MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-346B01
Chromosome	11 (Build37)
Map Location	96,617,303 - 96,634,483
singlet/doublet	doublet
Overlap gene	Skap1, Snx11
Upstream gene	Zfp652, EG665273, Phospho1, Abi3, Gngt2, LOC100040014, B4galnt2, Igf2bp1, LOC100040040, Gip, Snf8, Ube2z, Atp5g1, Ndp52, Ttll6, Hoxb13, LOC432593, LOC100039639, Gm53, Hoxb9, Hoxb8, Hoxb7, Hoxb6, Hoxb5, Hoxb4, Hoxb3, Hoxb2, Hoxb1, LOC100040242, OTTMUSG00000001775
Downstream gene	Cbx1, LOC629750, Nfe2l1, Copz2, LOC100040373, LOC665436, Cdk5rap3, Atad4, Pnpo, D030028A08Rik, Sp2, Sp6, Scrn2, Lrrc46, Mrpl10, Osbpl7, Tbx21, Tbkbp1, Kpnb1, Npepps, EG665490, Mrpl45, Gpr179, Socs7, 4933428G20Rik, P140, 2410003L11Rik, E130012A19Rik, Mllt6, Mel13, Pcgf2, Psmb3, Pip5k2b, 2810474C18Rik, Ccdc49, LOC100040708, 1700001P01Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp652 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268469 MGI:2442221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665273 MGI:3644307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Phospho1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237928 MGI:2447348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abi3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66610 MGI:1913860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gngt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14710 MGI:893584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	B4galnt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14422 MGI:1342058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igf2bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140486 MGI:1890357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040040 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Gip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14607 MGI:107504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27681 MGI:1343161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2z (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268470 MGI:1343160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11951 MGI:107653
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndp52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76815 MGI:1343177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttll6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237930 MGI:2683461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15408 MGI:107730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC432593 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	LOC100039639 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 889 ESTs, 1 Protein pseudo : _no_value

name	Gm53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193022 MGI:2684899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Hoxb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15417 MGI:96190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15416 MGI:96189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15415 MGI:96188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15414 MGI:96187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15413 MGI:96186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15412 MGI:96185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15410 MGI:96184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hoxb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103889 MGI:96183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hoxb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15407 MGI:96182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040242 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs, 3 Proteins

name	OTTMUSG00000001775 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100038600 MGI:3649352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Skap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78473 MGI:1925723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74479 MGI:1921729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12412 MGI:105369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629750 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 37 ESTs, 16 Proteins

name	Nfe2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18023 MGI:99421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Copz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56358 MGI:1929008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC665436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Cdk5rap3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80280 MGI:1933126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atad4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217138 MGI:2387599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103711 MGI:2144151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D030028A08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319371 MGI:2441931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78912 MGI:1926162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Sp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83395 MGI:1932575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scrn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217140 MGI:1343092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69297 MGI:1916547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107732 MGI:1333801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osbpl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71240 MGI:1918490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbx21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57765 MGI:1888984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73174 MGI:1920424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kpnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16211 MGI:107532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Npepps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19155 MGI:1101358
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665490 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665490 MGI:3644866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Mrpl45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67036 MGI:1914286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217143 MGI:2443409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Socs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192157 MGI:2651588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933428G20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58996 MGI:1918475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56013 MGI:1933179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410003L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69729 MGI:1916979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	E130012A19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103551 MGI:2143991
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246198 MGI:1935145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mel13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217149 MGI:101788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 1 Protein

name	Pcgf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22658 MGI:99161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26446 MGI:1347014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pip5k2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108083 MGI:1934234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810474C18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72785 MGI:1920035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67480 MGI:1914730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040708 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 334 ESTs, 5 Proteins

name	1700001P01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72215 MGI:1919465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp652 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378027 GeneID:268469 MGI:2442221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 652 transcript_id : NM_201609.2

name	EG665273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390767 GeneID:665273 MGI:3644307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG665273 transcript_id : XM_975768.1

name	Phospho1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665717 GeneID:237928 MGI:2447348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatase, orphan 1 transcript_id : NM_153104.2

name	Abi3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802686 GeneID:66610 MGI:1913860
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ABI gene family, member 3 transcript_id : NM_025659.2

name	Gngt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461991 GeneID:14710 MGI:893584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 transcript_id : NM_023121.2

name	Gngt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113461989 GeneID:14710 MGI:893584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 transcript_id : NM_001038664.2

name	LOC100040014 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262407 GeneID:100040014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040014 transcript_id : XM_001474923.1

name	B4galnt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517711 GeneID:14422 MGI:1342058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,4-N-acetyl-galactosaminyl transferase 2 transcript_id : NM_008081.3

name	Igf2bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129819 GeneID:140486 MGI:1890357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like growth factor 2 mRNA binding protein 1 transcript_id : NM_009951.3

name	LOC100040040 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262409 GeneID:100040040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040040 transcript_id : XM_001474953.1

name	Gip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982339 GeneID:14607 MGI:107504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastric inhibitory polypeptide transcript_id : NM_008119.2

name	Snf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802129 GeneID:27681 MGI:1343161
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) transcript_id : NM_033568.2

name	Ube2z (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681728 GeneID:268470 MGI:1343160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2Z (putative) transcript_id : NM_172300.3

