MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-350P07
Chromosome	11 (Build37)
Map Location	50,435,941 - 50,569,910
singlet/doublet	doublet
Overlap gene	Adamts2
Upstream gene	Flt4, LOC100040032, Scgb3a1, Cnot6, LOC666899, LOC100040073, Gfpt2, Mapk9, Rasgef1c, Rnf130, LOC380696, Tbc1d9b, 3010026O09Rik, Sqstm1, Mgat4b, Ltc4s, Maml1, Canx, 1700121K02Rik, Hnrph1, Rufy1
Downstream gene	Zfp354c, 9630041N07Rik, Grm6, Zfp454, Zfp2, Zfp354b, Prop1, Olfr1379-ps1, Olfr1378, Olfr1377, Olfr226-ps1, Olfr51, Olfr54, Olfr1375-ps1, Zfp354a, LOC100040275, LOC382518, Olfr1374-ps1, 5133400J02Rik, LOC622699, BC049762, Clk4, Col23a1, Agxt2l2, Hnrpab, Nola2, Rmnd5b, C330016O10Rik, D930048N14Rik, 0610009B22Rik, Sec24a, LOC100040402
Link	Open Mouse BAC browser

Click to get alignment info.

name	Flt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14257 MGI:95561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Scgb3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68662 MGI:1915912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cnot6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104625 MGI:2144529
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 649 ESTs, 6 Proteins

name	LOC100040073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gfpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14584 MGI:1338883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26420 MGI:1346862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rasgef1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74563 MGI:1921813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59044 MGI:1891717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC380696 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380696
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	Tbc1d9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76795 MGI:1924045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3010026O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68067 MGI:1915317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sqstm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18412 MGI:107931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mgat4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103534 MGI:2143974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltc4s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17001 MGI:107498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103806 MGI:1890504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Canx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12330 MGI:88261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700121K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76653 MGI:1923903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	Hnrph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59013 MGI:1891925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rufy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216724 MGI:2429762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adamts2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216725 MGI:1347356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp354c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30944 MGI:1353621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9630041N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214779 MGI:3053099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108072 MGI:1351343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237758 MGI:2679253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22678 MGI:99167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Zfp354b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27274 MGI:1351476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prop1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19127 MGI:109330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1379-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404506 MGI:3031213
definition	gene_synonym : MOR129-5_p note : olfactory receptor 1379, pseudogene 1 pseudo : _no_value

name	Olfr1378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258912 MGI:3031212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1377 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258913 MGI:3031211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr226-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258202 MGI:3030060
definition	gene_synonym : MOR129-4P note : olfactory receptor 226, pseudogene 1 pseudo : _no_value

name	Olfr51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18351 MGI:1333747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18354 MGI:1333750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1375-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258509 MGI:3031209
definition	gene_synonym : MOR126-2; RP23-217L7.2 note : olfactory receptor 1375, pseudogene 1 pseudo : _no_value

name	Zfp354a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21408 MGI:103172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC382518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382518
definition	note : tubulin alpha-4 pseudogene pseudo : _no_value

name	Olfr1374-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257969 MGI:3031208
definition	gene_synonym : MOR256-44P note : olfactory receptor 1374, pseudogene 1 pseudo : _no_value

name	5133400J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71297 MGI:1918547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC622699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	BC049762 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193286 MGI:3039622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12750 MGI:1098551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col23a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237759 MGI:2653243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agxt2l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72947 MGI:1920197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpab (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15384 MGI:1330294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nola2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52530 MGI:1098547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rmnd5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66089 MGI:1913339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330016O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212706 MGI:2442218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D930048N14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97775 MGI:2144709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs

name	0610009B22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66050 MGI:1913300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec24a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77371 MGI:1924621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040402 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Flt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801963 GeneID:14257 MGI:95561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 4 transcript_id : NM_008029.2

name	Scgb3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25014111 GeneID:68662 MGI:1915912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 3A, member 1 transcript_id : NM_170727.1

name	Scgb3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905068 GeneID:68662 MGI:1915912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretoglobin, family 3A, member 1 transcript_id : NM_054037.1

name	Cnot6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059014 GeneID:104625 MGI:2144529
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 6 transcript_id : NM_212484.1

name	LOC666899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390048 GeneID:666899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 649 ESTs, 6 Proteins product : similar to ribosomal protein L30 transcript_id : XM_001000091.1

name	Gfpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386698 GeneID:14584 MGI:1338883
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamine fructose-6-phosphate transaminase 2 transcript_id : NM_013529.2

name	Mapk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592768 GeneID:26420 MGI:1346862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 9 transcript_id : NM_016961.2

name	Mapk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46592832 GeneID:26420 MGI:1346862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 9 transcript_id : NM_207692.1

