MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-215D11
Chromosome	11 (Build37)
Map Location	77,072,594 - 77,072,880
singlet/doublet	singlet
Overlap gene	Ssh2
Upstream gene	Nxn, Timm22, Abr, LOC100043483, A830053O21Rik, Tusc5, Gosr1, Cpd, Tmigd1, Blmh, Slc6a4, Ccdc55, Efcab5, LOC628108
Downstream gene	LOC544800, Coro6, Ankrd13b, 2210008F06Rik, Git1, Trp53i13, 1300007F04Rik, Taok1, LOC668641, Nufip2, Cryba1, LOC100043506, Myo18a, Pipox, Sez6, LOC100043518, Phf12, Dhrs13, Flot2, Eral1, BC017647, LOC100043525, Traf4, Nek8, Tlcd1, Rpl23a, Rab34, 4933404M19Rik, Supt6h, Sdf2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nxn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18230 MGI:109331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56322 MGI:1929742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109934 MGI:107771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100043483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 310 ESTs, 7 Proteins pseudo : _no_value

name	A830053O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320522 MGI:2444198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tusc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237858 MGI:3029307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gosr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53334 MGI:1858260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12874 MGI:107265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmigd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66601 MGI:1913851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blmh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104184 MGI:1345186
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15567 MGI:96285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc55 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237859 MGI:2144305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcab5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319634 MGI:2442440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628108 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 153 ESTs, 10 Proteins pseudo : _no_value

name	Ssh2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237860 MGI:2679255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC544800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544800
definition	note : heat shock protein 1, alpha pseudogene pseudo : _no_value

name	Coro6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ankrd13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268445 MGI:2144501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210008F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70057 MGI:1917307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Git1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216963 MGI:1927140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53i13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216964 MGI:1915125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1300007F04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67477 MGI:1914727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taok1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216965 MGI:1914490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Nufip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68564 MGI:1915814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cryba1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12957 MGI:88518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043506 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 97 ESTs, 2 Proteins pseudo : _no_value

name	Myo18a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360013 MGI:2667185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pipox (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19193 MGI:1197006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sez6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20370 MGI:104745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043518 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs

name	Phf12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268448 MGI:1924057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhrs13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70451 MGI:1917701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flot2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14252 MGI:103309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eral1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57837 MGI:1889295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC017647 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216971 MGI:2384939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043525 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins

name	Traf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22032 MGI:1202880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140859 MGI:1890646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68385 MGI:1915572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl23a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268449 MGI:3040672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19376 MGI:104606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933404M19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216974 MGI:1918274
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt6h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20926 MGI:107726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20316 MGI:108019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385508 GeneID:18230 MGI:109331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoredoxin transcript_id : NM_008750.4

name	Timm22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802246 GeneID:56322 MGI:1929742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 22 homolog (yeast) transcript_id : NM_019818.3

name	Abr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38683819 GeneID:109934 MGI:107771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : active BCR-related gene transcript_id : NM_198894.1

name	Abr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38683821 GeneID:109934 MGI:107771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : active BCR-related gene transcript_id : NM_198895.1

name	Abr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574112 GeneID:109934 MGI:107771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : active BCR-related gene transcript_id : NM_198018.1

name	A830053O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254309 GeneID:320522 MGI:2444198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830053O21 gene transcript_id : NM_177182.3

name	Tusc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343238 GeneID:237858 MGI:3029307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor suppressor candidate 5 transcript_id : NM_177709.2

name	Gosr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131190 GeneID:53334 MGI:1858260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi SNAP receptor complex member 1 transcript_id : NM_016810.3

name	Cpd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681000 GeneID:12874 MGI:107265
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase D transcript_id : NM_007754.1

name	Tmigd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802619 GeneID:66601 MGI:1913851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and immunoglobulin domain containing 1 transcript_id : NM_025655.2

name	Blmh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801815 GeneID:104184 MGI:1345186
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bleomycin hydrolase transcript_id : NM_178645.2

name	Slc6a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7110638 GeneID:15567 MGI:96285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 transcript_id : NM_010484.1

name	Ccdc55 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858548 GeneID:237859 MGI:2144305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 55 transcript_id : NM_001012309.1

name	Efcab5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118026914 GeneID:319634 MGI:2442440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand calcium binding domain 5 transcript_id : NM_176965.3

name	Ssh2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674237 GeneID:237860 MGI:2679255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : slingshot homolog 2 (Drosophila) transcript_id : NM_177710.3

name	Coro6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281696 GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 6 transcript_id : NM_139128.1

name	Coro6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129989 GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 6 transcript_id : NM_139130.2

name	Coro6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281699 GeneID:216961 MGI:2183448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 6 transcript_id : NM_139129.1

