MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-081J07
Chromosome	11 (Build37)
Map Location	73,828,850 - 73,829,033
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100043309, Camkk1, 1200014J11Rik, Itgae, Gsg2, P2rx5, Tmem93, Tax1bp3, Ctns, Carkl, Trpv1, Trpv3, Aspa, Spata22, Olfr20, Olfr376, Olfr377-ps1, Olfr1, Olfr75-ps1, Olfr378, Olfr379-ps1, Olfr380, Olfr381, Olfr382, Olfr383-ps1, Olfr385, Olfr386, Olfr387-ps1, 1700012C15Rik, Olfr388-ps1, Olfr389, Olfr390, Olfr391-ps1, Olfr392, Olfr393, Olfr394, Olfr395, Olfr396-ps1, Olfr23, Olfr22-ps1, Olfr397, Olfr398
Downstream gene	Olfr139, Olfr399, OTTMUSG00000006163, LOC668567, Olfr400-ps1, Olfr401, Olfr402, Olfr403, Olfr43, Olfr404-ps1, Olfr405-ps1, Olfr406, Olfr407-ps1, Olfr59, Olfr408-ps1, Olfr409-ps1, LOC193079, Olfr410, Olfr411, Olfr412, Garnl4, E130309D14Rik, 1300001I01Rik, Pafah1b1, Mett10d, Mnt, Rutbc1, Tsr1, Srr, LOC100042478, Smg6
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043309 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Camkk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55984 MGI:1891766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200014J11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66874 MGI:1914124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgae (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gsg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14841 MGI:1194498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2rx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94045 MGI:2137026
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66048 MGI:1913298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tax1bp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76281 MGI:1923531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctns (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83429 MGI:1932872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Carkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74637 MGI:1921887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193034 MGI:1341787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpv3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246788 MGI:2181407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aspa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11484 MGI:87914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spata22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380709 MGI:2685728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258925 MGI:109315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258924 MGI:3030210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr377-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258226 MGI:3030211
definition	gene_synonym : MOR135-15 note : olfactory receptor 377, pseudogene 1 pseudo : _no_value

name	Olfr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258923 MGI:102698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr75-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258186 MGI:2153204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Olfr378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259026 MGI:3030212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr379-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257942 MGI:3030213
definition	gene_synonym : MOR135-25 note : olfactory receptor 379, pseudogene 1 pseudo : _no_value

name	Olfr380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259027 MGI:3030214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259024 MGI:3030215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258435 MGI:3030216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr383-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258211 MGI:3030217
definition	gene_synonym : MOR135-16P note : olfactory receptor 383, pseudogene 1 pseudo : _no_value

name	Olfr385 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259025 MGI:3030219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193053 MGI:3030220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr387-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258210 MGI:3030221
definition	gene_synonym : MOR135-17 note : olfactory receptor 387, pseudogene 1 pseudo : _no_value

name	1700012C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76390 MGI:1923640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Olfr388-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258182 MGI:3030222
definition	gene_synonym : MOR135-22 note : olfactory receptor 388, pseudogene 1 pseudo : _no_value

name	Olfr389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259011 MGI:3030223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr390 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258344 MGI:3030224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr391-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258236 MGI:3030225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2296 Proteins pseudo : _no_value

name	Olfr392 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259008 MGI:3030226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr393 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259010 MGI:3030227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr394 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259009 MGI:3030228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259007 MGI:3030229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr396-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258208 MGI:3030230
definition	gene_synonym : MOR135-19 note : olfactory receptor 396, pseudogene 1 pseudo : _no_value

name	Olfr23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18321 MGI:109312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr22-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258209 MGI:109313
definition	gene_synonym : MOR135-18; MTPCR35; Olfr22 note : olfactory receptor 22, pseudogene 1 pseudo : _no_value

name	Olfr397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258343 MGI:3030231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr398 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258705 MGI:3030232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr139 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259005 MGI:2177522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr399 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259006 MGI:3030233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000006163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327963 MGI:3650906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 1 Protein

name	LOC668567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 15 Proteins pseudo : _no_value

name	Olfr400-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257876 MGI:3030234
definition	gene_synonym : MOR255-7P note : olfactory receptor 400, pseudogene 1 pseudo : _no_value

name	Olfr401 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258701 MGI:3030235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr402 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258703 MGI:3030236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404316 MGI:3030237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr43 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258706 MGI:1333770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr404-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257920 MGI:3030238
definition	gene_synonym : MOR133-5P note : olfactory receptor 404, pseudogene 1 pseudo : _no_value

name	Olfr405-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258128 MGI:3030239
definition	gene_synonym : MOR125-3P note : olfactory receptor 405, pseudogene 1 pseudo : _no_value

name	Olfr406 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258181 MGI:3030240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr407-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258127 MGI:3030241
definition	gene_synonym : MOR125-4P note : olfactory receptor 407, pseudogene 1 pseudo : _no_value