name	Atp5g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385741 GeneID:11951 MGI:107653
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 transcript_id : NM_007506.4

name	Ndp52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802150 GeneID:76815 MGI:1343177
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear domain 10 protein 52 transcript_id : NM_029755.2

name	Ttll6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357013 GeneID:237930 MGI:2683461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin tyrosine ligase-like family, member 6 transcript_id : NM_172799.2

name	Hoxb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130864 GeneID:15408 MGI:107730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B13 transcript_id : NM_008267.3

name	LOC432593 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262392 GeneID:432593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical gene supported by AK078606 transcript_id : XM_976177.2

name	Gm53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390771 GeneID:193022 MGI:2684899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : gene model 53, (NCBI) transcript_id : XM_112540.4

name	Hoxb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680759 GeneID:15417 MGI:96190
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B9 transcript_id : NM_008270.2

name	Hoxb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709819 GeneID:15416 MGI:96189
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B8 transcript_id : NM_010461.2

name	Hoxb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014651 GeneID:15415 MGI:96188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B7 transcript_id : NM_010460.2

name	Hoxb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21886812 GeneID:15414 MGI:96187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B6 transcript_id : NM_008269.1

name	Hoxb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680250 GeneID:15413 MGI:96186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B5 transcript_id : NM_008268.1

name	Hoxb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802912 GeneID:15412 MGI:96185
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B4 transcript_id : NM_010459.5

name	Hoxb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300899 GeneID:15410 MGI:96184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B3 transcript_id : NM_001079869.1

name	Hoxb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300924 GeneID:15410 MGI:96184
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B3 transcript_id : NM_010458.2

name	Hoxb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158903 GeneID:103889 MGI:96183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B2 transcript_id : NM_134032.2

name	Hoxb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227197 GeneID:15407 MGI:96182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeo box B1 transcript_id : NM_008266.4

name	LOC100040242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262413 GeneID:100040242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs, 2 Proteins product : similar to Ribosomal protein L17, transcript variant 1 transcript_id : XM_001475389.1

name	LOC100040242 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262415 GeneID:100040242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 83 ESTs, 2 Proteins product : similar to Ribosomal protein L17, transcript variant 2 transcript_id : XM_001475401.1

name	OTTMUSG00000001775 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262419 GeneID:100038600 MGI:3649352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, OTTMUSG00000001775 transcript_id : XM_001475433.1

name	Skap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803165 GeneID:78473 MGI:1925723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : src family associated phosphoprotein 1 transcript_id : NM_001033186.2

name	Snx11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357419 GeneID:74479 MGI:1921729
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 11 transcript_id : NM_028965.3

name	Cbx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606333 GeneID:12412 MGI:105369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromobox homolog 1 (Drosophila HP1 beta) transcript_id : NM_007622.3

name	LOC629750 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262425 GeneID:629750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 33 ESTs, 16 Proteins product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1, transcript variant 1 transcript_id : XM_001475488.1

name	LOC629750 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390841 GeneID:629750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 ESTs, 16 Proteins product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1, transcript variant 2 transcript_id : XM_894675.2

name	Nfe2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982172 GeneID:18023 MGI:99421
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor, erythroid derived 2,-like 1 transcript_id : NM_008686.2

name	Copz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388340 GeneID:56358 MGI:1929008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit zeta 2 transcript_id : NM_019877.2

name	LOC100040373 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262432 GeneID:100040373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040373 transcript_id : XM_001475583.1

name	Cdk5rap3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384787 GeneID:80280 MGI:1933126
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDK5 regulatory subunit associated protein 3 transcript_id : NM_030248.1

name	Atad4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122504 GeneID:217138 MGI:2387599
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase family, AAA domain containing 4 transcript_id : NM_146026.1

name	Pnpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625355 GeneID:103711 MGI:2144151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyridoxine 5'-phosphate oxidase transcript_id : NM_134021.2

name	Sp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625319 GeneID:78912 MGI:1926162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sp2 transcription factor transcript_id : NM_001080964.1

name	Sp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125625317 GeneID:78912 MGI:1926162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sp2 transcription factor transcript_id : NM_030220.3

name	Sp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538743 GeneID:83395 MGI:1932575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trans-acting transcription factor 6 transcript_id : NM_031183.1

name	Scrn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122498 GeneID:217140 MGI:1343092
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secernin 2 transcript_id : NM_146027.1

name	Lrrc46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982633 GeneID:69297 MGI:1916547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 46 transcript_id : NM_027026.2

name	Mrpl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385657 GeneID:107732 MGI:1333801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L10 transcript_id : NM_026154.1

name	Osbpl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487450 GeneID:71240 MGI:1918490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 7 transcript_id : NM_001081434.1

name	Tbx21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9507178 GeneID:57765 MGI:1888984
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 21 transcript_id : NM_019507.1

name	Tbkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674211 GeneID:73174 MGI:1920424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBK1 binding protein 1 transcript_id : NM_198100.1

name	Kpnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014719 GeneID:16211 MGI:107532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : karyopherin (importin) beta 1 transcript_id : NM_008379.3

name	Npepps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68226730 GeneID:19155 MGI:1101358
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminopeptidase puromycin sensitive transcript_id : NM_008942.2

name	EG665490 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262404 GeneID:665490 MGI:3644866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665490 transcript_id : XM_977275.2