name	Ankrd13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117956382 GeneID:268445 MGI:2144501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 13b transcript_id : NM_172945.2

name	2210008F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261945 GeneID:70057 MGI:1917307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2210008F06 gene transcript_id : XM_001002792.2

name	Git1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921284 GeneID:216963 MGI:1927140
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase-interactor 1 transcript_id : NM_001004144.1

name	Trp53i13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906196 GeneID:216964 MGI:1915125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 inducible protein 13 transcript_id : NM_001024920.1

name	1300007F04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802026 GeneID:67477 MGI:1914727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1300007F04 gene transcript_id : NM_026185.3

name	Taok1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358958 GeneID:216965 MGI:1914490
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAO kinase 1 transcript_id : NM_144825.2

name	Nufip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66730552 GeneID:68564 MGI:1915814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear fragile X mental retardation protein interacting protein 2 transcript_id : NM_001024205.1

name	Cryba1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802703 GeneID:12957 MGI:88518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : crystallin, beta A1 transcript_id : NM_009965.2

name	Myo18a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130118 GeneID:360013 MGI:2667185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin XVIIIa transcript_id : NM_011586.2

name	Pipox (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679506 GeneID:19193 MGI:1197006
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pipecolic acid oxidase transcript_id : NM_008952.1

name	Sez6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130194 GeneID:20370 MGI:104745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seizure related gene 6 transcript_id : NM_021286.3

name	LOC100043518 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261997 GeneID:100043518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : hypothetical protein LOC100043518 transcript_id : XM_001480841.1

name	Phf12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842821 GeneID:268448 MGI:1924057
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 12 transcript_id : NM_174852.2

name	Dhrs13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647266 GeneID:70451 MGI:1917701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dehydrogenase/reductase (SDR family) member 13 transcript_id : NM_183286.2

name	Flot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94536789 GeneID:14252 MGI:103309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flotillin 2 transcript_id : NM_008028.2

name	Flot2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94536790 GeneID:14252 MGI:103309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : flotillin 2 transcript_id : NM_001040403.1

name	Eral1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612490 GeneID:57837 MGI:1889295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Era (G-protein)-like 1 (E. coli) transcript_id : NM_022313.1

name	BC017647 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703857 GeneID:216971 MGI:2384939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC017647 transcript_id : NM_145430.1

name	LOC100043525 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261999 GeneID:100043525
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins product : similar to Lsm6 protein transcript_id : XM_001480855.1

name	Traf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803144 GeneID:22032 MGI:1202880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tnf receptor associated factor 4 transcript_id : NM_009423.3

name	Nek8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32307137 GeneID:140859 MGI:1890646
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 8 transcript_id : NM_080849.2

name	Tlcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539616 GeneID:68385 MGI:1915572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TLC domain containing 1 transcript_id : NM_026708.1

name	Rpl23a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430507 GeneID:268449 MGI:3040672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L23a transcript_id : NM_207523.1

name	Rab34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560773 GeneID:19376 MGI:104606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB34, member of RAS oncogene family transcript_id : NM_033475.2

name	4933404M19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139947886 GeneID:216974 MGI:1918274
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933404M19 gene transcript_id : NM_001045516.2

name	Supt6h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678182 GeneID:20926 MGI:107726
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 6 homolog (S. cerevisiae) transcript_id : NM_009297.1

name	Sdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254616 GeneID:20316 MGI:108019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal cell derived factor 2 transcript_id : NM_009143.2

name	Nxn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679160 CCDS:CCDS25064.1 GeneID:18230 MGI:109331
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA]; GO:0004791 - thioredoxin-disulfide reductase activity [Evidence IDA] codon_start : 1 product : nucleoredoxin protein_id : NP_032776.1

name	Timm22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543865 CCDS:CCDS25065.1 GeneID:56322 MGI:1929742
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : preprotein translocase product : translocase of inner mitochondrial membrane 22 homolog protein_id : NP_062792.2

name	Abr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38683822 CCDS:CCDS25066.1 GeneID:109934 MGI:107771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : active BCR-related isoform 3 protein_id : NP_942598.1

name	Abr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574113 GeneID:109934 MGI:107771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : active BCR-related isoform 1 protein_id : NP_932135.1

name	Abr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38683820 CCDS:CCDS25067.1 GeneID:109934 MGI:107771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : active BCR-related isoform 2 protein_id : NP_942597.1

name	A830053O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254310 CCDS:CCDS25068.1 GeneID:320522 MGI:2444198
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : novel helix-loop-helix DNA-binding domain containing protein product : hypothetical protein LOC320522 protein_id : NP_796156.2

name	Tusc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244170 CCDS:CCDS25069.1 GeneID:237858 MGI:3029307
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 product : tumor suppressor candidate 5 protein_id : NP_808377.1