name	Rasgef1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73088861 GeneID:74563 MGI:1921813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RasGEF domain family, member 1C transcript_id : NM_029004.1

name	Rnf130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892292 GeneID:59044 MGI:1891717
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 130 transcript_id : NM_021540.3

name	Tbc1d9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358939 GeneID:76795 MGI:1924045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 9B transcript_id : NM_029745.2

name	3010026O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350731 GeneID:68067 MGI:1915317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3010026O09 gene transcript_id : NM_026543.2

name	Sqstm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130186 GeneID:18412 MGI:107931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sequestosome 1 transcript_id : NM_011018.2

name	Mgat4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239191 GeneID:103534 MGI:2143974
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannoside acetylglucosaminyltransferase 4, isoenzyme B transcript_id : NM_145926.2

name	Ltc4s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678733 GeneID:17001 MGI:107498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukotriene C4 synthase transcript_id : NM_008521.1

name	Maml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341628 GeneID:103806 MGI:1890504
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mastermind like 1 (Drosophila) transcript_id : NM_175334.2

name	Canx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542338 GeneID:12330 MGI:88261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calnexin transcript_id : NM_007597.2

name	1700121K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261874 GeneID:76653 MGI:1923903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : RIKEN cDNA 1700121K02 gene transcript_id : XM_484016.4

name	Hnrph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628660 GeneID:59013 MGI:1891925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein H1 transcript_id : NM_021510.2

name	Rufy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388074 GeneID:216724 MGI:2429762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and FYVE domain containing 1 transcript_id : NM_172557.2

name	Adamts2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130291 GeneID:216725 MGI:1347356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 transcript_id : NM_175643.2

name	Zfp354c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113681198 GeneID:30944 MGI:1353621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354C transcript_id : NM_013922.4

name	9630041N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802593 GeneID:214779 MGI:3053099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630041N07 gene transcript_id : NM_173387.2

name	Grm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27734061 GeneID:108072 MGI:1351343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, metabotropic 6 transcript_id : NM_173372.1

name	Zfp454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982551 GeneID:237758 MGI:2679253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 454 transcript_id : NM_172794.2

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374187 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044700.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374179 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044699.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374177 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044698.1

name	Zfp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374175 GeneID:22678 MGI:99167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 2 transcript_id : NM_001044697.1

name	Zfp354b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475952 GeneID:27274 MGI:1351476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354B transcript_id : NM_013744.2

name	Prop1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679480 GeneID:19127 MGI:109330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired like homeodomain factor 1 transcript_id : NM_008936.1

name	Olfr1378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129068 GeneID:258912 MGI:3031212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1378 transcript_id : NM_146910.1

name	Olfr1377 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129070 GeneID:258913 MGI:3031211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1377 transcript_id : NM_146911.1

name	Olfr51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170065 GeneID:18351 MGI:1333747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 51 transcript_id : NM_146909.1

name	Olfr54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203766 GeneID:18354 MGI:1333750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 54 transcript_id : NM_010997.1

name	Zfp354a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113374174 GeneID:21408 MGI:103172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 354A transcript_id : NM_009329.3

name	LOC100040275 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261876 GeneID:100040275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040275 transcript_id : XM_001474403.1

name	5133400J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261887 GeneID:71297 MGI:1918547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133400J02 gene transcript_id : XM_001475111.1

name	LOC622699 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94390078 GeneID:622699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : hypothetical LOC622699 transcript_id : XM_887141.2

name	BC049762 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802050 GeneID:193286 MGI:3039622
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049762 transcript_id : NM_177567.3

name	Clk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373542 GeneID:12750 MGI:1098551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC like kinase 4 transcript_id : NM_007714.3

name	Col23a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510252 GeneID:237759 MGI:2653243
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type XXIII, alpha 1 transcript_id : NM_153393.1

name	Agxt2l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28077014 GeneID:72947 MGI:1920197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanine-glyoxylate aminotransferase 2-like 2 transcript_id : NM_028398.1

name	Hnrpab (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114326506 GeneID:15384 MGI:1330294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein A/B transcript_id : NM_010448.3

name	Nola2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360258 GeneID:52530 MGI:1098547
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein family A, member 2 transcript_id : NM_026631.2

name	Rmnd5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076878 GeneID:66089 MGI:1913339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : required for meiotic nuclear division 5 homolog B (S. cerevisiae) transcript_id : NM_025346.1

name	C330016O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119137 GeneID:212706 MGI:2442218
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330016O10 gene transcript_id : NM_145974.3

name	0610009B22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801968 GeneID:66050 MGI:1913300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610009B22 gene transcript_id : NM_025319.2

