MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-341M03
Chromosome	11 (Build37)
Map Location	88,163,031 - 88,315,341
singlet/doublet	doublet
Overlap gene	Msi2
Upstream gene	Ppm1e, Rad51c, Tex14, Sept4, Mtmr4, Hsf5, Rnf43, Supt4h1, Bzrap1, Mpo, Lpo, Mks1, Epx, Olfr462, Olfr463, Olfr464, Dynll2, Sfrs1, Vezf1, Cuedc1, Mrps23, 1700106J16Rik, LOC668793
Downstream gene	LOC100038945, Akap1, Scpep1, OTTMUSG00000001305, 2210409E12Rik, Coil, LOC100039051, Trim25, Dgke, A930013B10Rik, Gm525, LOC100039114, Nog, LOC100039047, 4932411E22Rik, Ankfn1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ppm1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320472 MGI:2444096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad51c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114714 MGI:2150020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83560 MGI:1933227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18952 MGI:1270156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170749 MGI:2180699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327992 MGI:2685585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207742 MGI:2442609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt4h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20922 MGI:107416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bzrap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207777 MGI:2450877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17523 MGI:97137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76113 MGI:1923363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mks1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380718 MGI:3584243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13861 MGI:107569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr462 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258406 MGI:3030296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr463 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258408 MGI:3030297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258407 MGI:3030298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dynll2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68097 MGI:1915347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfrs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110809 MGI:98283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vezf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22344 MGI:1313291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cuedc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103841 MGI:2144281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64656 MGI:1928138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700106J16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74297 MGI:1921547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs

name	LOC668793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Msi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76626 MGI:1923876
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 2 Proteins

name	Akap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11640 MGI:104729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Scpep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74617 MGI:1921867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000001305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217066 MGI:3651308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	2210409E12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72381 MGI:1919631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Coil (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12812 MGI:104842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039051 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Trim25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217069 MGI:102749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgke (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56077 MGI:1889276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930013B10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414094 MGI:3041185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	Gm525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217071 MGI:2685371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Nog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18121 MGI:104327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039047 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	4932411E22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214604 MGI:3045332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382543 MGI:2686021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppm1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130345 GeneID:320472 MGI:2444096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1E (PP2C domain containing) transcript_id : NM_177167.4

name	Rad51c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593000 GeneID:114714 MGI:2150020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rad51 homolog c (S. cerevisiae) transcript_id : NM_053269.2

name	Tex14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878214 GeneID:83560 MGI:1933227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 14 transcript_id : NM_031386.1

name	Sept4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755119 GeneID:18952 MGI:1270156
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 4 transcript_id : NM_011129.1

name	Mtmr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875367 GeneID:170749 MGI:2180699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 4 transcript_id : NM_133215.1

name	Hsf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865886 GeneID:327992 MGI:2685585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock transcription factor family member 5 transcript_id : NM_001045527.1

name	Rnf43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802131 GeneID:207742 MGI:2442609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 43 transcript_id : NM_172448.2

name	Supt4h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678180 GeneID:20922 MGI:107416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 4 homolog 1 (S. cerevisiae) transcript_id : NM_009296.1

name	Bzrap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369600 GeneID:207777 MGI:2450877
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : benzodiazapine receptor associated protein 1 transcript_id : NM_172449.1

name	Mpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754731 GeneID:17523 MGI:97137
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloperoxidase transcript_id : NM_010824.1

name	Lpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17975592 GeneID:76113 MGI:1923363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactoperoxidase transcript_id : NM_080420.1

name	Mks1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89199234 GeneID:380718 MGI:3584243
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Meckel syndrome, type 1 transcript_id : NM_001039684.1

name	Epx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679674 GeneID:13861 MGI:107569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil peroxidase transcript_id : NM_007946.1

name	Olfr462 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239009 GeneID:258406 MGI:3030296
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 462 transcript_id : NM_146411.1

name	Olfr463 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239013 GeneID:258408 MGI:3030297
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 463 transcript_id : NM_146413.1

