seq2  CAGGCTCCCTTGGCCAAGGAGC-CATTCATTGGCAGCA-----CTGC---  41

seq1  CAGCAAGTGTCCATTGTGATGAGCTGCGCCTGACCTTCCCAGTTCGAGAT  100
       ||  |||||||||||  ||||| || | |||||  ||| ||||||||||
seq2  TAGGCAGTGTCCATTGGAATGAGGTG-GGCTGAC--TCCAAGTTCGAGAT  88

seq1  GGGGTGGTCCTGGAGCCCTTCCGCCTGC-AGCACAACCTGGCTGT-GAGC  148
       ||| ||  ||||||||  || || ||| |||| |  |||||||| ||||
seq2  TGGGAGGGTCTGGAGCC--TCGGCTTGCAAGCA-ACACTGGCTGTGGAGC  135

seq1  AACCATGTCTTCCAGCTCCGA-GATTCTG-TCTATAAGACCCTGATGCTG  196
      |||   ||||||||||||||| ||||||| ||||| ||| ||||||||||
seq2  AAC--AGTCTTCCAGCTCCGAGGATTCTGTTCTAT-AGA-CCTGATGCTG  181

seq1  AGGTGAGTCTCACTGCCATCTTGCCCCTGGTCCCTGGCTGCACAGTGTGG  246
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  AGGTGAGTCTCACTGCCATCTTGCCCCTGGT-CCTGGCTGCACAGTGTGG  230

seq1  GCTTCCATCATCTTCTTCCCTACTAGGCCTGACCTGGAG-CTGCAGTTTA  295
      ||||||||||||||||||||||||||| ||||||||||| ||||||||||
seq2  GCTTCCATCATCTTCTTCCCTACTAGG-CTGACCTGGAGCCTGCAGTTTA  279

seq1  AGTGCTATCACCATGAGGACCGGCAGATGAACACCAACTGGCCAGCATCT  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTATCACCATGAGGACCGGCAGATGAACACCAACTGGCCAGCATCT  329

seq1  GTGCAGGTCAGCGTCAATGCCACACCCCTCAGCATTGAGCGTGGAGACAA  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAGGTCAGCGTCAATGCCACACCCCTCAGCATTGAGCGTGGAGACAA  379

seq1  CAAGACCTCGCACAAGCCCCTCTACCTGAAGCATGTGTGCCAG-CCAGGT  444
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CAAGACCTCGCACAAGCCCCTCTACCTGAAGCATGTGTGCCAGCCCAGGT  429

seq1  CGCAACACCATCCAGATCACTGTCACCGCCTGCTGCTGTGTGCGTAGTGT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCAACACCATCCAGATCACTGTCACCGCCTGCTGCTGTGTGCGTAGTGT  479

seq1  GGGACTGTGGGCAGGGCTGGTATATACCCCCAGATTGTCGTCTCTCCTAT  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACTGTGGGCAGGGCTGGTATATACCCCCAGATTGTCGTCTCTCCTAT  529

seq1  GGGGTTCGGGAGCTTGTGGGTGAGGGTCTGTCTCCTTGAGAAGCAAGATG  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGTTCGGGAGCTTGTGGGTGAGGGTCTGTCTCCTTGAGAAGCAAGATG  579

seq1  TTGCTTTTCCATTTTACTCTGTTCTTGCCCTTTAAGAAAAGGGAACCGGA  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTTTCCATTTTACTCTGTTCTTGCCCTTTAAGAAAAGGGAACCGGA  629

seq1  CACCACCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGGTT  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGGTT  679

seq1  TCTGAGTTCCAGGCTAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCTAT  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAGTTCCAGGCTAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCTAT  729

seq1  ACAGAGAAACCCTGTCTCAGAAAGAAAAAAAAAAAAAGAAGAAGAAAAAA  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAGAAACCCTGTCTCAGAAAGAAAAAAAAAAAAAGAAGAAGAAAAAA  779