name	Sec24a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174773 GeneID:77371 MGI:1924621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC24 related gene family, member A (S. cerevisiae) transcript_id : NM_175255.3

name	LOC100040402 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261878 GeneID:100040402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040402 transcript_id : XM_001474628.1

name	Flt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679813 CCDS:CCDS24618.1 GeneID:14257 MGI:95561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA]; GO:0005021 - vascular endothelial growth factor receptor activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 note : vascular endothelial growth factor receptor-3; chylous ascites; receptor protein tyrosine kinase product : FMS-like tyrosine kinase 4 protein_id : NP_032055.1

name	Scgb3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905069 CCDS:CCDS24619.1 GeneID:68662 MGI:1915912
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : type A is encoded by transcript variant A; pneumo secretory protein 2; uteroglobin related protein 2; family 3A member 1 secretoglobin product : secretoglobin, family 3A, member 1 type A protein_id : NP_473378.1

name	Scgb3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25014112 GeneID:68662 MGI:1915912
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : type B is encoded by transcript variant B; pneumo secretory protein 2; uteroglobin related protein 2; family 3A member 1 secretoglobin product : secretoglobin, family 3A, member 1 type B protein_id : NP_733923.1

name	Cnot6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059015 CCDS:CCDS24621.1 GeneID:104625 MGI:2144529
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCR4-NOT transcription complex, subunit 6 protein_id : NP_997649.1

name	LOC666899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390049 GeneID:666899
definition	codon_start : 1 product : similar to ribosomal protein L30 protein_id : XP_001000091.1

name	Gfpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305087 CCDS:CCDS24622.1 GeneID:14584 MGI:1338883
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004360 - glutamine-fructose-6-phosphate transaminase (isomerizing) activity [Evidence TAS]; GO:0005529 - sugar binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006541 - glutamine metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutamine fructose-6-phosphate transaminase 2 protein_id : NP_038557.1

name	Mapk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46592833 CCDS:CCDS24623.1 GeneID:26420 MGI:1346862
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant 1; protein kinase, mitogen-activated 9; Jun kinase; JNK/SAPK alpha product : mitogen activated protein kinase 9 isoform a protein_id : NP_997575.1

name	Mapk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393749 CCDS:CCDS24624.1 GeneID:26420 MGI:1346862
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; protein kinase, mitogen-activated 9; Jun kinase; JNK/SAPK alpha product : mitogen activated protein kinase 9 isoform b protein_id : NP_058657.1

name	Rasgef1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73088862 CCDS:CCDS24625.1 GeneID:74563 MGI:1921813
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : RasGEF domain family, member 1C protein_id : NP_083280.1

name	Rnf130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981195 CCDS:CCDS24626.1 GeneID:59044 MGI:1891717
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence NAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 note : g1-related zinc finger protein product : ring finger protein 130 protein_id : NP_067515.2

name	Tbc1d9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358940 GeneID:76795 MGI:1924045
definition	codon_start : 1 product : TBC1 domain family, member 9B protein_id : NP_084021.2

name	3010026O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386048 GeneID:68067 MGI:1915317
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68067 protein_id : NP_080819.1

name	Sqstm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754954 CCDS:CCDS24629.1 GeneID:18412 MGI:107931
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0003712 - transcription cofactor activity [Evidence TAS]; GO:0043130 - ubiquitin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0016197 - endosome transport [Evidence ISS]; GO:0006955 - immune response [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0008104 - protein localization [Evidence ISS]; GO:0043122 - regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 note : oxidative stress induced product : sequestosome 1 protein_id : NP_035148.1

name	Mgat4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239192 CCDS:CCDS24630.1 GeneID:103534 MGI:2143974
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B product : N-acetylglucosaminyltransferase IVb protein_id : NP_666038.2

name	Ltc4s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678734 CCDS:CCDS24631.1 GeneID:17001 MGI:107498
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008047 - enzyme activator activity [Evidence IEA]; GO:0004464 - leukotriene-C4 synthase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0019370 - leukotriene biosynthesis [Evidence IEA]; GO:0006691 - leukotriene metabolism [Evidence IEA] codon_start : 1 product : leukotriene C4 synthase protein_id : NP_032547.1

name	Maml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425022 CCDS:CCDS24632.1 GeneID:103806 MGI:1890504
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003713 - transcription coactivator activity [Evidence ISS] [Evidence IDA] GO_process : GO:0007219 - Notch signaling pathway [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mastermind like 1 protein_id : NP_780543.1

name	Canx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671664 CCDS:CCDS24633.1 GeneID:12330 MGI:88261
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : calnexin protein_id : NP_031623.1