name	Olfr59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18359 MGI:1333755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr408-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258129 MGI:3030242
definition	gene_synonym : MOR125-2P note : olfactory receptor 408, pseudogene 1 pseudo : _no_value

name	Olfr409-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258131 MGI:3030243
definition	gene_synonym : MOR133-2 note : olfactory receptor 409, pseudogene 1 pseudo : _no_value

name	LOC193079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:193079
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	Olfr410 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258702 MGI:3030244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr411 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258704 MGI:3030245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258153 MGI:3030246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Garnl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380711 MGI:3028623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130309D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432582 MGI:3588240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300001I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74148 MGI:1921398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18472 MGI:109520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mett10d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67493 MGI:1914743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17428 MGI:109150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rutbc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97761 MGI:2144695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104662 MGI:2144566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27364 MGI:1351636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042478 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	Smg6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103677 MGI:2144117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043309 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261984 GeneID:100043309
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043309 transcript_id : XM_001480517.1

name	Camkk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922602 GeneID:55984 MGI:1891766
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase kinase 1, alpha transcript_id : NM_018883.2

name	1200014J11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802919 GeneID:66874 MGI:1914124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200014J11 gene transcript_id : NM_025818.2

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680481 GeneID:16407 MGI:1298377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_008399.1

name	Itgae (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227222 GeneID:16407 MGI:1298377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha E, epithelial-associated transcript_id : NM_172944.2

name	Gsg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106328 GeneID:14841 MGI:1194498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : germ cell-specific gene 2 transcript_id : NM_010353.1

name	P2rx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349156 GeneID:94045 MGI:2137026
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2X, ligand-gated ion channel, 5 transcript_id : NM_033321.2

name	Tmem93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354019 GeneID:66048 MGI:1913298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 93 transcript_id : NM_025318.2

name	Tax1bp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803240 GeneID:76281 MGI:1923531
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tax1 (human T-cell leukemia virus type I) binding protein 3 transcript_id : NM_029564.2

name	Ctns (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354408 GeneID:83429 MGI:1932872
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystinosis, nephropathic transcript_id : NM_031251.3

name	Carkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286807 GeneID:74637 MGI:1921887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate kinase-like transcript_id : NM_029031.3

name	Trpv1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47825363 GeneID:193034 MGI:1341787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 1 transcript_id : NM_001001445.1

name	Trpv3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21492637 GeneID:246788 MGI:2181407
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily V, member 3 transcript_id : NM_145099.1

name	Aspa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354273 GeneID:11484 MGI:87914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aspartoacylase (aminoacylase) 2 transcript_id : NM_023113.4

name	Spata22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865896 GeneID:380709 MGI:2685728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated 22 transcript_id : NM_001045531.1

name	Olfr20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239301 GeneID:258925 MGI:109315
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 20 transcript_id : NM_146923.1

name	Olfr376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239303 GeneID:258924 MGI:3030210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 376 transcript_id : NM_146922.1

name	Olfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129048 GeneID:258923 MGI:102698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1 transcript_id : NM_146921.1

name	Olfr378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128892 GeneID:259026 MGI:3030212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 378 transcript_id : NM_147024.1

name	Olfr380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128894 GeneID:259027 MGI:3030214
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 380 transcript_id : NM_147025.1

name	Olfr381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121583634 GeneID:259024 MGI:3030215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 381 transcript_id : NM_147022.2

name	Olfr382 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239297 GeneID:258435 MGI:3030216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 382 transcript_id : NM_146443.1

name	Olfr385 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239299 GeneID:259025 MGI:3030219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 385 transcript_id : NM_147023.1

name	Olfr386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402198 GeneID:193053 MGI:3030220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 386 transcript_id : NM_207224.1

name	1700012C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390200 GeneID:76390 MGI:1923640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 1700012C15 gene transcript_id : XM_111107.7

name	Olfr389 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110735421 GeneID:259011 MGI:3030223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 389 transcript_id : NM_147009.2

name	Olfr390 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129603 GeneID:258344 MGI:3030224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 390 transcript_id : NM_146347.1

name	Olfr392 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128926 GeneID:259008 MGI:3030226
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 392 transcript_id : NM_147006.1

name	Olfr393 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128920 GeneID:259010 MGI:3030227
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 393 transcript_id : NM_147008.1

name	Olfr394 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128928 GeneID:259009 MGI:3030228
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 394 transcript_id : NM_147007.1

name	Olfr395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128932 GeneID:259007 MGI:3030229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 395 transcript_id : NM_147005.1

name	Olfr23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66472355 GeneID:18321 MGI:109312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 23 transcript_id : NM_010970.1

name	Olfr397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129609 GeneID:258343 MGI:3030231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 397 transcript_id : NM_146346.1

name	Olfr398 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129414 GeneID:258705 MGI:3030232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 398 transcript_id : NM_146710.1

name	Olfr139 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22208855 GeneID:259005 MGI:2177522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 139 transcript_id : NM_147003.1

name	Olfr399 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128930 GeneID:259006 MGI:3030233
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 399 transcript_id : NM_147004.1