name	Mrpl45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368142 GeneID:67036 MGI:1914286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L45 transcript_id : NM_025927.3

name	Gpr179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487044 GeneID:217143 MGI:2443409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 179 transcript_id : NM_001081220.1

name	Socs7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76253931 GeneID:192157 MGI:2651588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of cytokine signaling 7 transcript_id : NM_138657.3

name	4933428G20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796636 GeneID:58996 MGI:1918475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933428G20 gene transcript_id : NM_021493.2

name	P140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089328 GeneID:56013 MGI:1933179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : P140 gene transcript_id : NM_018873.2

name	2410003L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262438 GeneID:69729 MGI:1916979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 2410003L11 gene, transcript variant 2 transcript_id : XM_903024.3

name	E130012A19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185891 GeneID:103551 MGI:2143991
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130012A19 gene transcript_id : NM_175332.3

name	Mllt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130867 GeneID:246198 MGI:1935145
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed lineage-leukemia translocation to 6 homolog (Drosophila) transcript_id : NM_139311.2

name	Mel13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390859 GeneID:217149 MGI:101788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 ESTs, 1 Protein product : melanoma nuclear protein 13, transcript variant 1 transcript_id : XM_126589.6

name	Mel13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262440 GeneID:217149 MGI:101788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 1 Protein product : melanoma nuclear protein 13, transcript variant 2 transcript_id : XM_895143.3

name	Pcgf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678634 GeneID:22658 MGI:99161
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycomb group ring finger 2 transcript_id : NM_009545.1

name	Psmb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801586 GeneID:26446 MGI:1347014
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 3 transcript_id : NM_011971.3

name	Pip5k2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563293 GeneID:108083 MGI:1934234
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol-4-phosphate 5-kinase, type II, beta transcript_id : NM_054051.1

name	2810474C18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262441 GeneID:72785 MGI:1920035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810474C18 gene transcript_id : XM_001476201.1

name	Ccdc49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379058 GeneID:67480 MGI:1914730
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 49 transcript_id : NM_026186.3

name	LOC100040708 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262445 GeneID:100040708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 232 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G, transcript variant 2 transcript_id : XM_001476326.1

name	LOC100040708 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262443 GeneID:100040708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 mRNAs, 333 ESTs, 5 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G, transcript variant 1 transcript_id : XM_001476305.1

name	1700001P01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130873 GeneID:72215 MGI:1919465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001P01 gene transcript_id : NM_028156.2

name	Zfp652 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124378028 GeneID:268469 MGI:2442221
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 652 protein_id : NP_963903.2

name	EG665273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390768 GeneID:665273 MGI:3644307
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980862.1

name	Phospho1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346533 GeneID:237928 MGI:2447348
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016791 - phosphoric monoester hydrolase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : phosphatase, orphan 1 protein_id : NP_694744.1

name	Abi3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313408 CCDS:CCDS25283.1 GeneID:66610 MGI:1913860
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030334 - regulation of cell migration [Evidence ISS] codon_start : 1 product : ABI gene family, member 3 protein_id : NP_079935.1

name	Gngt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113461990 CCDS:CCDS25284.1 GeneID:14710 MGI:893584
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : guanine nucleotide binding protein (G protein), gamma transducing polypeptide 2 product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 protein_id : NP_001033753.2

name	Gngt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21327663 GeneID:14710 MGI:893584
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : guanine nucleotide binding protein (G protein), gamma transducing polypeptide 2 product : guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 protein_id : NP_075610.1

name	LOC100040014 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262408 GeneID:100040014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474973.1

name	B4galnt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679931 CCDS:CCDS25285.1 GeneID:14422 MGI:1342058
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0030259 - lipid glycosylation [Evidence IEA] codon_start : 1 note : dolichos lectin binding 1; CT-Gal NAc transferase; N-acetylgalactosaminyltransferase; UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)- galactosyl-N-acetylglucosaminylpolypeptide-beta-1, 4-N-acetylgalactosaminyltransferase; UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneura minyl)-galactosyl-N-acetylglucosaminylpolypeptide-beta-1, 4-N-acetylgalactosaminyltransferase product : beta-1,4-N-acetyl-galactosaminyl transferase 2 protein_id : NP_032107.1

name	Igf2bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753518 CCDS:CCDS25286.1 GeneID:140486 MGI:1890357
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zipcode-binding protein 1; coding region determinant binding protein; zipcode binding protein 1 product : insulin-like growth factor 2, binding protein 1 protein_id : NP_034081.1

name	LOC100040040 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262410 GeneID:100040040
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475003.1

name	Gip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982340 CCDS:CCDS25287.1 GeneID:14607 MGI:107504
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : glucose-dependent insulinotropic polypeptide product : gastric inhibitory polypeptide protein_id : NP_032145.2

name	Snf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809002 CCDS:CCDS25288.1 GeneID:27681 MGI:1343161
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence ISS] GO_function : GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : EAP30 subunit of ELL complex protein_id : NP_291046.1

name	Ube2z (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681729 GeneID:268470 MGI:1343160
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2Z protein_id : NP_758504.3

name	Atp5g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982497 CCDS:CCDS25289.1 GeneID:11951 MGI:107653
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c, isoform 1 protein_id : NP_031532.2