name	Gosr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542904 CCDS:CCDS25070.1 GeneID:53334 MGI:1858260
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence ISS] [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Cis-Golgi SNARE product : golgi SNAP receptor complex member 1 protein_id : NP_058090.2

name	Cpd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681001 CCDS:CCDS25071.1 GeneID:12874 MGI:107265
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008472 - metallocarboxypeptidase D activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0009045 - xylose isomerase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : carboxypeptidase D protein_id : NP_031780.1

name	Tmigd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385118 CCDS:CCDS25072.1 GeneID:66601 MGI:1913851
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane and immunoglobulin domain containing protein_id : NP_079931.1

name	Blmh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519997 CCDS:CCDS25073.1 GeneID:104184 MGI:1345186
definition	GO_component : GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0008423 - bleomycin hydrolase activity [Evidence IMP]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0042493 - response to drug [Evidence IMP]; GO:0009636 - response to toxin [Evidence IMP] codon_start : 1 note : BLM hydrolase product : bleomycin hydrolase protein_id : NP_848760.1

name	Slc6a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110639 CCDS:CCDS25074.1 GeneID:15567 MGI:96285
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008504 - monoamine transporter activity [Evidence ISS]; GO:0005328 - neurotransmitter:sodium symporter activity [Evidence IEA]; GO:0005335 - serotonin:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015844 - monoamine transport [Evidence ISS]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 5-hydroxytryptamine (serotonin) transporter product : solute carrier family 6 member 4 protein_id : NP_034614.1

name	Ccdc55 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858549 CCDS:CCDS25075.1 GeneID:237859 MGI:2144305
definition	codon_start : 1 product : coiled-coil domain containing 55 protein_id : NP_001012309.1

name	Efcab5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118026915 GeneID:319634 MGI:2442440
definition	codon_start : 1 product : EF-hand calcium binding domain 5 protein_id : NP_795939.2

name	Ssh2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674238 CCDS:CCDS25076.1 GeneID:237860 MGI:2679255
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : slingshot 2L product : slingshot-like 2 protein_id : NP_808378.2

name	Coro6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281697 CCDS:CCDS25077.1 GeneID:216961 MGI:2183448
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform A is encoded by transcript variant A; coronin 6; clipin E; coronin 6/clipin E type D product : coronin, actin binding protein 6 isoform A protein_id : NP_624354.1

name	Coro6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281703 CCDS:CCDS25079.1 GeneID:216961 MGI:2183448
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform B is encoded by transcript variant B; coronin 6; clipin E; coronin 6/clipin E type D product : coronin, actin binding protein 6 isoform B protein_id : NP_624356.1

name	Coro6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281700 CCDS:CCDS25078.1 GeneID:216961 MGI:2183448
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform C is encoded by transcript variant C; coronin 6; clipin E; coronin 6/clipin E type D product : coronin, actin binding protein 6 isoform C protein_id : NP_624355.1

name	Ankrd13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117956383 GeneID:268445 MGI:2144501
definition	codon_start : 1 product : ankyrin repeat domain 13b protein_id : NP_766533.2

name	2210008F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261946 GeneID:70057 MGI:1917307
definition	codon_start : 1 product : hypothetical protein LOC70057 protein_id : XP_001002792.2

name	Git1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921285 CCDS:CCDS25080.1 GeneID:216963 MGI:1927140
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : G protein-coupled receptor kinase-associated ADP ribosylation factor GTPase-activating protein product : G protein-coupled receptor kinase-interactor 1 protein_id : NP_001004144.1

name	Trp53i13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906197 CCDS:CCDS25081.1 GeneID:216964 MGI:1915125
definition	codon_start : 1 product : tumor protein p53 inducible protein 13 protein_id : NP_001020091.1

name	1300007F04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625747 GeneID:67477 MGI:1914727
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67477 protein_id : NP_080461.2

name	Taok1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358959 GeneID:216965 MGI:1914490
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : TAO kinase 1 protein_id : NP_659074.2

name	Nufip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66730553 CCDS:CCDS25083.1 GeneID:68564 MGI:1915814
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0042788 - polysomal ribosome [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence ISS] codon_start : 1 note : proliferation-inducing gene 1 product : 82-kD FMRP Interacting Protein protein_id : NP_001019376.1

name	Cryba1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20304089 CCDS:CCDS25084.1 GeneID:12957 MGI:88518
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0005212 - structural constituent of eye lens [Evidence TAS] GO_process : GO:0007423 - sensory organ development [Evidence IEA] codon_start : 1 function : lens structural protein note : beta-A3/A1-crystallin product : crystallin, beta A1 protein_id : NP_034095.1