name	Olfr464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239007 GeneID:258407 MGI:3030298
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 464 transcript_id : NM_146412.1

name	Dynll2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802589 GeneID:68097 MGI:1915347
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain LC8-type 2 transcript_id : NM_026556.3

name	Sfrs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118582270 GeneID:110809 MGI:98283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 1 (ASF/SF2) transcript_id : NM_001078167.1

name	Sfrs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598842 GeneID:110809 MGI:98283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor, arginine/serine-rich 1 (ASF/SF2) transcript_id : NM_173374.3

name	Vezf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117414175 GeneID:22344 MGI:1313291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vascular endothelial zinc finger 1 transcript_id : NM_016686.3

name	Cuedc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574103 GeneID:103841 MGI:2144281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUE domain containing 1 transcript_id : NM_198013.1

name	Mrps23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130310 GeneID:64656 MGI:1928138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S23 transcript_id : NM_024174.5

name	1700106J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390265 GeneID:74297 MGI:1921547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs product : RIKEN cDNA 1700106J16 gene transcript_id : XM_484061.3

name	Msi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286824 GeneID:76626 MGI:1923876
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Musashi homolog 2 (Drosophila) transcript_id : NM_054043.3

name	LOC100038945 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262367 GeneID:100038945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs, 2 Proteins product : similar to Musashi homolog 2 (Drosophila) transcript_id : XM_001471946.1

name	Akap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347476 GeneID:11640 MGI:104729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 1 transcript_id : NM_001042541.1

name	Akap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347488 GeneID:11640 MGI:104729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 1 transcript_id : NM_009648.2

name	Scpep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982616 GeneID:74617 MGI:1921867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine carboxypeptidase 1 transcript_id : NM_029023.2

name	Coil (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053928 GeneID:12812 MGI:104842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coilin transcript_id : NM_016706.2

name	LOC100039051 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262372 GeneID:100039051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039051 transcript_id : XM_001472257.1

name	Trim25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849790 GeneID:217069 MGI:102749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 25 transcript_id : NM_009546.1

name	Dgke (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432551 GeneID:56077 MGI:1889276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase, epsilon transcript_id : NM_019505.3

name	Gm525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366077 GeneID:217071 MGI:2685371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 525, (NCBI) transcript_id : NM_001033266.2

name	LOC100039114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262374 GeneID:100039114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039114 transcript_id : XM_001472509.1

name	Nog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110674 GeneID:18121 MGI:104327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : noggin transcript_id : NM_008711.1

name	LOC100039047 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262370 GeneID:100039047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : hypothetical protein LOC100039047 transcript_id : XM_001472161.1

name	4932411E22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803578 GeneID:214604 MGI:3045332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932411E22 gene transcript_id : NM_172534.2

name	Ankfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286855 GeneID:382543 MGI:2686021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin-repeat and fibronectin type III domain containing 1 transcript_id : NM_001080933.1

name	Ppm1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54873617 CCDS:CCDS25211.1 GeneID:320472 MGI:2444096
definition	codon_start : 1 product : protein phosphatase 1E (PP2C domain containing) protein_id : NP_796141.2

name	Rad51c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716605 CCDS:CCDS25212.1 GeneID:114714 MGI:2150020
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Rad51 homolog c protein_id : NP_444499.1

name	Tex14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878215 GeneID:83560 MGI:1933227
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : from 5'-RACE analysis product : testis expressed gene 14 protein_id : NP_113563.1

name	Sept4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755120 CCDS:CCDS25213.1 GeneID:18952 MGI:1270156
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IMP] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0048240 - sperm capacitation [Evidence IMP]; GO:0030382 - sperm mitochondrion organization and biogenesis [Evidence IMP]; GO:0007286 - spermatid development [Evidence IMP] codon_start : 1 note : peanut-like 2 homolog; M-Septin; septin H5; cell division control-related protein 2b product : septin 4 protein_id : NP_035259.1