name	Ndp52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626078 GeneID:76815 MGI:1343177
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016605 - PML body [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : nuclear domain 10 protein 52 like 1 protein_id : NP_084031.1

name	Ttll6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370188 CCDS:CCDS25290.1 GeneID:237930 MGI:2683461
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004835 - tubulin-tyrosine ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 product : tubulin tyrosine ligase-like family, member 6 protein_id : NP_766387.1

name	Hoxb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680247 CCDS:CCDS25291.1 GeneID:15408 MGI:107730
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0040008 - regulation of growth [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeobox B13 protein_id : NP_032293.1

name	LOC432593 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262393 GeneID:432593
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981271.2

name	Gm53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38091774 GeneID:193022 MGI:2684899
definition	codon_start : 1 product : hypothetical protein protein_id : XP_112540.2

name	Hoxb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680760 CCDS:CCDS25292.1 GeneID:15417 MGI:96190
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B9 protein_id : NP_032296.2

name	Hoxb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362265 CCDS:CCDS25293.1 GeneID:15416 MGI:96189
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B8 protein_id : NP_034591.1

name	Hoxb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014652 CCDS:CCDS25294.1 GeneID:15415 MGI:96188
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B7 protein_id : NP_034590.2

name	Hoxb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21886813 CCDS:CCDS25295.1 GeneID:15414 MGI:96187
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B6 protein_id : NP_032295.1

name	Hoxb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680251 CCDS:CCDS25296.1 GeneID:15413 MGI:96186
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045446 - endothelial cell differentiation [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeo box B5 protein_id : NP_032294.1

name	Hoxb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625619 CCDS:CCDS25297.1 GeneID:15412 MGI:96185
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0048103 - somatic stem cell division [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B4 protein_id : NP_034589.3

name	Hoxb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300900 GeneID:15410 MGI:96184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B3 protein_id : NP_001073338.1

name	Hoxb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300925 CCDS:CCDS25299.1 GeneID:15410 MGI:96184
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : homeo box B3 protein_id : NP_034588.2

name	Hoxb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94158904 GeneID:103889 MGI:96183
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : homeo box B2 protein_id : NP_598793.2

name	Hoxb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45598392 CCDS:CCDS25300.1 GeneID:15407 MGI:96182
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IEA]; GO:0007389 - pattern specification [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeobox B1 protein_id : NP_032292.2

name	LOC100040242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262414 GeneID:100040242
definition	codon_start : 1 product : similar to Ribosomal protein L17 isoform 1 protein_id : XP_001475439.1

name	LOC100040242 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262416 GeneID:100040242
definition	codon_start : 1 product : similar to Ribosomal protein L17 isoform 2 protein_id : XP_001475451.1

name	OTTMUSG00000001775 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262420 GeneID:100038600 MGI:3649352
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475483.1

name	Skap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794544 CCDS:CCDS25301.1 GeneID:78473 MGI:1925723
definition	GO_function : GO:0019904 - protein domain specific binding [Evidence ISS] codon_start : 1 note : ortholog of human src family associated phosphoprotein 1 SCAP1 product : src family associated phosphoprotein 1 protein_id : NP_001028358.1

name	Snx11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094999 CCDS:CCDS25302.1 GeneID:74479 MGI:1921729
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 11 protein_id : NP_083241.1

name	LOC629750 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262426 GeneID:629750
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 isoform 1 protein_id : XP_001475538.1

name	LOC629750 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262427 GeneID:629750
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 isoform 2 protein_id : XP_899768.2

name	Cbx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671696 CCDS:CCDS25303.1 GeneID:12412 MGI:105369
definition	GO_component : GO:0005721 - centric heterochromatin [Evidence IDA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0001939 - female pronucleus [Evidence IDA]; GO:0001940 - male pronucleus [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence ISS]; GO:0005654 - nucleoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0005701 - polytene chromosome chromocenter [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : chromobox homolog 1 protein_id : NP_031648.1

name	Nfe2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982173 CCDS:CCDS25304.1 GeneID:18023 MGI:99421
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : nuclear factor, erythroid derived 2,-like 1 protein_id : NP_032712.2

name	Copz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845242 CCDS:CCDS25305.1 GeneID:56358 MGI:1929008
definition	GO_component : GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0030126 - COPI vesicle coat [Evidence ISS]; GO:0030137 - COPI-coated vesicle [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nonclathrin coat protein zeta2-COP product : coatomer protein complex, subunit zeta 2 protein_id : NP_063930.1

name	LOC100040373 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262433 GeneID:100040373
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475633.1

name	Cdk5rap3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384788 CCDS:CCDS25306.1 GeneID:80280 MGI:1933126
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0042808 - neuronal Cdc2-like kinase binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007420 - brain development [Evidence ISS]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0000079 - regulation of cyclin-dependent protein kinase activity [Evidence ISS]; GO:0045664 - regulation of neuron differentiation [Evidence ISS] codon_start : 1 note : OK/SW-cl.114 product : CDK5 regulatory subunit associated protein 3 protein_id : NP_084524.1

name	Atad4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122505 CCDS:CCDS25307.1 GeneID:217138 MGI:2387599
definition	codon_start : 1 product : ATPase family, AAA domain containing 4 protein_id : NP_666138.1