name	1700121K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261875 GeneID:76653 MGI:1923903
definition	codon_start : 1 product : hypothetical protein LOC76653 protein_id : XP_484016.3

name	Hnrph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946928 CCDS:CCDS24634.1 GeneID:59013 MGI:1891925
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein H1 protein_id : NP_067485.1

name	Rufy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369788 CCDS:CCDS24635.1 GeneID:216724 MGI:2429762
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IDA]; GO:0030100 - regulation of endocytosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : FYVE-finger containing protein; Rab4a interacting protein product : RUN and FYVE domain containing 1 protein_id : NP_766145.1

name	Adamts2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563307 CCDS:CCDS24636.1 GeneID:216725 MGI:1347356
definition	GO_component : GO:0031012 - extracellular matrix [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0017074 - procollagen N-endopeptidase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0051605 - proteolysis during protein maturation [Evidence IMP]; GO:0043588 - skin development [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : procollagen N-proteinase; a disintegrin and metalloproteinase with thrombospondin repeats product : a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2 protein_id : NP_783574.1

name	Zfp354c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592078 CCDS:CCDS24637.1 GeneID:30944 MGI:1353621
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : transcription factor 17-like 2 product : zinc finger protein 354C protein_id : NP_038950.3

name	9630041N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734192 CCDS:CCDS24638.1 GeneID:214779 MGI:3053099
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : novel zinc finger protein product : hypothetical protein LOC214779 protein_id : NP_775563.1

name	Grm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734062 GeneID:108072 MGI:1351343
definition	GO_function : GO:0001642 - group III metabotropic glutamate receptor activity [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : G protein-coupled receptor, family C, group 1, member F; G protein-coupled receptor GRM6; metabotropic glutamate receptor 6 product : glutamate receptor, metabotropic 6 protein_id : NP_775548.1

name	Zfp454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982552 CCDS:CCDS24639.1 GeneID:237758 MGI:2679253
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 454 protein_id : NP_766382.2

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374176 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038162.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374178 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038163.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374180 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038164.1

name	Zfp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113374188 GeneID:22678 MGI:99167
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 2 protein_id : NP_001038165.1

name	Zfp354b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305545 CCDS:CCDS24641.1 GeneID:27274 MGI:1351476
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : transcription factor 17-like 1 product : zinc finger protein 354B protein_id : NP_038772.1

name	Prop1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679481 CCDS:CCDS24643.1 GeneID:19127 MGI:109330
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0048732 - gland development [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : prophet of Pit-1; Ames dwarf; pituitary specific homeodomain factor product : paired like homeodomain factor 1 protein_id : NP_032962.1

name	Olfr1378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129069 CCDS:CCDS24644.1 GeneID:258912 MGI:3031212
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4469162-4468215; olfactory receptor MOR129-2 product : olfactory receptor 1378 protein_id : NP_667121.1

name	Olfr1377 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129071 CCDS:CCDS24645.1 GeneID:258913 MGI:3031211
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4453480-4452557; olfactory receptor MOR129-1 product : olfactory receptor 1377 protein_id : NP_667122.1

name	Olfr51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170066 CCDS:CCDS24646.1 GeneID:18351 MGI:1333747
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4431129-4430206; olfactory receptor MOR129-3 product : olfactory receptor 51 protein_id : NP_667120.1

name	Olfr54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203767 CCDS:CCDS24647.1 GeneID:18354 MGI:1333750
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QP88-4411197-4410256; olfactory receptor MOR126-1 product : olfactory receptor 54 protein_id : NP_035127.1

name	Zfp354a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982823 CCDS:CCDS24648.1 GeneID:21408 MGI:103172
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription factor 17 product : zinc finger protein 354A protein_id : NP_033355.2

name	LOC100040275 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261877 GeneID:100040275
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474453.1

name	5133400J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261888 GeneID:71297 MGI:1918547
definition	codon_start : 1 product : hypothetical protein LOC71297 protein_id : XP_001475161.1

name	LOC622699 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390079 GeneID:622699
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892234.2

name	BC049762 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243908 CCDS:CCDS24650.1 GeneID:193286 MGI:3039622
definition	codon_start : 1 product : hypothetical protein LOC193286 protein_id : NP_808235.1

name	Clk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671766 CCDS:CCDS24651.1 GeneID:12750 MGI:1098551
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : CDC like kinase 4 protein_id : NP_031740.1

name	Col23a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510253 CCDS:CCDS24652.1 GeneID:237759 MGI:2653243
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : collagen type XXIII, alpha 1 product : procollagen, type XXIII, alpha 1 protein_id : NP_700442.1

name	Agxt2l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077015 CCDS:CCDS24653.1 GeneID:72947 MGI:1920197
definition	GO_function : GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : alanine-glyoxylate aminotransferase 2-like 2 protein_id : NP_082674.1