name	OTTMUSG00000006163 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94390202 GeneID:327963 MGI:3650906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 1 Protein product : predicted gene, OTTMUSG00000006163 transcript_id : XM_282967.5

name	Olfr401 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129424 GeneID:258701 MGI:3030235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 401 transcript_id : NM_146706.1

name	Olfr402 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129418 GeneID:258703 MGI:3030236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 402 transcript_id : NM_146708.1

name	Olfr403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518539 GeneID:404316 MGI:3030237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 403 transcript_id : NM_207622.1

name	Olfr43 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239309 GeneID:258706 MGI:1333770
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 43 transcript_id : NM_146711.1

name	Olfr406 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801481 GeneID:258181 MGI:3030240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 406 transcript_id : NM_001011863.1

name	Olfr59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53828658 GeneID:18359 MGI:1333755
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 59 transcript_id : NM_011002.1

name	Olfr410 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129426 GeneID:258702 MGI:3030244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 410 transcript_id : NM_146707.1

name	Olfr411 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129420 GeneID:258704 MGI:3030245
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 411 transcript_id : NM_146709.1

name	Olfr412 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801459 GeneID:258153 MGI:3030246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 412 transcript_id : NM_001011851.1

name	Garnl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517293 GeneID:380711 MGI:3028623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTPase activating RANGAP domain-like 4 transcript_id : NM_001015046.2

name	E130309D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000657 GeneID:432582 MGI:3588240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130309D14 gene transcript_id : NM_001013784.1

name	1300001I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487200 GeneID:74148 MGI:1921398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300001I01 gene transcript_id : NM_001081158.1

name	Pafah1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354041 GeneID:18472 MGI:109520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit transcript_id : NM_013625.2

name	Mett10d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347227 GeneID:67493 MGI:1914743
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyltransferase 10 domain containing transcript_id : NM_026197.2

name	Mnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543258 GeneID:17428 MGI:109150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : max binding protein transcript_id : NM_010813.2

name	Rutbc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956384 GeneID:97761 MGI:2144695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RUN and TBC1 domain containing 1 transcript_id : NM_197943.2

name	Tsr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506293 GeneID:104662 MGI:2144566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSR1, 20S rRNA accumulation, homolog (yeast) transcript_id : NM_177325.3

name	Srr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380722 GeneID:27364 MGI:1351636
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine racemase transcript_id : NM_013761.3

name	LOC100042478 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261937 GeneID:100042478
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : hypothetical protein LOC100042478 transcript_id : XM_001478283.1

name	Smg6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50582544 GeneID:103677 MGI:2144117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) transcript_id : NM_001002764.1

name	LOC100043309 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261985 GeneID:100043309
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480567.1

name	Camkk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922603 CCDS:CCDS24993.1 GeneID:55984 MGI:1891766
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0004683 - calmodulin regulated protein kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : calcium calmodulin dependent protein kinase kinase alpha product : calcium/calmodulin-dependent protein kinase kinase 1, alpha protein_id : NP_061371.2

name	1200014J11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229010 CCDS:CCDS24994.1 GeneID:66874 MGI:1914124
definition	codon_start : 1 exception : mismatches in translation product : ELG protein protein_id : NP_080094.2

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680482 CCDS:CCDS24995.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation function : adhesion receptor note : isoform 1 is encoded by transcript variant 1; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 1 protein_id : NP_032425.1

name	Itgae (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370456 CCDS:CCDS24996.1 GeneID:16407 MGI:1298377
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; integrin alpha-M290; integrin alpha-E; integrin aM290 product : integrin, alpha E, epithelial-associated isoform 2 protein_id : NP_766532.1

name	Gsg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106329 CCDS:CCDS24997.1 GeneID:14841 MGI:1194498
definition	GO_component : GO:0005634 - nucleus [Evidence IEP] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IDA] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IDA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP] codon_start : 1 note : haploid germ cell-specific nuclear protein kinase product : germ cell-specific gene 2 protein_id : NP_034483.1

name	P2rx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15277325 CCDS:CCDS24998.1 GeneID:94045 MGI:2137026
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC] GO_function : GO:0004931 - ATP-gated cation channel activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : purinergic receptor P2X5 protein_id : NP_201578.1

name	Tmem93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384684 CCDS:CCDS24999.1 GeneID:66048 MGI:1913298
definition	codon_start : 1 product : hypothetical protein LOC66048 protein_id : NP_079594.1

name	Tax1bp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313140 CCDS:CCDS25000.1 GeneID:76281 MGI:1923531
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IMP] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0030178 - negative regulation of Wnt receptor signaling pathway [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : Tax1 (human T-cell leukemia virus type I) binding protein 3 protein_id : NP_083840.1

name	Ctns (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752577 CCDS:CCDS25001.1 GeneID:83429 MGI:1932872
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cystinosis, nephropathic protein_id : NP_112541.1

name	Carkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095001 CCDS:CCDS25002.1 GeneID:74637 MGI:1921887
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 product : carbohydrate kinase-like protein_id : NP_083307.1