name	Pnpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527238 CCDS:CCDS25308.1 GeneID:103711 MGI:2144151
definition	EC_number : 1.4.3.5 GO_function : GO:0010181 - FMN binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004733 - pyridoxamine-phosphate oxidase activity [Evidence IEA] GO_process : GO:0008615 - pyridoxine biosynthesis [Evidence IEA] codon_start : 1 note : pyridoxamine-phosphate oxidase product : pyridoxine 5'-phosphate oxidase protein_id : NP_598782.1

name	Sp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625320 GeneID:78912 MGI:1926162
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : Sp2 transcription factor isoform 2 protein_id : NP_001074433.1

name	Sp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125625318 GeneID:78912 MGI:1926162
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : Sp2 transcription factor isoform 1 protein_id : NP_084496.2

name	Sp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40538744 CCDS:CCDS25309.1 GeneID:83395 MGI:1932575
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : Kruppel-like factor 14; specificity protein 6; epiprofin product : trans-acting transcription factor 6 protein_id : NP_112460.1

name	Scrn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122499 CCDS:CCDS25310.1 GeneID:217140 MGI:1343092
definition	GO_function : GO:0016805 - dipeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : secernin 2 protein_id : NP_666139.1

name	Lrrc46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982634 CCDS:CCDS25311.1 GeneID:69297 MGI:1916547
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 46 protein_id : NP_081302.2

name	Mrpl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385658 CCDS:CCDS25312.1 GeneID:107732 MGI:1333801
definition	GO_component : GO:0005762 - mitochondrial large ribosomal subunit [Evidence ISS] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0007046 - ribosome biogenesis [Evidence ISS] codon_start : 1 product : mitochondrial ribosomal protein L10 protein_id : NP_080430.1

name	Osbpl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487451 GeneID:71240 MGI:1918490
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol-binding protein-like protein 7 protein_id : NP_001074903.1

name	Tbx21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9507179 CCDS:CCDS25315.1 GeneID:57765 MGI:1888984
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0048304 - positive regulation of isotype switching to IgG isotypes [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : T-box transcription factor product : T-box 21 protein_id : NP_062380.1

name	Tbkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674212 GeneID:73174 MGI:1920424
definition	codon_start : 1 product : ProSAPiP2 protein protein_id : NP_932768.1

name	Kpnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014720 CCDS:CCDS25316.1 GeneID:16211 MGI:107532
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0006606 - protein import into nucleus [Evidence ISS] [Evidence IDA]; GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006610 - ribosomal protein import into nucleus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : importin beta product : karyopherin (importin) beta 1 protein_id : NP_032405.3

name	Npepps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68226731 CCDS:CCDS25317.1 GeneID:19155 MGI:1101358
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004179 - membrane alanyl aminopeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : puromycin-sensitive aminopeptidase product : aminopeptidase puromycin sensitive protein_id : NP_032968.2

name	EG665490 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390773 GeneID:665490 MGI:3644866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_982369.1

name	Mrpl45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385418 CCDS:CCDS25318.1 GeneID:67036 MGI:1914286
definition	GO_component : GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence ISS] codon_start : 1 product : mitochondrial ribosomal protein L45 protein_id : NP_080203.1

name	Gpr179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487045 GeneID:217143 MGI:2443409
definition	codon_start : 1 product : GPR158-like 1 receptor protein_id : NP_001074689.1

name	Socs7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149738 CCDS:CCDS25319.1 GeneID:192157 MGI:2651588
definition	GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0045444 - fat cell differentiation [Evidence IMP]; GO:0008286 - insulin receptor signaling pathway [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0016567 - protein ubiquitination [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : SH2 domain containing SOCS box protein SOCS7; Nck, Ash and phospholipase C binding protein product : suppressor of cytokine signaling 7 protein_id : NP_619598.1

name	4933428G20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114796637 GeneID:58996 MGI:1918475
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Rho GTPase activating protein 23 protein_id : NP_067468.2

name	P140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089329 GeneID:56013 MGI:1933179
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0007162 - negative regulation of cell adhesion [Evidence IDA] codon_start : 1 product : Snap-25-interacting protein protein_id : NP_061361.2

name	2410003L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82934981 GeneID:69729 MGI:1916979
definition	codon_start : 1 product : hypothetical protein LOC69729 isoform 2 protein_id : XP_908117.1

name	E130012A19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185892 CCDS:CCDS25322.1 GeneID:103551 MGI:2143991
definition	codon_start : 1 product : hypothetical protein LOC103551 protein_id : NP_780541.2

name	Mllt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130868 CCDS:CCDS25323.1 GeneID:246198 MGI:1935145
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : myeloid/lymphoid or mixed lineage-leukemia translocation to 6 homolog protein_id : NP_647472.2

name	Mel13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262439 GeneID:217149 MGI:101788
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_126589.5

name	Mel13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82934983 GeneID:217149 MGI:101788
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_900236.1

name	Pcgf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678635 CCDS:CCDS25327.1 GeneID:22658 MGI:99161
definition	GO_component : GO:0016604 - nuclear body [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0001739 - sex chromatin [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI]; GO:0016573 - histone acetylation [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 144; ring finger protein 110 product : polycomb group ring finger 2 protein_id : NP_033571.1