name	Hnrpab (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754222 CCDS:CCDS24654.1 GeneID:15384 MGI:1330294
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; S1 protein D2 product : heterogeneous nuclear ribonucleoprotein A/B isoform 2 protein_id : NP_034578.1

name	Nola2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386120 CCDS:CCDS24655.1 GeneID:52530 MGI:1098547
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005732 - small nucleolar ribonucleoprotein complex [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0030559 - rRNA pseudouridylation guide activity [Evidence ISS]; GO:0030515 - snoRNA binding [Evidence ISS] GO_process : GO:0006365 - 35S primary transcript processing [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0042254 - ribosome biogenesis and assembly [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0031118 - rRNA pseudouridine synthesis [Evidence ISS] codon_start : 1 note : H/ACA small nucleolar RNPs product : nucleolar protein family A, member 2 protein_id : NP_080907.1

name	Rmnd5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076879 CCDS:CCDS24656.1 GeneID:66089 MGI:1913339
definition	codon_start : 1 product : required for meiotic nuclear division 5 homolog B protein_id : NP_079622.1

name	C330016O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981859 CCDS:CCDS24657.1 GeneID:212706 MGI:2442218
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : Nedd4 binding protein 3 protein_id : NP_666086.2

name	0610009B22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384686 GeneID:66050 MGI:1913300
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005478 - intracellular transporter activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66050 protein_id : NP_079595.1

name	Sec24a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174774 CCDS:CCDS24660.1 GeneID:77371 MGI:1924621
definition	GO_component : GO:0030127 - COPII vesicle coat [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : SEC24 related gene family, member A protein_id : NP_780464.2

name	LOC100040402 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261879 GeneID:100040402
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474678.1

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 1 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 2 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 3 pseudo : _no_value

name	LOC100040032 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040032
definition	number : 4 pseudo : _no_value

name	LOC100040073 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040073
definition	number : 1 pseudo : _no_value

name	D930048N14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261892 GeneID:97775 MGI:2144709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 26 ESTs product : RIKEN cDNA D930048N14 gene transcript_id : XR_035265.1