seq1  AGAAAAAGAAAAAGAAAAGGGAACCAGTTAAATACGCTCTGTTACATTAA  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAAGAAAAAGAAAAGGGAACCAGTTAAATACGCTCTGTTACATTAA  829

seq1  AAAGATTTAATGCTCCTGTTGATTATGTCAGAGAAACCAAGCTCATGGAA  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATTTAATGCTCCTGTTGATTATGTCAGAGAAACCAAGCTCATGGAA  879

seq1  GATGTCCCATCTGTACTGTCTGGGCCTCACCAGGCTCCAGTGGGCAGGGT  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTCCCATCTGTACTGTCTGGGCCTCACCAGGCTCCAGTGGGCAGGGT  929

seq1  CCCAAGTAGACCTTGAGCTGCAGGCCAGCAGGAGCCATGCTGATTGAGGT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGTAGACCTTGAGCTGCAGGCCAGCAGGAGCCATGCTGATTGAGGT  979

seq1  GGCACAGAGATAGAGTGGCTCAGAAGCCATAGCATGCCAGGAGTGTCTTG  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACAGAGATAGAGTGGCTCAGAAGCCATAGCATGCCAGGAGTGTCTTG  1029

seq1  ACAGAAAACTAGACAGTGGTCGAGCAATACCAGAGTGCTCTGCTGAGGGC  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAAAACTAGACAGTGGTCGAGCAATACCAGAGTGCTCTGCTGAGGGC  1079

seq1  TGAGGCAGTGTGGTAACAAAATAGAAAAGCCCCTGCCTATGTGTCAGCAC  1144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCAGTGTGGTAACAAAATAGAAAAGCCCCTGCCTATGTGTCAGCAC  1129

seq1  TCAGGAGAGCCTCGCTGCCAGGATGGTGGCTGGCTTGGCTTTCTTCCATA  1194
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGAGAGCCTCGCTGCCAGGATGGTGGCTGGCTTGGCTTTCTTCCATA  1179

seq1  CTAAGCTCTTCCTTCCCTCTGTGCCTGCACTCCTTGAATTC  1235
      |||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGCTCTTCCTTCCCTCTGTGCCTGCACTCCTTGAATTC  1220

seq1: chr11_6184856_6186049
seq2: B6Ng01-338A18.g_63_1251

seq1  GAATTCCCTTCAAAAGCTGTAAAATATACAGGGCGGTCATGGCGCATGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTTCAAAAGCTGTAAAATATACAGGGCGGTCATGGCGCATGCC  50

seq1  TTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTTGAG  100

seq1  GCCAGCCTGGTTTAAAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGCCTGGTTTAAAGAGTGAGTTCCAGGACAGCCAGGGCTACACAGAG  150

seq1  AAACCCTGTCTCAAAAACAAAACAAAACAAAAACAAAAACAAAAACAAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCCTGTCTCAAAAACAAAACAAAACAAAAACAAAAACAAAAACAAAA  200

seq1  ACAAACAAAACATAAAATAAATGAAATCTTAAAAAAAGAAAAAGAACAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAAACATAAAATAAATGAAATCTTAAAAAAAGAAAAAGAACAAA  250

seq1  TGATTTAAAAACTAGACAGATGGGAGAACATATGCATGTAGTGCCAGCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTAAAAACTAGACAGATGGGAGAACATATGCATGTAGTGCCAGCTG  300

seq1  TTTGGAAGACAGGAGGATGGCTTACGTCCAGGGGTTGAAGGACAGCCTAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGAAGACAGGAGGATGGCTTACGTCCAGGGGTTGAAGGACAGCCTAG  350

seq1  GTTAAAAAGTAGGACCCATCTCAATTTAAAAAGTCAGAGATCAGGCTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAAAAGTAGGACCCATCTCAATTTAAAAAGTCAGAGATCAGGCTGGA  400

seq1  GAAATGGCTCAGCGGTTAAGAGCACCAACCACTCTTTGAGAGGTTCTGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATGGCTCAGCGGTTAAGAGCACCAACCACTCTTTGAGAGGTTCTGAA  450