name	Psmb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755202 CCDS:CCDS25328.1 GeneID:26446 MGI:1347014
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence TAS]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 product : proteasome beta 3 subunit protein_id : NP_036101.1

name	Pip5k2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563294 CCDS:CCDS25329.1 GeneID:108083 MGI:1934234
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016308 - 1-phosphatidylinositol-4-phosphate 5-kinase activity [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046488 - phosphatidylinositol metabolism [Evidence IDA] codon_start : 1 product : phosphatidylinositol-4-phosphate 5-kinase, type II, beta protein_id : NP_473392.1

name	2810474C18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262442 GeneID:72785 MGI:1920035
definition	codon_start : 1 product : hypothetical protein LOC72785 protein_id : XP_001476251.1

name	Ccdc49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312952 CCDS:CCDS25330.1 GeneID:67480 MGI:1914730
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 49 protein_id : NP_080462.1

name	LOC100040708 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262444 GeneID:100040708
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476355.1

name	LOC100040708 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262446 GeneID:100040708
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476376.1

name	1700001P01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130874 GeneID:72215 MGI:1919465
definition	codon_start : 1 product : hypothetical protein LOC72215 protein_id : NP_082432.2

name	LOC665436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665436
definition	number : 1 pseudo : _no_value

name	LOC665436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665436
definition	number : 2 pseudo : _no_value

name	LOC665436 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665436
definition	number : 3 pseudo : _no_value

name	LOC100039639 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262394 GeneID:100039639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 889 ESTs, 1 Protein product : similar to ribosomal protein L18 pseudo : _no_value transcript_id : XR_031108.1

name	D030028A08Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141801253 GeneID:319371 MGI:2441931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030028A08 gene transcript_id : NR_003293.2

clone name	MSMg01-466E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-102H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-107K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389B06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-291F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-346B01.b	B6Ng01-346B01.g
ACC	GA128073	GA128074
length	1,066	361
definition	B6Ng01-346B01.b	B6Ng01-346B01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(96,633,431 - 96,634,483)	(96,617,303 - 96,617,663)
sequence	gaattcttacgtggactataagatattcctccatgtgagtcaagctttag tgatggtgtcagctgcagggctgtgggctgtgctgaggtcaaaaatggtt tgtgggtgttcccgacagaagatttacaagaaagagtggggagaggacta gcttgaggggacacagaatggcttccaggtgcctggtggcatcttggtct gggacccagtagcctgataatccgtccccttagggtggcggtggtgaact catgagggactaaggcttttccggatttctcccctagacgaacagcaagg cttttaccgccaagacgtcctgtgtgcggcggcgctaccgtgagtttgtg tggctgaggaagcagctgcagaggaacgccggcttggtgtgagtttgctc tcgggccttctcaggtctgaatggatctgggggatcacaggggagctagg gttacgagggagaagaacttagagcgtggcaggctgaggagcttgagaaa tgctcgcactcaggtggttatgtcagtgaaaggaaaccagcaagtctccc tccgttcatgccacgtgacctagcaaaactgtataaacggggggaaaagt gaatacatacatactcccctcctcccacaaagcaattaaagtgaaaaaaa aaacagttctgtgtgctttataacagaagttgagaatgtttaacagtatc ctgccacagctcatctcagttttagaaaactctggggctggagtactctt ttggtttagtttagtttagctttgttttctgagatagagctggtggtatt tagctccagcctggccctcaaatgccccagaattctcgcccgaagccaac agagtagctgagatggatagcaccgtgggcagttgtgtcctgacttggag tagttctaatccttaggaacggaccagcattctgcagcttactttggtgg agctgatgctggggacgtggatgtccgtcaaagggttgctgtcaagcact agctgagatcagatcctttagcacccacgtagaagcccgggaatcccagt gcttggagagagagac	aaggcaccctgggctgcagatcaagacccacaatatatagagacgtaact tttaagtaataaagcatatgcattaagctgctgggcagtggtggcacacg cctttgatcccagcacttggaaggcagaggcagacggatttctgagttcg aggccagcctggtctacagagtgagttctaggacagccagggctacacag agaaaccctgtctcgggaaaaaaaaaaaaaaaaagttttatgagcaagaa caccatgctttggtaggttgttttggtttggtttttgctttgtttttttt ttgttttttttgtttgtttttgtttgttttttgattgtgtgtgtgtgtgt gtgtgtgtgtg
quality values	Open. Hide. 58 39 27 30 58 54 58 62 62 47 47 47 62 46 31 39 56 56 62 62 62 62 41 39 54 47 62 62 56 56 56 44 32 56 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 59 59 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 54 54 62 54 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 58 58 58 58 58 47 58 58 48 58 54 49 58 58 54 54 58 58 58 58 54 58 58 54 54 41 58 58 58 54 36 30 58 58 35 58 58 58 58 58 52 58 58 46 39 58 54 58 58 52 58 52 54 54 58 42 41 58 39 45 45 39 54 52 42 58 54 54 47 50 58 58 58 58 54 25 41 43 58 49 40 48 42 50 58 50 51 52 54 54 58 51 58 58 50 51 58 48 45 45 52 32 54 58 50 47 46 50 54 47 51 37 33 50 53 50 28 49 50 58 58 50 50 52 58 53 53 54 46 58 51 49 49 49 38 58 58 54 32 44 41 43 31 50 51 36 36 38 50 53 42 53 53 53 39 53 40 51 52 58 36 49 58 41 47 58 39 42 58 37 31 53 31 38 28 29 37 31 28 28 53 30 51 50 40 50 52 53 54 44 34 42 50 54 54 54 52 37 38 37 49 54 45 39 35 39 37 41 39 34 49 54 33 32 39 32 25 34 28 32 39 33 31 41 35 41 53 35 51 35 25 32 8 51 37 31 31 37 37 35 40 29 29 33 34 34 52 35 30 18 37 29 33 42 37 42 34 39 45 40 40 34 16 42 54 54 28 28 19 35 49 49 12 16 31 31 29 32 52 51 28 30 32 31 32 31 24 33 28 32 26 53 40 52 47 33 31 31 31 47 29 32 18 32 52 28 31 26 26 53 52 31 26 36 32 45 31 33 26 46 51 30 31 30 26 42 19 31 31 33 23 31 20 19 30 33 15 9 10 32 9 28 34 51 32 21 32 36 43 36 38 22 26 27 30 14 25 21 9 46 9 22 31 31 46 18 31 33 26 31 37 27 9 12 25 18 6 37 16 16 14 12 32 48 25 15 17 31 23 26 21 6 11 28 9 6 25 21 27 14 5 20 38 24 30 8 9 10 19 14 31 16 25 17 11 11 6 14 13 14 16 30 21 16 6 6 6 6 9 16 31 21 18 16 24 22 36 18 25 25 28 21 14 8 14 14 9 10 16 11 6 13 6 23 11 13 17 11 14 14 10 18 21 9 9 19 26 11 8 6 20 11 18 21 13 8 21 27 11 17 7 7 8 8 5 11 10 7 5 6 6 8 9 6 11 13 16 22 18 25 10 9 21 6 17 33 39 18 11 17 5 4 8 9 14 15 16 9 18 14 5 6 7 8 17 19 21 31 19 13 28 16 7 14 21 5 5 5 5 4 11 5 5 5 13 5 15 26 24 28 7 21 5 9 6 6 6 11 11 15 8 27 6 4 6 6 7 20 34 10 5 13 6 5 14 10 24 23 11 12 29 28 7 19 8 12 7 11 24 27 12 5 3 7 15 24 18 8 6 9 11 5 10 6 7 5 6 4 4 5	Open. Hide. 39 59 62 62 59 41 49 50 32 34 33 35 54 54 62 62 62 62 62 59 59 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 46 46 56 56 41 62 56 56 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 58 48 46 46 58 52 46 58 58 58 58 58 46 46 58 47 46 46 52 54 52 43 58 54 54 58 52 58 47 47 58 58 54 58 58 58 47 58 58 58 47 49 47 58 58 47 47 58 15 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_96633431_96634483
seq2: B6Ng01-346B01.b_48_1113 (reverse)