name	Mtmr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875368 CCDS:CCDS25214.1 GeneID:170749 MGI:2180699
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA] codon_start : 1 note : FYVE zinc finger phosphatase product : myotubularin related protein 4 protein_id : NP_573478.1

name	Hsf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865887 GeneID:327992 MGI:2685585
definition	codon_start : 1 product : heat shock transcription factor family member 5 protein_id : NP_001038992.1

name	Rnf43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369607 CCDS:CCDS25215.1 GeneID:207742 MGI:2442609
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 43 protein_id : NP_766036.1

name	Supt4h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678181 GeneID:20922 MGI:107416
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008159 - positive transcription elongation factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IEA] codon_start : 1 product : suppressor of Ty 4 homolog 1 protein_id : NP_033322.1

name	Bzrap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369601 GeneID:207777 MGI:2450877
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : peripheral-type benzodiazepine receptor-associated protein 1 product : benzodiazapine receptor associated protein 1 protein_id : NP_766037.1

name	Mpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754732 CCDS:CCDS25217.1 GeneID:17523 MGI:97137
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IDA] GO_process : GO:0042744 - hydrogen peroxide catabolism [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myeloperoxidase protein_id : NP_034954.1

name	Lpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17975593 CCDS:CCDS25218.1 GeneID:76113 MGI:1923363
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : lactoperoxidase protein_id : NP_536345.1

name	Mks1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89199235 GeneID:380718 MGI:3584243
definition	codon_start : 1 exception : mismatches in translation note : FABB proteome-like product : Meckel syndrome, type 1 protein_id : NP_001034773.1

name	Epx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679675 CCDS:CCDS25220.1 GeneID:13861 MGI:107569
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA] GO_process : GO:0042744 - hydrogen peroxide catabolism [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IEA] codon_start : 1 exception : mismatches in translation product : eosinophil peroxidase protein_id : NP_031972.1

name	Olfr462 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239010 CCDS:CCDS25221.1 GeneID:258406 MGI:3030296
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PAEV-9536824-9535889; olfactory receptor MOR240-3 product : olfactory receptor 462 protein_id : NP_666523.1

name	Olfr463 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239014 CCDS:CCDS25222.1 GeneID:258408 MGI:3030297
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PAEV-9540823-9539888; olfactory receptor MOR240-1 product : olfactory receptor 463 protein_id : NP_666525.1

name	Olfr464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239008 CCDS:CCDS25223.1 GeneID:258407 MGI:3030298
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PAEV-9555122-9554181; olfactory receptor MOR240-2 product : olfactory receptor 464 protein_id : NP_666524.1

name	Dynll2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18087731 GeneID:68097 MGI:1915347
definition	GO_component : GO:0030286 - dynein complex [Evidence NAS] [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0016459 - myosin [Evidence IDA] GO_function : GO:0003774 - motor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0046907 - intracellular transport [Evidence NAS] codon_start : 1 product : dynein light chain 2 protein_id : NP_080832.1

name	Sfrs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328400 GeneID:110809 MGI:98283
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : splicing factor, arginine/serine-rich 1 isoform 1 protein_id : NP_775550.2

name	Sfrs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118582271 GeneID:110809 MGI:98283
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006376 - mRNA splice site selection [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : splicing factor, arginine/serine-rich 1 isoform 2 protein_id : NP_001071635.1

name	Vezf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117414176 GeneID:22344 MGI:1313291
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0001885 - endothelial cell development [Evidence IMP] codon_start : 1 product : vascular endothelial zinc finger 1 protein_id : NP_057895.2

name	Cuedc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574104 CCDS:CCDS25226.1 GeneID:103841 MGI:2144281
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : CUE domain containing 1 protein_id : NP_932130.1

name	Mrps23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27228982 CCDS:CCDS25227.1 GeneID:64656 MGI:1928138
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] codon_start : 1 product : mitochondrial ribosomal protein S23 protein_id : NP_077136.2

name	1700106J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51828639 GeneID:74297 MGI:1921547
definition	codon_start : 1 product : hypothetical protein LOC74297 protein_id : XP_484061.1