seq1  TTTAATTTCCAGCAACCACATGGTGGCTCACAACCATCCGTAAAGGGGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATTTCCAGCAACCACATGGTGGCTCACAACCATCCGTAAAGGGGTC  500

seq1  TGATGCCCAATTCTGGTGTGTCTGAAGGGAGCAATGGTGGTGTATTCATA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATGCCCAATTCTGGTGTGTCTGAAGGGAGCAATGGTGGTGTATTCATA  550

seq1  TGCCTAACATAAATAAATAAACCTTTTTTTTTTTAAAAGAAAAGTCAGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTAACATAAATAAATAAACCTTTTTTTTTTTAAAAGAAAAGTCAGAG  600

seq1  ATCAGAGGATTAGGAGTTCAAGACCAGTCTAGGCCATCTATATAGTTAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGAGGATTAGGAGTTCAAGACCAGTCTAGGCCATCTATATAGTTAAA  650

seq1  CCCTCCCTTCAAAGAACAAATAAACAGGTAAAAAAACAAACAAACAAAAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCCTTCAAAGAACAAATAAACAGGTAAAAAAACAAACAAACAAAAC  700

seq1  CCTCCCCTAGTTTTGTTTTTAAAGAACATTATCAAGAAAATGAAGACAAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCCCTAGTTTTGTTTTTAAAGAACATTATCAAGAAAATGAAGACAAC  750

seq1  GCACAAAATGGGGGTGGGAGTGAGAAATATTTGCAAATCACATATCTGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAAAATGGGGGTGGGAGTGAGAAATATTTGCAAATCACATATCTGGC  800

seq1  AGGGTTTAAATAACCAAAGCAAGTAAATAACTCTTACAACTCAACAAAAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGTTTAAATAACCAAAGCAAGTAAATAACTCTTACAACTCAACAAAAC  850

seq1  AAAAACAACTACCACAAGCTTTGAATTCTGACAGGAGCCTGGAATAGAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACAACTACCACAAGCTTTGAATTCTGACAGGAGCCTGGAATAGAAT  900

seq1  ATATACAAATGGGAAAAAAAAAAAGCAGGGGGGGGCGTGGGGTAAAACAC  950
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  ATATACAAATGGGAAAAAAAAAAAGCAAGGGGGGGCGTGGGGTAAAACAC  950

seq1  TTGAAAGGGTACTTGATAAAGCTAGCTTTCAGGAAAGTCTGTATCTGTGT  1000
      |||||||||||| ||| |||||||||||||||||||||||||||||||||
seq2  TTGAAAGGGTAC-TGAAAAAGCTAGCTTTCAGGAAAGTCTGTATCTGTGT  999

seq1  CATATGTGTCATATGTGTCATATGTGTCATATGT-GTGTGCCTGCATGTT  1049
      |||||||||||||||||||||||||||||||||| |||   |||||||||
seq2  CATATGTGTCATATGTGTCATATGTGTCATATGTGGTGGTGCTGCATGTT  1049

seq1  TGTATGACACTCTGGAGGCTAG-AGACTGATGTTGCCTGTCTTCCTCACT  1098
         |||||||||||   ||||| |||||||   || |||||||| |||||
seq2  --GATGACACTCTG--AGCTAGAAGACTGAATGTG-CTGTCTTCTTCACT  1094

seq1  TCCCCCCACCTTATCTTTTGAAATGGGATCT-CTCACTGAAACCAGCACC  1147
      ||||||   ||||||||| ||||| |||||| ||||||  || ||| | |
seq2  TCCCCC--ACTTATCTTTGGAAAT-GGATCTCCTCACTTGAAACAGGAAC  1141

seq1  CACTGACTGGCTAAACTGGCTGACCAGGGAGCTCTCTGGA--TCCTCTG  1194
      ||   |||| || | |||||||| ||| || |||||||||  |||||||
seq2  CATGAACTGCCTTACCTGGCTGA-CAGTGACCTCTCTGGATCTCCTCTG  1189

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information