name	Trpv1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47825364 CCDS:CCDS25003.1 GeneID:193034 MGI:1341787
definition	GO_component : GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IMP]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence ISS]; GO:0008324 - cation transporter activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0009408 - response to heat [Evidence IDA] [Evidence IMP]; GO:0009268 - response to pH [Evidence IMP] [Evidence IDA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0050955 - thermoception [Evidence IDA]; GO:0001659 - thermoregulation [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : vanilloid receptor subtype 1; capsaicin receptor; cation channel; transient receptor potential cation channel V1; novel protein, ortholog of human and rat transient receptor potential cation channel, subfamily V, member 1 TRPV1 product : transient receptor potential cation channel, subfamily V, member 1 protein_id : NP_001001445.1

name	Trpv3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21492638 CCDS:CCDS25004.1 GeneID:246788 MGI:2181407
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0009266 - response to temperature stimulus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : TRP ion channel TRPV3; non-hair product : transient receptor potential cation channel, subfamily V, member 3 protein_id : NP_659567.1

name	Aspa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560279 CCDS:CCDS25005.1 GeneID:11484 MGI:87914
definition	GO_function : GO:0004046 - aminoacylase activity [Evidence TAS] [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0006083 - acetate metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : aminoacylase 2; aspartoacylase product : aspartoacylase (aminoacylase) 2 protein_id : NP_075602.2

name	Spata22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865897 GeneID:380709 MGI:2685728
definition	codon_start : 1 product : testes development-related NYD-SP20 protein_id : NP_001038996.1

name	Olfr20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239302 CCDS:CCDS25006.1 GeneID:258925 MGI:109315
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor 21; GA_x6K02T2P1NL-3514066-3515010 product : olfactory receptor 20 protein_id : NP_667134.1

name	Olfr376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239304 CCDS:CCDS25007.1 GeneID:258924 MGI:3030210
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3535075-3536028; olfactory receptor MOR135-12 product : olfactory receptor 376 protein_id : NP_667133.1

name	Olfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129049 CCDS:CCDS25008.1 GeneID:258923 MGI:102698
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3556334-3555390; olfactory receptor MOR135-13 product : olfactory receptor 1 protein_id : NP_667132.1

name	Olfr378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128893 CCDS:CCDS25009.1 GeneID:259026 MGI:3030212
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3586282-3585338; olfactory receptor MOR135-2; odorant receptor product : olfactory receptor 378 protein_id : NP_667235.1

name	Olfr380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128895 CCDS:CCDS25010.1 GeneID:259027 MGI:3030214
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3613021-3612086; olfactory receptor MOR135-1 product : olfactory receptor 380 protein_id : NP_667236.1

name	Olfr381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121583635 CCDS:CCDS25011.1 GeneID:259024 MGI:3030215
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3646409-3645474; olfactory receptor MOR135-4 product : olfactory receptor 381 protein_id : NP_667233.2

name	Olfr382 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239298 CCDS:CCDS25012.1 GeneID:258435 MGI:3030216
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3676608-3675670; MOR135-31_p; olfactory receptor MOR135-14 product : olfactory receptor 382 protein_id : NP_666654.1

name	Olfr385 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239300 CCDS:CCDS25013.1 GeneID:259025 MGI:3030219
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3760313-3759375; olfactory receptor MOR135-3 product : olfactory receptor 385 protein_id : NP_667234.1

name	Olfr386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402199 CCDS:CCDS25014.1 GeneID:193053 MGI:3030220
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2P1NL-3773152-3774090; novel olfactory receptor family MOR135 member product : olfactory receptor 386 protein_id : NP_997107.1

name	1700012C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390201 GeneID:76390 MGI:1923640
definition	codon_start : 1 product : hypothetical protein LOC76390 protein_id : XP_111107.7

name	Olfr389 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110735422 CCDS:CCDS25015.1 GeneID:259011 MGI:3030223
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3932085-3931147; olfactory receptor MOR135-6 product : olfactory receptor 389 protein_id : NP_667220.2

name	Olfr390 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129604 CCDS:CCDS25016.1 GeneID:258344 MGI:3030224
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-3938806-3939741; olfactory receptor MOR135-26 product : olfactory receptor 390 protein_id : NP_666459.1

name	Olfr392 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128927 CCDS:CCDS25017.1 GeneID:259008 MGI:3030226
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-3966976-3966038; olfactory receptor MOR135-9 product : olfactory receptor 392 protein_id : NP_667217.1

name	Olfr393 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128921 CCDS:CCDS25018.1 GeneID:259010 MGI:3030227
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4004140-4003208; olfactory receptor MOR135-7 product : olfactory receptor 393 protein_id : NP_667219.1

name	Olfr394 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128929 CCDS:CCDS25019.1 GeneID:259009 MGI:3030228
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4043306-4042374; olfactory receptor MOR135-8 product : olfactory receptor 394 protein_id : NP_667218.1