name	Msi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17157989 GeneID:76626 MGI:1923876
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005844 - polysome [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008266 - poly(U) binding [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003727 - single-stranded RNA binding [Evidence IDA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : Musashi2 product : Musashi homolog 2 protein_id : NP_473384.1

name	LOC100038945 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262368 GeneID:100038945
definition	codon_start : 1 product : similar to Musashi homolog 2 (Drosophila) protein_id : XP_001471996.1

name	Akap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347477 GeneID:11640 MGI:104729
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : A kinase anchor protein product : A-kinase anchor protein 1 protein_id : NP_001036006.1

name	Akap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347489 CCDS:CCDS25229.1 GeneID:11640 MGI:104729
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : A kinase anchor protein product : A-kinase anchor protein 1 protein_id : NP_033778.2

name	Scpep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982617 CCDS:CCDS25230.1 GeneID:74617 MGI:1921867
definition	GO_function : GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : retinoid-inducible serine caroboxypetidase; retinoid-inducible serine caroboxypeptidase; serine caroboxypeptidase 1 product : serine carboxypeptidase 1 protein_id : NP_083299.2

name	Coil (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053929 GeneID:12812 MGI:104842
definition	GO_component : GO:0015030 - Cajal body [Evidence IDA]; GO:0001674 - female germ cell nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : nuclear phosphoprotein of Cajal body; p80 Coilin product : coilin protein_id : NP_057915.2

name	LOC100039051 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262373 GeneID:100039051
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472307.1

name	Trim25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849791 GeneID:217069 MGI:102749
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : estrogen-responsive finger protein; zinc finger protein 147 product : tripartite motif protein 25 protein_id : NP_033572.1

name	Dgke (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506541 CCDS:CCDS25234.1 GeneID:56077 MGI:1889276
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IEA] codon_start : 1 product : diacylglycerol kinase, epsilon protein_id : NP_062378.1

name	Gm525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701760 GeneID:217071 MGI:2685371
definition	codon_start : 1 note : novel transcript product : hypothetical protein LOC217071 protein_id : NP_001028438.1

name	LOC100039114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262375 GeneID:100039114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472559.1

name	Nog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110675 CCDS:CCDS25236.1 GeneID:18121 MGI:104327
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_process : GO:0030509 - BMP signaling pathway [Evidence IDA]; GO:0007420 - brain development [Evidence IMP]; GO:0051216 - cartilage development [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007417 - central nervous system development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0045596 - negative regulation of cell differentiation [Evidence IEA]; GO:0007389 - pattern specification [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP]; GO:0001657 - ureteric bud development [Evidence IDA] codon_start : 1 product : noggin protein_id : NP_032737.1

name	LOC100039047 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262371 GeneID:100039047
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472211.1

name	4932411E22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369752 CCDS:CCDS25237.1 GeneID:214604 MGI:3045332
definition	codon_start : 1 product : hypothetical protein LOC214604 protein_id : NP_766122.1

name	Ankfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286856 GeneID:382543 MGI:2686021
definition	codon_start : 1 product : ankyrin-repeat and fibronectin type III domain containing 1 protein_id : NP_001074402.1

name	LOC668793 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668793
definition	number : 1 pseudo : _no_value

name	OTTMUSG00000001305 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262364 GeneID:217066 MGI:3651308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000001305 pseudo : _no_value transcript_id : XR_035754.1

name	2210409E12Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:134053860 GeneID:72381 MGI:1919631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210409E12 gene pseudo : _no_value transcript_id : NR_003492.1

name	A930013B10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262369 GeneID:414094 MGI:3041185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : RIKEN cDNA A930013B10 gene transcript_id : XR_035174.1