seq1  GTCTCTCTCTC--AGCACTGGGA-TCACGGGCTTTCTACGTGGGTGCT-A  46
      |||||||||||  |||||||||| || ||||| ||||||||||||||| |
seq2  GTCTCTCTCTCCAAGCACTGGGATTCCCGGGC-TTCTACGTGGGTGCTAA  49

seq1  AGGATCTGATCTCAGCTCGTGCTTTACAGCAACCCTTTGACGGACATCCA  96
      ||||||||||||||||| |||||| |||||||||||||||||||||||||
seq2  AGGATCTGATCTCAGCTAGTGCTTGACAGCAACCCTTTGACGGACATCCA  99

seq1  CGTCCCCAGCATCAGCTCCA-CACAGTGAGCTGCAG-ATGCTGGGTCCGT  144
      |||||||||||||||||||| || ||| |||||||| ||||| |||||||
seq2  CGTCCCCAGCATCAGCTCCACCAAAGTAAGCTGCAGAATGCT-GGTCCGT  148

seq1  TCCTATGAATTAGAACTACTCCAAGTCA-GACAC-ACTG-CCAC-GTGCT  190
      ||||| | |||||||||||||||||||| ||||| |||| |||| |||||
seq2  TCCTAAGGATTAGAACTACTCCAAGTCAGGACACAACTGCCCACGGTGCT  198

seq1  AT-CATCTCAGCTACTCTGTGGGC-TCGGGCGAGAA-TCTGGGGCATTTG  237
      || ||||||||||||||||| ||| ||||||||||| |||||||||||||
seq2  ATCCATCTCAGCTACTCTGTTGGCTTCGGGCGAGAATTCTGGGGCATTTG  248

seq1  A-GGCCAGGCTGGAGCTAAATA-CACCAGCTCTATCTCAGAAAACAAAGC  285
      | |||||||||||||||||||| |||||||||||||||||||||||||||
seq2  AGGGCCAGGCTGGAGCTAAATACCACCAGCTCTATCTCAGAAAACAAAGC  298

seq1  TAAACTAAACTAAACCAAAAGAGTACTCCAGCCCCAGAGTTTTCTAAAAC  335
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACTAAACTAAACCAAAAGAGTACTCCAGCCCCAGAGTTTTCTAAAAC  348

seq1  TGAGATGAGCTGTGGCAGGATACTGTTAAACATTCTCAACTTCTGTTATA  385
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGATGAGCTGTGGCAGGATACTGTTAAACATTCTCAACTTCTGTTATA  398