name	Olfr395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128933 CCDS:CCDS25020.1 GeneID:259007 MGI:3030229
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4062605-4061667; olfactory receptor MOR135-10 product : olfactory receptor 395 protein_id : NP_667216.1

name	Olfr23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66472356 GeneID:18321 MGI:109312
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR135-27; GA_x6K02T2P1NL-4097159-4098136 product : olfactory receptor 23 protein_id : NP_035100.1

name	Olfr397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129610 CCDS:CCDS25021.1 GeneID:258343 MGI:3030231
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4121434-4122381; olfactory receptor MOR135-28 product : olfactory receptor 397 protein_id : NP_666458.1

name	Olfr398 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129415 CCDS:CCDS25022.1 GeneID:258705 MGI:3030232
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4141430-4140486; olfactory receptor MOR157-1 product : olfactory receptor 398 protein_id : NP_666921.1

name	Olfr139 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22208856 CCDS:CCDS25023.1 GeneID:259005 MGI:2177522
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4202012-4201065; olfactory receptor MOR255-2 product : olfactory receptor 139 protein_id : NP_667214.1

name	Olfr399 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128931 CCDS:CCDS25024.1 GeneID:259006 MGI:3030233
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-4211516-4210581; olfactory receptor MOR255-1 product : olfactory receptor 399 protein_id : NP_667215.1

name	OTTMUSG00000006163 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94390203 GeneID:327963 MGI:3650906
definition	codon_start : 1 product : similar to novel KRAB box and zinc finger, C2H2 type domain containing protein protein_id : XP_282967.4

name	Olfr401 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129425 CCDS:CCDS25025.1 GeneID:258701 MGI:3030235
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4278037-4278984; olfactory receptor MOR255-6 product : olfactory receptor 401 protein_id : NP_666917.1

name	Olfr402 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129419 CCDS:CCDS25026.1 GeneID:258703 MGI:3030236
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4307199-4308146; olfactory receptor MOR255-4 product : olfactory receptor 402 protein_id : NP_666919.1

name	Olfr403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518540 CCDS:CCDS25027.1 GeneID:404316 MGI:3030237
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0004984 - olfactory receptor activity [Evidence ISS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0007608 - sensory perception of smell [Evidence ISS] codon_start : 1 note : GA_x6K02T2P1NL-4348188-4349129; olfactory receptor 43 product : olfactory receptor 403 protein_id : NP_997505.1

name	Olfr43 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239310 CCDS:CCDS25028.1 GeneID:258706 MGI:1333770
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2P1NL-4359899-4358958; olfactory receptor MOR125-1; olfactory receptor 403 product : olfactory receptor 43 protein_id : NP_666922.1

name	Olfr406 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801482 GeneID:258181 MGI:3030240
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4415162-4416133; olfactory receptor MOR133-1 product : olfactory receptor 406 protein_id : NP_001011863.1

name	Olfr59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828659 CCDS:CCDS25029.1 GeneID:18359 MGI:1333755
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR133-3P; GA_x6K02T2P1NL-4434429-4435400 product : olfactory receptor 59 protein_id : NP_035132.1

name	Olfr410 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129427 CCDS:CCDS25030.1 GeneID:258702 MGI:3030244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4467421-4466474; olfactory receptor MOR255-5 product : olfactory receptor 410 protein_id : NP_666918.1

name	Olfr411 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129421 GeneID:258704 MGI:3030245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2P1NL-4481525-4480578; olfactory receptor MOR255-3; olfactory receptor MOR255-6 product : olfactory receptor 411 protein_id : NP_666920.1

name	Olfr412 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801460 CCDS:CCDS25031.1 GeneID:258153 MGI:3030246
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2P1NL-4500587-4501525; olfactory receptor MOR127-5P product : olfactory receptor 412 protein_id : NP_001011851.1

name	Garnl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71051609 CCDS:CCDS25032.1 GeneID:380711 MGI:3028623
definition	codon_start : 1 product : GTPase activating RANGAP domain-like 4 protein_id : NP_001015046.1

name	E130309D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000658 CCDS:CCDS25033.1 GeneID:432582 MGI:3588240
definition	codon_start : 1 product : hypothetical protein LOC432582 protein_id : NP_001013806.1

name	1300001I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487201 GeneID:74148 MGI:1921398
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74148 protein_id : NP_001074627.1

name	Pafah1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305363 CCDS:CCDS25035.1 GeneID:18472 MGI:109520
definition	EC_number : 3.1.1.47 GO_component : GO:0005813 - centrosome [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IDA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA] GO_function : GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001675 - acrosome formation [Evidence IMP]; GO:0007049 - cell cycle [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0016477 - cell migration [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007067 - mitosis [Evidence IEA]; GO:0007405 - neuroblast proliferation [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP] [Evidence IGI]; GO:0008090 - retrograde axon cargo transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0047496 - vesicle transport along microtubule [Evidence IGI] codon_start : 1 note : platelet-activating factor acetylhydrolase IB alpha subunit; lissencephaly-1 protein product : platelet-activating factor acetylhydrolase, isoform 1b, beta1 subunit protein_id : NP_038653.1