clone name	MSMg01-442A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108J18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-477E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-261M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-307D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-341M03.b	B6Ng01-341M03.g
ACC	GA125050	GA125051
length	335	1,007
definition	B6Ng01-341M03.b	B6Ng01-341M03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(88,163,031 - 88,163,365)	(88,314,331 - 88,315,341)
sequence	atctctgtgtgcacgtgtggatgtttcatcccatttctcttggtttttgg atccattgaatgacgaatttgtgtgtgggtttttttttgtttgtttgttt tttaaagacaaaataaaaagatcttcattctgtatcccccttctcccccc acccccactggctactcccgccctcccacccttcagtttataccctgcat gaaaattggcaatattgaggtggtcagaggatggcatatgtcatggaaag ttcaggcatcttaacgtaacagtaatgatggcggcagagtcctcttttgg ggtgcagagcagggatggagggagggaggggatgg	gaattcactcctttgattattttgtcattaacaaccaaggggtgtgacta gaggcggctttcccattaagtcagtaacggctttgtcatccaggaaggtt tgcacctatacctggtgcagggattttgttgctagggttagaaggttttg aagagactgcacagtgtgcatacatcgggggcctgtcacccattcttcct tagctgaggtgccatccaccctccgtgatgctgatgcagccctgggagca gatgtatagctaggttcgggtctgggttccagcctgttcaccagaccctg ggcttctgtttatgactaattgctttgtttgttctgtatgagacacttaa ttttttccccgtgatttactcctctttgtaattaggtgtagtgattagaa tcttgttcctattacaatggagttttgcttttaattcatgcacgttcacc aggcctgtctctgtctgttcattgattgtccccaattggcttttcccaag ctgtcatataaatcacagttcaggggtggcttagagactgatgtgagtcc aaggaaccaaagagggctgactgggaattcctttgcattcagctgggcag gagcagtgtattcctggggatgaagtctccataattgaggtacaaagagt tgcaaattaataaatgtccctcaccatattatcccctgcatcgctccttt taaaaattaaagatgttatctctcttgtgcacacagtactaagaaaaggt gtgggaagcaaaaacgaaaatttataaaaaaaaaaaataactggtatttt ctccttctcttcagtcgcttctgctatgcatatgtaatgcatgcattaaa aagtaaaaatgtttgcatggccctttttgatagactaacagcacacatgt gtcaactaccccaaggtcactgtcccgtagatcctggatcttagagtcca aggagtgggcagtccccagagtttcttttttgtttttggtaattggttga atgtgtg
quality values	Open. Hide. 26 59 59 62 62 62 59 62 59 59 59 59 59 59 62 62 62 62 62 62 49 43 54 59 59 43 46 21 40 32 28 30 29 51 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 42 42 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 36 35 47 62 46 62 62 62 62 62 62 62 62 49 54 62 62 62 47 45 35 12	Open. Hide. 62 54 51 47 62 59 34 59 62 45 43 28 28 28 28 20 24 26 39 59 62 62 62 59 62 59 49 62 59 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 59 56 42 54 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 58 58 58 58 58 58 45 36 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 54 58 58 54 58 58 58 52 58 49 58 54 58 58 49 54 58 58 58 58 58 58 58 54 32 58 54 58 58 45 42 54 52 54 58 58 58 40 58 58 53 58 58 58 49 58 58 58 58 58 40 41 51 50 58 51 58 58 54 53 50 51 58 53 49 53 51 58 54 58 58 51 53 39 58 44 31 51 58 50 49 58 35 46 52 51 50 58 51 58 41 43 49 39 26 50 58 49 40 53 53 53 50 51 39 53 50 52 52 58 51 58 32 58 37 39 50 38 58 58 40 58 37 50 51 50 47 31 58 52 35 51 42 49 51 38 58 52 52 51 41 52 58 38 39 42 39 33 39 32 50 52 45 42 49 49 49 54 54 49 39 53 38 9 9 5 5 6 16 39 54 31 54 54 26 25 54 54 54 42 35 53 35 54 47 35 34 25 41 31 37 52 52 53 53 53 53 40 34 33 54 42 45 40 29 52 31 45 28 39 40 43 40 40 21 44 40 49 54 54 25 29 53 34 53 53 34 52 52 37 47 29 32 41 40 46 47 32 32 26 52 40 40 17 20 52 45 39 39 39 53 51 51 53 53 51 51 51 51 51 31 31 26 33 31 31 30 33 16 25 31 51 51 39 43 31 24 37 27 35 31 27 30 37 25 31 25 16 21 30 17 31 38 37 37 31 42 35 38 28 31 34 32 26 43 32 34 33 34 33 30 31 43 26 24 31 30 31 28 37 12 19 48 48 48 42 26 26 34 46 48 48 31 29 30 29 48 28 25 24 21 28 18 27 14 47 30 23 48 48 46 23 11 31 25 30 26 36 25 19 12 25 26 25 29 33 30 29 30 31 15 26 42 31 27 14 21 21 30 35 28 14 30 38 38 30 8 22 32 32 27 31 26 28 32 42 31 20 38 31 24 20 44 6 22 20 22 18 19 13 14 9 20 24 21 33 15 7 22 12 24 27 24 17 14 25 13 43 7 23 15 36 30 21 21 21 24 26 39 36 30 11 11 24 7 18 39 16 29 15 47 48 48 39 26 6 10 31 37 31 19 13 18 26 7 7 16 12 13 19 12 12 16 21 23 14 10 5 8 11 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_88163031_88163365
seq2: B6Ng01-341M03.b_50_384