clone name	MSMg01-157M06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-072K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-122B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275E15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-424O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105B13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-386E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-113G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059O08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-350P07.b	B6Ng01-350P07.g
ACC	GA131474	GA131475
length	885	886
definition	B6Ng01-350P07.b	B6Ng01-350P07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(50,569,027 - 50,569,910)	(50,435,941 - 50,436,827)
sequence	gaattcactcgccgccatctcccactgaagcatggagctccttccagaag gaatgagagctgttgtcagagcagaagccactcctggctgttgctgctcg gtgggaaatgttacccgtgcacgtgctacaatccacacttgtatcccaca accccgcacccatgcattcaatcaacccaggtcaaaattatttggagaaa agttggcagaaaatgtatagactccccccccccccttctaagcaatagaa cggcacttgtgtgttatgaagcactgtaagtaatatagattacttgatgt atgtgggagagtgtgtgtaggttaaacccaaatgacacacatattacccc agcgatctggatacttgagagggtcctgcaccagagctctgtggatgctg aaggattctgcaggatgctgcagttgaagatgtggaccatttggaccatg attaactctactttcatcccattagtgagagcagttatcatcactaggtc tcttgccccacccacttaccttgttccatgtcatgcctgtcattgtcttc tttcacattttgagtactattttatttttgtgtactttttaaaaatatat tattctgggtcatgtccgaagccgggtggtggtgcacgcctttaatccca gcacttgggaggcagaagcaggagtccaaggccagcctggtctacatagt gggctccaggacagccagggctacgcagagaaaccctgtctcacacacac acacacacacacacacacacacacacacacacacacacacacacacactc acttcttagcagcatctgtaggcctcctcagatatccacaccacaaaagg atgtgtgtgtagggtgtggggggagatgacttccc	gaattcctgggtcagagtaaggagagcagatgtttactagaagacgccaa ggacggctgacatcacccagggcccccaggacacgggaagaggccggggt cctccatccctccgcgccaaggagcattcctggggcaggcgccagggctg gggggtggacatgcacacagatgcaggcgccacacaccagtcctcgccac ctgaacacaattagtcaagatgtggaaacgatttcaatcttgaaaggaga gaggagtggctggccggacagactcctcagtgtggattggtcctttgcag aattgcaggagtggcctttgtggcgggtgagctgttgggagtccctggcc agggatggagacgaccattgtcatgtctctctcccttccatggacacaag ccatcctttaatatctactttaggggtggaactggaagaggagttgcttc cattctttcctttacacctctgcagcctgttcctcaccaaaagctgtccc caggctcagattcgtgtgacaacaagccacagaaaacctagtgtaaatca gctcgggccaaaagcctccatcttgtattactttgccttctcccctgtgt ggcctgcctcgacagctcacctgtgccacttggcaccaccagagcacaca gaggctggccttttccatcagattgtactgtagactctaaagctggttcc atgggttcagtttgggtcatcggtagaggtttgagcatcaacactgtggc tgaggcagggagcagagctttggttggtcaaataggccacatgactgttt cgggtggggtttgctgtctgaacctcaggagctgaggcaaggaggctctg aggagggtgtctcgtgtgtgtgtgtgtgtgtgtgtg
quality values	Open. Hide. 62 31 23 37 62 33 25 54 62 62 56 62 62 62 62 44 24 62 62 62 62 62 44 44 59 62 62 59 43 34 43 31 24 34 28 27 30 43 62 62 62 62 62 62 49 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 62 54 48 59 59 59 59 62 62 62 62 62 62 56 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 59 62 59 59 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 59 59 46 62 59 62 62 56 43 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 56 62 47 54 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 53 62 62 46 62 62 62 62 62 56 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 52 52 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 52 54 54 62 52 62 62 62 62 54 58 58 58 58 54 58 58 58 54 54 58 37 41 58 58 58 58 54 58 58 58 54 58 58 45 58 52 54 58 58 58 54 58 48 54 58 58 54 54 52 52 52 58 58 58 58 58 58 54 54 47 46 54 58 41 58 58 41 49 54 58 58 58 58 58 53 53 50 50 46 53 58 58 58 46 49 58 58 58 58 50 50 41 53 47 54 48 46 37 58 52 52 50 44 48 41 41 50 54 51 53 58 32 58 54 29 48 58 38 58 39 26 54 44 40 51 37 36 51 50 49 37 33 58 51 58 58 32 21 50 40 50 58 50 50 32 41 49 53 54 52 47 54 50 29 12 44 30 32 29 54 54 24 49 39 27 49 32 16 50 52 37 40 41 40 54 37 41 39 45 42 52 41 50 42 37 53 52 34 37 37 53 40 40 40 45 31 31 30 41 30 41 27 37 32 46 27 31 31 33 37 40 51 52 54 32 33 31 31 26 52 36 28 31 15 40 36 32 31 52 32 45 52 31 25 46 23 28 45 31 45 18 32 34 45 22 34 29 32 31 30 30 33 30 45 32 34 31 27 23 21 19 25 19 30 27 32 16 15 22 27 17 21 13 30 29 41 26 29 25 36 31 38 29 43 13 31 19 31 22 27 22 29 13 19 9 16 43 46 24 37 31 24 27 23 6 7 8 23 33 42 36 38 26 31 22 22 21 31 31 37 31 37 31 27 9 12 6 20 11 7 31 17 27 25 23 36 31 37 37 41 46 27 18 18 20 15 31 30 31 27 31 13 21 21 19 17 32 16 13 26 19 36 30 28 36 28 13 13 9 11 12 10 26 11 30 29 12 14 9	Open. Hide. 62 47 31 47 62 62 62 42 51 32 27 28 36 21 25 45 43 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 59 59 62 62 59 62 62 62 62 59 59 56 49 48 62 62 59 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 32 38 62 62 62 62 54 54 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 42 58 58 52 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 58 54 54 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 54 58 54 54 58 54 52 58 58 58 58 58 58 58 53 51 51 58 58 58 54 51 42 46 41 58 58 48 58 58 53 58 51 52 49 58 58 34 58 58 58 54 52 54 58 49 58 58 58 51 40 58 58 54 58 58 58 52 50 58 58 58 58 54 51 58 58 58 51 58 54 49 51 42 58 58 58 40 54 58 54 58 49 52 53 58 58 51 58 52 41 51 58 51 54 58 58 51 51 51 58 44 44 51 53 51 49 58 58 53 51 53 53 52 51 41 24 54 51 52 39 58 53 58 50 41 52 42 51 42 54 50 52 50 54 51 51 53 53 54 44 37 38 54 40 51 51 38 45 39 54 34 50 50 39 49 54 31 44 40 49 52 49 49 52 47 33 46 37 45 51 49 25 42 35 54 54 53 40 45 34 53 53 45 32 46 26 49 39 26 37 40 53 54 31 51 26 35 38 51 54 52 37 54 47 45 42 52 53 46 25 52 52 42 33 45 52 49 49 35 47 34 34 32 29 51 31 34 53 52 32 45 35 43 42 42 51 30 40 41 53 32 52 30 53 53 40 42 32 42 35 43 31 25 32 35 31 45 31 42 36 42 46 30 43 31 46 10 41 23 31 31 51 33 22 16 31 31 16 51 14 33 51 51 30 25 42 27 33 31 30 19 30 25 46 37 31 9 17 19 28 30 31 36 28 36 36 30 31 32 33 8 47 31 37 26 47 43 31 41 46 46 31 36 48 29 31 32 43 36 31 38 36 28 29 27 33 31 31 32 7 10 8 7 13 31 31 32 32 18 27 19 17 15 14 29 31 29 27 25 31 31 31 23 38 16 18 30 17 43 22 13 36 18 28 31 38 23 18 36 27 38 25 36 17 29 24 26 7 25 30 37 18 14 5 10 8 13 4 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr11_50569027_50569910
seq2: B6Ng01-350P07.b_51_935 (reverse)