name	Mett10d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312938 CCDS:CCDS25036.1 GeneID:67493 MGI:1914743
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : methyltransferase 10 domain containing protein_id : NP_080473.1

name	Mnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543259 CCDS:CCDS25037.1 GeneID:17428 MGI:109150
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IMP]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007569 - cell aging [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription repressor product : max binding protein protein_id : NP_034943.2

name	Rutbc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956385 GeneID:97761 MGI:2144695
definition	codon_start : 1 product : RUN and TBC1 domain containing 1 protein_id : NP_922934.2

name	Tsr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126506294 GeneID:104662 MGI:2144566
definition	codon_start : 1 product : TSR1, 20S rRNA accumulation protein_id : NP_796299.2

name	Srr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305521 CCDS:CCDS25038.1 GeneID:27364 MGI:1351636
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0030378 - serine racemase activity [Evidence IDA]; GO:0018114 - threonine racemase activity [Evidence IDA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0009069 - serine family amino acid metabolism [Evidence IDA] codon_start : 1 product : serine racemase protein_id : NP_038789.1

name	LOC100042478 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261938 GeneID:100042478
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478333.1

name	Smg6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50582545 CCDS:CCDS25039.1 GeneID:103677 MGI:2144117
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0005697 - telomerase holoenzyme complex [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0042162 - telomeric DNA binding [Evidence ISS] GO_process : GO:0000184 - mRNA catabolism, nonsense-mediated decay [Evidence ISS]; GO:0006406 - mRNA export from nucleus [Evidence ISS]; GO:0035303 - regulation of dephosphorylation [Evidence ISS]; GO:0006445 - regulation of translation [Evidence ISS]; GO:0000723 - telomere maintenance [Evidence ISS] [Evidence IEA] codon_start : 1 product : telomerase subunit EST1A protein_id : NP_001002764.1

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 3 pseudo : _no_value

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 2 pseudo : _no_value

name	Olfr391-ps1 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:258236
definition	number : 1 pseudo : _no_value

name	Olfr75-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872150 GeneID:258186 MGI:2153204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 75, pseudogene 1 pseudo : _no_value transcript_id : NR_002859.1

name	LOC668567 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261932 GeneID:668567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 15 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_033528.1