seq1  AAGCACACAGAACTGTTTTTTTTTTCACTTTAATTGCTTTGTGGGAGGAG  435
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCACACAGAACTGTTTTTTTTTTCACTTTAATTGCTTTGTGGGAGGAG  448

seq1  GGGAGTATGTATGTATTCACTTTTCCCCCCGTTTATACAGTTTTGCTAGG  485
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGTATGTATGTATTCACTTTTCCCCCCGTTTATACAGTTTTGCTAGG  498

seq1  TCACGTGGCATGAACGGAGGGAGACTTGCTGGTTTCCTTTCACTGACATA  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGTGGCATGAACGGAGGGAGACTTGCTGGTTTCCTTTCACTGACATA  548

seq1  ACCACCTGAGTGCGAGCATTTCTCAAGCTCCTCAGCCTGCCACGCTCTAA  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACCTGAGTGCGAGCATTTCTCAAGCTCCTCAGCCTGCCACGCTCTAA  598

seq1  GTTCTTCTCCCTCGTAACCCTAGCTCCCCTGTGATCCCCCAGATCCATTC  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTTCTCCCTCGTAACCCTAGCTCCCCTGTGATCCCCCAGATCCATTC  648

seq1  AGACCTGAGAAGGCCCGAGAGCAAACTCACACCAAGCCGGCGTTCCTCTG  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCTGAGAAGGCCCGAGAGCAAACTCACACCAAGCCGGCGTTCCTCTG  698

seq1  CAGCTGCTTCCTCAGCCACACAAACTCACGGTAGCGCCGCCGCACACAGG  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTGCTTCCTCAGCCACACAAACTCACGGTAGCGCCGCCGCACACAGG  748

seq1  ACGTCTTGGCGGTAAAAGCCTTGCTGTTCGTCTAGGGGAGAAATCCGGAA  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTCTTGGCGGTAAAAGCCTTGCTGTTCGTCTAGGGGAGAAATCCGGAA  798

seq1  AAGCCTTAGTCCCTCATGAGTTCACCACCGCCACCCTAAGGGGACGGATT  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCTTAGTCCCTCATGAGTTCACCACCGCCACCCTAAGGGGACGGATT  848

seq1  ATCAGGCTACTGGGTCCCAGACCAAGATGCCACCAGGCACCTGGAAGCCA  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGGCTACTGGGTCCCAGACCAAGATGCCACCAGGCACCTGGAAGCCA  898

seq1  TTCTGTGTCCCCTCAAGCTAGTCCTCTCCCCACTCTTTCTTGTAAATCTT  935
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGTGTCCCCTCAAGCTAGTCCTCTCCCCACTCTTTCTTGTAAATCTT  948

seq1  CTGTCGGGAACACCCACAAACCATTTTTGACCTCAGCACAGCCCACAGCC  985
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCGGGAACACCCACAAACCATTTTTGACCTCAGCACAGCCCACAGCC  998

seq1  CTGCAGCTGACACCATCACTAAAGCTTGACTCACATGGAGGAATATCTTA  1035
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCAGCTGACACCATCACTAAAGCTTGACTCACATGGAGGAATATCTTA  1048

seq1  TAGTCCACGTAAGAATTC  1053
      ||||||||||||||||||
seq2  TAGTCCACGTAAGAATTC  1066

seq1: chr11_96617303_96617663
seq2: B6Ng01-346B01.g_70_430

seq1  AAGGCACCCTGGGCTGCAGATCAAGACCCACAATATATAGAGACGTAACT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCACCCTGGGCTGCAGATCAAGACCCACAATATATAGAGACGTAACT  50

seq1  TTTAAGTAATAAAGCATATGCATTAAGCTGCTGGGCAGTGGTGGCACACG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAGTAATAAAGCATATGCATTAAGCTGCTGGGCAGTGGTGGCACACG  100

seq1  CCTTTGATCCCAGCACTTGGAAGGCAGAGGCAGACGGATTTCTGAGTTCG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTGATCCCAGCACTTGGAAGGCAGAGGCAGACGGATTTCTGAGTTCG  150

seq1  AGGCCAGCCTGGTCTACAGAGTGAGTTCTAGGACAGCCAGGGCTACACAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCAGCCTGGTCTACAGAGTGAGTTCTAGGACAGCCAGGGCTACACAG  200

seq1  AGAAACCCTGTCTCGGGAAAAAAAAAAAAAAAAAGTTTTATGAGCAAGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACCCTGTCTCGGGAAAAAAAAAAAAAAAAAGTTTTATGAGCAAGAA  250

seq1  CACCATGCTTTGGTAGGTTGTTTTGGTTTGGTTTTTGCTTTGTTTTTTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCATGCTTTGGTAGGTTGTTTTGGTTTGGTTTTTGCTTTGTTTTTTTT  300

seq1  TTGTTTTTTTTGTTTGTTTTTGTTTGTTTTTTGATTGTGTGTGTGTGTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTTTTTTGTTTGTTTTTGTTTGTTTTTTGATTGTGTGTGTGTGTGT  350

seq1  GTGTGTGTGTG  361
      |||||||||||
seq2  GTGTGTGTGTG  361

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information