seq1  GGGAAGTCATCTCCCCCCACACCCTACACACACATCCTTTTGTGGTGTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAGTCATCTCCCCCCACACCCTACACACACATCCTTTTGTGGTGTGG  50

seq1  ATATCTGAGGAGGCCTACAGATGCCTGCTAAGAAGT--GTGTGTGTGTGT  98
      ||||||||||||||||||||||| ||||||||||||  ||||||||||||
seq2  ATATCTGAGGAGGCCTACAGATG-CTGCTAAGAAGTGAGTGTGTGTGTGT  99

seq1  GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGAGACA  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGAGACA  149

seq1  GGGTTTCTCTGCGTAGCCCTGGCTGTCCTGGAGCCCACTATGTAGACCAG  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTTCTCTGCGTAGCCCTGGCTGTCCTGGAGCCCACTATGTAGACCAG  199

seq1  GCTGGCCTTGGACTCCTGCTTCTGCCTCCCAAGTGCTGGGATTAAAGGCG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGCCTTGGACTCCTGCTTCTGCCTCCCAAGTGCTGGGATTAAAGGCG  249

seq1  TGCACCACCACCCGGCTTCGGACATGACCCAGAATAATATATTTTTAAAA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACCACCACCCGGCTTCGGACATGACCCAGAATAATATATTTTTAAAA  299

seq1  AGTACACAAAAATAAAATAGTACTCAAAATGTGAAAGAAGACAATGACAG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACACAAAAATAAAATAGTACTCAAAATGTGAAAGAAGACAATGACAG  349

seq1  GCATGACATGGAACAAGGTAAGTGGGTGGGGCAAGAGACCTAGTGATGAT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGACATGGAACAAGGTAAGTGGGTGGGGCAAGAGACCTAGTGATGAT  399

seq1  AACTGCTCTCACTAATGGGATGAAAGTAGAGTTAATCATGGTCCAAATGG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGCTCTCACTAATGGGATGAAAGTAGAGTTAATCATGGTCCAAATGG  449

seq1  TCCACATCTTCAACTGCAGCATCCTGCAGAATCCTTCAGCATCCACAGAG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACATCTTCAACTGCAGCATCCTGCAGAATCCTTCAGCATCCACAGAG  499

seq1  CTCTGGTGCAGGACCCTCTCAAGTATCCAGATCGCTGGGGTAATATGTGT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGTGCAGGACCCTCTCAAGTATCCAGATCGCTGGGGTAATATGTGT  549

seq1  GTCATTTGGGTTTAACCTACACACACTCTCCCACATACATCAAGTAATCT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATTTGGGTTTAACCTACACACACTCTCCCACATACATCAAGTAATCT  599

seq1  ATATTACTTACAGTGCTTCATAACACACAAGTGCCGTTCTATTGCTTAGA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTACTTACAGTGCTTCATAACACACAAGTGCCGTTCTATTGCTTAGA  649

seq1  AGGGGGGGGGGGGAGTCTATACATTTTCTGCCAACTTTTCTCCAAATAAT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGGGGGGGGGAGTCTATACATTTTCTGCCAACTTTTCTCCAAATAAT  699

seq1  TTTGACCTGGGTTGATTGAATGCATGGGTGCGGGGTTGTGGGATACAAGT  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGACCTGGGTTGATTGAATGCATGGGTGCGGGGTTGTGGGATACAAGT  749

seq1  GTGGATTGTAGCACGTGCACGGGTAACATTTCCCACCGAGCAGCAACAGC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGATTGTAGCACGTGCACGGGTAACATTTCCCACCGAGCAGCAACAGC  799

seq1  CAGGAGTGGCTTCTGCTCTGACAACAGCTCTCATTCCTTCTGGAAGGAGC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAGTGGCTTCTGCTCTGACAACAGCTCTCATTCCTTCTGGAAGGAGC  849