seq1  ATCTCTGTGTGCACGTGTGGATGTTTCATCCCATTTCTCTTGGTTTTTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCTGTGTGCACGTGTGGATGTTTCATCCCATTTCTCTTGGTTTTTGG  50

seq1  ATCCATTGAATGACGAATTTGTGTGTGGGTTTTTTTTTGTTTGTTTGTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCATTGAATGACGAATTTGTGTGTGGGTTTTTTTTTGTTTGTTTGTTT  100

seq1  TTTAAAGACAAAATAAAAAGATCTTCATTCTGTATCCCCCTTCTCCCCCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAAGACAAAATAAAAAGATCTTCATTCTGTATCCCCCTTCTCCCCCC  150

seq1  ACCCCCACTGGCTACTCCCGCCCTCCCACCCTTCAGTTTATACCCTGCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCCACTGGCTACTCCCGCCCTCCCACCCTTCAGTTTATACCCTGCAT  200

seq1  GAAAATTGGCAATATTGAGGTGGTCAGAGGATGGCATATGTCATGGAAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATTGGCAATATTGAGGTGGTCAGAGGATGGCATATGTCATGGAAAG  250

seq1  TTCAGGCATCTTAACGTAACAGTAATGATGGCGGCAGAGTCCTCTTTTGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGCATCTTAACGTAACAGTAATGATGGCGGCAGAGTCCTCTTTTGG  300

seq1  GGTGCAGAGCAGGGATGGAGGGAGGGAGGGGATGG  335
      |||||||||||||||||||||||||||||||||||
seq2  GGTGCAGAGCAGGGATGGAGGGAGGGAGGGGATGG  335

seq1: chr11_88314331_88315341
seq2: B6Ng01-341M03.g_69_1075 (reverse)

seq1  CACACATTCAACCAATAACCAAAAAACAAAAAAGGAAACTCTGGGGACTG  50
      |||||||||||||||| ||| |||||||||||| ||||||||||||||||
seq2  CACACATTCAACCAATTACC-AAAAACAAAAAA-GAAACTCTGGGGACTG  48

seq1  CCCACTTCCTTGGACTCTAAGATCCAGGATCTTACGGGACAGTGACCTTG  100
      ||||| ||||||||||||||||||||||||| ||||||||||||||||||
seq2  CCCAC-TCCTTGGACTCTAAGATCCAGGATC-TACGGGACAGTGACCTTG  96

seq1  GGGTAGTTGACACATGTGTGCTGTTAGTCTATCAAAAAGGGCCATGCAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTAGTTGACACATGTGTGCTGTTAGTCTATCAAAAAGGGCCATGCAAA  146