clone name	MSMg01-407B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-069P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343P07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-475F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410O19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-218A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136F09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-146N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175H18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-081J07.T7 (MSMg01no081_j07.b1)	MSMg01-081J07.TJ (MSMg01no081_j07.g1)
ACC	AG302150	AG302151
length	776	758
length of high quality (start - end)	190 (43 - 232)	---
definition	CHROMAT_FILE: MSMg01no081_j07.b1 PHD_FILE: MSMg01no081_j07.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:30:50 2005	CHROMAT_FILE: MSMg01no081_j07.g1 PHD_FILE: MSMg01no081_j07.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:30:50 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTCTAGAGAGATCCGCGGA ATTCCTTCCTGTATCGGGGACCTCAAACACATACAAGAATTGGTTATCCT CACAATAGTCATTCACCTACTGCACAAAGGGGTACACCTTGCCTAACAGA TAAATAGCATAGTTTCTTGTGTTCACTGCAACATAAAAACGTGACTGTCT TTTCTGCCCCAGTAGGCTATGTAAAACTCTGATAACTATCCAGCAAAGTG AAAGCTTTCCACCCAGTTCCAGCTTGATTCCTCTATGTTACAAAAATAAA GTACATGTTGTCTTCACAATAATACCATCTTATCTAATTATGGTGTGCCT TTATATTATTGATTTCTATCCTGCCTGATCTATAAAACCTCCGACAACTA TCTGATCTAACTCTCTTAAATAAAAACACTACATCCTGAACTGTATATAT TTGTCTAAATACTCTATTAATTCTTAAAACTTATATTTCCCTCGTCATCT TATTGCTATTTTCAATTAAATATATTTTTTTTAACTTTTTTTGTAGTTTG TAATTCATAATATCAACTATTCTATACGTATTTATTCTACCGCCCATTTA CATTATTGTCTAAAAATTTCCCAGTATCCTTCTGTACTTCTACTCCTCCG TACAAAATAATTTTTGTTTTACATTTAAAATTCATCCTCTAAAGTTTTAT TCATATTCTTTTTTCTTCATTTCACAATTCTCCTACGCCTTTAATTGAAC TATATTTATTGTATTATATTATTTAG	TACACGTGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXCTGATCTTTCCAAACTTTTATCATGAAT GGGTGTTGGATCTTGTCAAATGCTTTTTCTGCATCTAACGAGATGATCAT GTGTTTTTTGTCATTGAGTCTGCTTATATAATGGATTACATTGATGGATT CTTGTATATTAAACCATCCCTGCATCCCTGGAATAAAAACTACTTGATCA GGATGCATGATTGTTTTAACGTGTTCCTGGATTCCCTTATCTAAATATAT ACTAAACATTTCCCCCTCTTTTTTCTTTATTATTATTTGTGCTGAACTCC CCCACATTCGCCGCGCCTCCCCGAGTTTCATCTATTTTATTAATATATAT CTTCTTAAAAAAAACTATCTTAACTACCATCCAACATCTCATCCAAAAAA AACATTATAAATATTTTATCATAAAAATCACATTAAATTGTTTTATTTAT CTCTTGCATTTTTACCATACACATCAATGAACCCTTACTAATCCATACTA TTTATATACAAAAAAACCTTCAATACCTCCTAGTTTTATCCGCCAATTTT TTTCTACTTCATATCCTATCCCACACCCCCGCTCTCGCCACTTTTACTCA TGTCCCAATAACCTAAACCATTTCCCCTCTTATCTATCCTATCTATTGAA TTACTTCTATTCATTTCAATACACACACCAACGTATTCACTTCTATAAAA AAACAGCA
quality values	Open. Hide. 6 6 6 6 10 19 29 30 30 30 25 25 22 20 29 28 27 25 25 21 25 18 12 12 10 10 10 18 19 27 11 16 11 8 8 9 7 7 8 8 8 8 22 24 33 28 37 37 33 36 36 36 36 33 48 41 40 32 32 15 22 9 9 9 9 11 16 18 28 28 30 29 29 29 31 31 33 36 33 36 23 23 12 14 14 17 12 22 26 29 37 33 32 32 37 42 43 54 48 48 42 42 41 43 31 32 21 19 14 24 26 29 30 34 34 34 42 57 57 47 44 43 33 33 28 37 37 39 42 37 37 42 42 39 39 44 47 48 59 57 46 43 43 46 41 30 30 22 22 22 50 43 43 42 42 30 30 32 43 43 37 35 35 37 42 44 43 43 28 29 29 42 42 42 39 37 37 32 26 26 37 36 36 38 26 26 26 36 36 13 10 9 9 9 10 10 24 27 30 41 30 36 30 25 25 30 30 37 32 39 32 24 24 17 18 18 31 23 28 26 12 12 12 19 19 30 37 37 43 27 27 12 12 12 23 15 15 26 19 18 18 13 13 14 21 25 14 13 13 13 12 12 12 12 11 18 16 24 19 22 15 14 12 16 11 11 11 12 11 8 8 8 8 12 25 15 13 13 13 18 18 34 34 40 20 17 8 8 8 13 10 10 8 10 15 19 19 12 12 14 14 12 11 8 8 8 8 8 12 12 15 15 19 16 13 11 11 11 13 12 11 13 10 10 10 8 8 6 6 6 8 10 10 10 15 15 14 12 12 15 14 11 11 11 18 13 10 8 8 8 8 8 8 8 8 10 10 9 10 12 10 10 10 10 10 10 13 10 9 9 10 10 10 10 10 10 12 10 11 11 9 8 8 8 8 10 10 10 10 10 8 6 6 6 8 6 8 8 8 8 9 13 8 8 8 8 6 6 8 8 8 9 10 13 14 14 8 8 8 10 9 9 10 10 10 10 11 9 8 8 8 10 10 10 8 8 6 6 8 8 8 8 7 7 10 8 9 11 11 13 12 13 15 12 12 12 13 10 10 8 8 8 8 8 11 8 8 8 8 8 7 8 8 8 8 11 12 9 9 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 10 10 8 8 10 8 8 8 11 12 18 15 10 10 10 16 14 16 15 28 29 19 10 8 8 10 8 8 9 9 13 19 14 15 8 8 9 9 7 8 13 10 10 8 8 6 6 8 8 9 10 8 8 8 8 8 6 6 10 