seq1  TCCATGCTTCAGTGGGAGATGGCGGCGAGTGAATTC  884
      ||||||||||||||||||||||||||||||||||||
seq2  TCCATGCTTCAGTGGGAGATGGCGGCGAGTGAATTC  885

seq1: chr11_50435941_50436827
seq2: B6Ng01-350P07.g_70_955

seq1  GAATTCCTGGGTCAGAGTAAGGAGAGCAGATGTTTACTAGAAGACGCCAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGGGTCAGAGTAAGGAGAGCAGATGTTTACTAGAAGACGCCAA  50

seq1  GGACGGCTGACATCACCCAGGGCCCCCAGGACACGGGAAGAGGCCGGGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACGGCTGACATCACCCAGGGCCCCCAGGACACGGGAAGAGGCCGGGGT  100

seq1  CCTCCATCCCTCCGCGCCAAGGAGCATTCCTGGGGCAGGCGCCAGGGCTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCATCCCTCCGCGCCAAGGAGCATTCCTGGGGCAGGCGCCAGGGCTG  150

seq1  GGGGGTGGACATGCACACAGATGCAGGCGCCACACACCAGTCCTCGCCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGTGGACATGCACACAGATGCAGGCGCCACACACCAGTCCTCGCCAC  200

seq1  CTGAACACAATTAGTCAAGATGTGGAAACGATTTCAATCTTGAAAGGAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAACACAATTAGTCAAGATGTGGAAACGATTTCAATCTTGAAAGGAGA  250

seq1  GAGGAGTGGCTGGCCGGACAGACTCCTCAGTGTGGATTGGTCCTTTGCAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAGTGGCTGGCCGGACAGACTCCTCAGTGTGGATTGGTCCTTTGCAG  300

seq1  AATTGCAGGAGTGGCCTTTGTGGCGGGTGAGCTGTTGGGAGTCCCTGGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGCAGGAGTGGCCTTTGTGGCGGGTGAGCTGTTGGGAGTCCCTGGCC  350

seq1  AGGGATGGAGACGACCATTGTCATGTCTCTCTCCCTTCCATGGACACAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGATGGAGACGACCATTGTCATGTCTCTCTCCCTTCCATGGACACAAG  400

seq1  CCATCCTTTAATATCTACTTTAGGGGTGGAACTGGAAGAGGAGTTGCTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCCTTTAATATCTACTTTAGGGGTGGAACTGGAAGAGGAGTTGCTTC  450

seq1  CATTCTTTCCTTTACACCTCTGCAGCCTGTTCCTCACCAAAAGCTGTCCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTTTCCTTTACACCTCTGCAGCCTGTTCCTCACCAAAAGCTGTCCC  500

seq1  CAGGCTCAGATTCGTGTGACAACAAGCCACAGAAAACCTAGTGTAAATCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTCAGATTCGTGTGACAACAAGCCACAGAAAACCTAGTGTAAATCA  550

seq1  GCTCGGGCCAAAAGCCTCCATCTTGTATTACTTTGCCTTCTCCCCTGTGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCGGGCCAAAAGCCTCCATCTTGTATTACTTTGCCTTCTCCCCTGTGT  600

seq1  GGCCTGCCTCGACAGCTCACCTGTGCCACTTGGCACCACCAGAGCACACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTGCCTCGACAGCTCACCTGTGCCACTTGGCACCACCAGAGCACACA  650

seq1  GAGGCTGGCCTTTTCCATCAGATTGTACTGTAGACTCTAAAGCTGGTTCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCTGGCCTTTTCCATCAGATTGTACTGTAGACTCTAAAGCTGGTTCC  700

seq1  ATGGGTTCAGTTTGGGTCATCGGTAGAGGTTTGAGCATCAACACTGTGGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGTTCAGTTTGGGTCATCGGTAGAGGTTTGAGCATCAACACTGTGGC  750

seq1  TGAGGCAGGGAGCAGAGCTTTGGTTGGTCAAATAGGCCACATGACTGTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCAGGGAGCAGAGCTTTGGTTGGTCAAATAGGCCACATGACTGTTT  800

seq1  CGGGTGGGGTTTGCTGTCTGAACCTCAGGGAGCTGAGGCAAGGAGGCTCT  850
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  CGGGTGGGGTTTGCTGTCTGAACCTCA-GGAGCTGAGGCAAGGAGGCTCT  849

seq1  GAGGAGGGTGTCTCGTGTGTGTGTGTGTGTGTGTGTG  887
      |||||||||||||||||||||||||||||||||||||
seq2  GAGGAGGGTGTCTCGTGTGTGTGTGTGTGTGTGTGTG  886

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information