seq1  CATTTTTACTTTTTAATGCATGCATTACATATGCATAGCAGAAGCGACTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTTACTTTTTAATGCATGCATTACATATGCATAGCAGAAGCGACTG  196

seq1  AAGAGAAGGAGAAAATACCAGTTATTTTTTTTTTTTATAAATTTTCGTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAAGGAGAAAATACCAGTTATTTTTTTTTTTTATAAATTTTCGTTT  246

seq1  TTGCTTCCCACACCTTTTCTTAGTACTGTGTGCACAAGAGAGATAACATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTCCCACACCTTTTCTTAGTACTGTGTGCACAAGAGAGATAACATC  296

seq1  TTTAATTTTTAAAAGGAGCTATGCAGGGGATAATATGGTGAGGGACATTT  350
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TTTAATTTTTAAAAGGAGCGATGCAGGGGATAATATGGTGAGGGACATTT  346

seq1  ATTAATTTGCAACTCTTTGTACCTCAATTATGGAGACTTCATCCCCAGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAATTTGCAACTCTTTGTACCTCAATTATGGAGACTTCATCCCCAGGA  396

seq1  ATACACTGCTCCTGCCCAGCTGAATGCAAAGGAATTCCCAGTCAGCCCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACACTGCTCCTGCCCAGCTGAATGCAAAGGAATTCCCAGTCAGCCCTC  446

seq1  TTTGGTTCCTTGGACTCACATCAGTCTCTAAGCCACCCCTGAACTGTGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGTTCCTTGGACTCACATCAGTCTCTAAGCCACCCCTGAACTGTGAT  496

seq1  TTATATGACAGCTTGGGAAAAGCCAATTGGGGACAATCAATGAACAGACA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATATGACAGCTTGGGAAAAGCCAATTGGGGACAATCAATGAACAGACA  546

seq1  GAGACAGGCCTGGTGAACGTGCATGAATTAAAAGCAAAACTCCATTGTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACAGGCCTGGTGAACGTGCATGAATTAAAAGCAAAACTCCATTGTAA  596

seq1  TAGGAACAAGATTCTAATCACTACACCTAATTACAAAGAGGAGTAAATCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGAACAAGATTCTAATCACTACACCTAATTACAAAGAGGAGTAAATCA  646

seq1  CGGGGAAAAAATTAAGTGTCTCATACAGAACAAACAAAGCAATTAGTCAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGGAAAAAATTAAGTGTCTCATACAGAACAAACAAAGCAATTAGTCAT  696

seq1  AAACAGAAGCCCAGGGTCTGGTGAACAGGCTGGAACCCAGACCCGAACCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAGAAGCCCAGGGTCTGGTGAACAGGCTGGAACCCAGACCCGAACCT  746

seq1  AGCTATACATCTGCTCCCAGGGCTGCATCAGCATCACGGAGGGTGGATGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTATACATCTGCTCCCAGGGCTGCATCAGCATCACGGAGGGTGGATGG  796

seq1  CACCTCAGCTAAGGAAGAATGGGTGACAGGCCCCCGATGTATGCACACTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTCAGCTAAGGAAGAATGGGTGACAGGCCCCCGATGTATGCACACTG  846

seq1  TGCAGTCTCTTCAAAACCTTCTAACCCTAGCAACAAAATCCCTGCACCAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGTCTCTTCAAAACCTTCTAACCCTAGCAACAAAATCCCTGCACCAG  896

seq1  GTATAGGTGCAAACCTTCCTGGATGACAAAGCCGTTACTGACTTAATGGG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATAGGTGCAAACCTTCCTGGATGACAAAGCCGTTACTGACTTAATGGG  946

seq1  AAAGCCGCCTCTAGTCACACCCCTTGGTTGTTAATGACAAAATAATCAAA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCGCCTCTAGTCACACCCCTTGGTTGTTAATGACAAAATAATCAAA  996

seq1  GGAGTGAATTC  1011
      |||||||||||
seq2  GGAGTGAATTC  1007

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information