8 10 8 10 8 8 8 8 8 8 8 8 9 9 10 9 12 11 12 8 8 8 8 8 6 6 8 10 10 10 10 10 8 8 8 8 10 10 8 8 8 8 8 8 9 9 9 8 8 8 8 10 10 11 8 8 6 6 7 6 6 8 10 10 8 8 6 6 6 8 8 10 8 8 8 8 8 8 10 10 9 8 8 8 8 8 8 8 10 10 12 9 9 12 17 20 28 15 13 13 9 8 8 8 8 8 10 11 10 10 9 10 10 9 9 8 10 10 12 10 10 12 15 12 11 8 7 9 9 12 11 11 11 13 8 8 8 8 6 6 8 8 9 11 11 16 12 13 11 14 18 9 9 9 8 8 8 9 9 9 9 8 8 8 8 8 8 10 8 8 8 8 6 6 8 8 8 11 8 8 8 8 8 10 8 8 8 8 10 9 9 9 8 8 8 8 6 6 8 8 8 8 8 10 13 10 9 10 9 9	Open. Hide. 10 10 10 9 9 9 8 8 8 8 9 8 14 16 16 21 22 19 18 15 17 17 19 26 34 32 19 8 6 6 7 8 9 9 9 9 9 8 12 8 15 13 13 21 24 24 29 28 35 33 36 37 37 44 37 26 21 17 11 14 13 14 13 15 11 13 10 14 24 26 30 23 36 33 33 33 33 39 39 37 34 28 23 23 34 34 39 43 39 37 36 33 33 30 27 21 21 18 18 15 21 11 8 8 6 6 8 10 8 10 15 19 29 23 23 10 10 12 23 16 17 16 24 29 39 36 33 33 30 21 21 21 21 28 31 29 26 20 20 20 15 15 12 17 15 17 13 12 12 15 14 16 12 12 12 18 20 24 22 12 12 9 9 9 18 18 13 14 14 24 22 15 15 14 21 21 23 10 8 8 8 8 8 8 10 20 20 28 21 22 16 15 10 12 11 11 11 11 10 10 10 10 13 10 11 16 26 27 29 30 30 28 24 24 15 15 15 21 25 30 21 18 11 11 13 21 21 23 21 15 11 11 11 11 13 10 12 10 13 13 12 13 18 18 19 19 10 10 10 10 9 9 9 9 9 9 10 15 16 23 20 18 11 10 10 15 12 9 9 9 9 9 10 10 12 10 10 10 9 10 11 12 19 18 12 11 12 8 8 8 8 8 8 8 7 7 8 10 9 9 12 9 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 8 17 17 25 15 11 11 10 10 10 11 11 8 8 8 8 8 8 13 13 8 8 8 8 8 8 8 6 6 8 8 8 9 9 12 9 9 9 9 12 11 11 9 8 8 8 8 8 8 8 8 9 12 11 11 11 11 11 11 11 12 9 9 11 11 11 11 11 8 8 8 8 13 8 8 8 8 8 8 6 7 8 8 8 8 8 8 8 9 9 9 10 11 10 8 8 9 7 6 6 8 8 11 8 8 6 6 8 6 9 7 8 8 8 8 7 7 8 8 8 8 8 8 8 8 8 10 16 13 10 13 10 10 8 9 9 10 8 10 11 11 12 10 10 9 10 12 8 8 8 8 8 8 6 8 8 8 8 10 8 8 8 9 9 9 9 12 12 8 8 6 6 6 8 8 10 10 11 11 10 8 8 8 8 8 8 8 11 8 8 8 8 8 8 7 6 8 8 8 8 10 8 8 8 8 8 8 10 10 9 9 9 10 8 8 8 8 6 6 8 8 8 9 13 10 9 9 8 8 8 8 8 8 8 14 10 8 8 8 8 8 8 10 10 19 11 8 8 8 10 8 8 8 8 8 9 8 9 9 10 10 10 8 8 8 8 10 8 10 8 8 8 9 8 8 10 8 8 8 11 10 8 8 8 8 8 8 11 10 8 8 9 10 10 10 9 9 9 9 9 9 9 12 18 11 11 11 15 16 10 8 8 6 6 6 6 8 8 10 8 8 6 6 8 8 10 8 8 8 8 8 8 6 6 8 8 8 6 6 8 10 8 9 10 8 8 8 8 8 8 8 8 8 8 11 12 9 9 9 9 9 9 9 13 12 11 10 10 10 10 10 8 8 8 8 8 8 8 8 8 6 6 7 8 10 10 13 15 17 11 10 11 9 9 8 10 10 8 8 8 8 8 8 6 6 8 8 9 10 10 10 10 10 10 10 10 10 8 8 8 8 8 8 10 9 9 9 10 10 8 8 8 9 8 8 8 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no081_j07.b1 MSMg01no081_j07.b1 CHROMAT_FILE:
MSMg01no081_j07.b1 PHD_FILE: MSMg01no081_j07.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:30:50 2005
         (190 letters)



>mm_chr11_73828644_73829233
          Length = 590

 Score =  327 bits (169), Expect = 3e-94
 Identities = 181/185 (97%), Gaps = 2/185 (1%)
 Strand = Plus / Plus

                                                                       
Query: 7   gaattccttcctgtatcggggacctcaaacacatacaagaattggttatcctcacaatag 66
           |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 207 gaattccttcctgtataggggacctcaaacacatagaagaattggttatcctcacaatag 266

                                                                       
Query: 67  tcattcacctactgcacaaaggggtacaccttgcctaacagataaatagcatagtttctt 126
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 267 tcattcacctactgcacaaaggggtacaccttgcctaacagataaatagcatagtttctt 326

                                                                       
Query: 127 gtgttcactgcaacataaaaacgtga-ctgtcttttctgccccagtaggctatgtaaaac 185
           |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||
Sbjct: 327 gtgttcactgcaacataaaaacgt-agctgtcttttctgccccagtaggctatgtaaaac 385

                
Query: 186 tctga 190
           |||||
Sbjct: 386 tctga 390


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 9
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 190
Length of database: 590
Length adjustment: 8
Effective length of query: 182
Effective length of database: 582
Effective search space:   105924
Effective search space used:   105924
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information