name	Myo18a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094119 CCDS:CCDS25085.1 GeneID:360013 MGI:2667185
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IDA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : myosin containing PDZ domain; myosin XVIIIb product : myosin XVIIIa protein_id : NP_035716.1

name	Pipox (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679507 CCDS:CCDS25086.1 GeneID:19193 MGI:1197006
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0050031 - L-pipecolate oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008115 - sarcosine oxidase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0007031 - peroxisome organization and biogenesis [Evidence IEA]; GO:0046653 - tetrahydrofolate metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation function : catalyses CH(3)NHCH(2)COOH + H(2)O + O(2) = NH(2)CH(2)COOH + CH(2)O + H(2)O(2) note : peroxisomal sarcosine oxidase product : pipecolic acid oxidase protein_id : NP_032978.1

name	Sez6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981500 CCDS:CCDS25087.1 GeneID:20370 MGI:104745
definition	codon_start : 1 product : seizure related gene 6 protein_id : NP_067261.2

name	LOC100043518 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261998 GeneID:100043518
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480891.1

name	Phf12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424679 GeneID:268448 MGI:1924057
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0017053 - transcriptional repressor complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD zinc finger transcription factor protein_id : NP_777277.1

name	Dhrs13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647267 GeneID:70451 MGI:1917701
definition	codon_start : 1 product : dehydrogenase/reductase (SDR family) member 13 protein_id : NP_899109.2

name	Flot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94536791 GeneID:14252 MGI:103309
definition	GO_component : GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : flotillin 2 isoform 1 protein_id : NP_001035493.1

name	Flot2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679811 CCDS:CCDS25088.1 GeneID:14252 MGI:103309
definition	GO_component : GO:0045121 - lipid raft [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : flotillin 2 isoform 2 protein_id : NP_032054.1

name	Eral1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612491 GeneID:57837 MGI:1889295
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : ERA-like GTPase; ERA-like protein 1 product : Era (G-protein)-like 1 protein_id : NP_071708.1

name	BC017647 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703858 CCDS:CCDS25089.1 GeneID:216971 MGI:2384939
definition	codon_start : 1 product : hypothetical protein LOC216971 protein_id : NP_663405.1

name	LOC100043525 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262000 GeneID:100043525
definition	codon_start : 1 product : similar to Lsm6 protein protein_id : XP_001480905.1

name	Traf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543889 CCDS:CCDS25090.1 GeneID:22032 MGI:1202880
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0030323 - respiratory tube development [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Tnf receptor associated factor 4 protein_id : NP_033449.2

name	Nek8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19263332 CCDS:CCDS25091.1 GeneID:140859 MGI:1890646
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : juvenile cystic kidney; NIMA-related expressed kinase 8 product : NIMA (never in mitosis gene a)-related expressed kinase 8 protein_id : NP_543125.1

name	Tlcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539617 CCDS:CCDS25092.1 GeneID:68385 MGI:1915572
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : TLC domain containing 1 protein_id : NP_080984.1

name	Rpl23a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430508 CCDS:CCDS25093.1 GeneID:268449 MGI:3040672
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : 60S ribosomal protein L23a; snoRNA MBII-287; snoRNA MBII-292 product : ribosomal protein L23a protein_id : NP_997406.1

name	Rab34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560774 CCDS:CCDS25094.1 GeneID:19376 MGI:104606
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IDA]; GO:0019001 - guanyl nucleotide binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IDA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB34, member of RAS oncogene family protein_id : NP_258436.2

name	4933404M19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139947887 GeneID:216974 MGI:1918274
definition	codon_start : 1 product : hypothetical protein LOC216974 protein_id : NP_001038981.2

name	Supt6h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678183 CCDS:CCDS25095.1 GeneID:20926 MGI:107726
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : suppressor of Ty 6 homolog protein_id : NP_033323.1

name	Sdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254617 CCDS:CCDS25096.1 GeneID:20316 MGI:108019
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : stromal cell derived factor 2 protein_id : NP_033169.2

name	LOC668641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668641
definition	number : 1 pseudo : _no_value

name	LOC100043483 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261994 GeneID:100043483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 310 ESTs, 7 Proteins product : similar to Rpl36 protein pseudo : _no_value transcript_id : XR_034836.1

name	LOC628108 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261995 GeneID:628108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 153 ESTs, 10 Proteins product : similar to vacuolar H+ ATPase G1 pseudo : _no_value transcript_id : XR_034847.1

name	LOC100043506 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261996 GeneID:100043506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 97 ESTs, 2 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_034860.1

clone name	MSMg01-369D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-362E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-156F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-368O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-215D11.T7 (MSMg01no215_d11.b1)	MSMg01-215D11.TJ (MSMg01no215_d11.g1)
ACC	AG395544	AG395545
length	750	816
length of high quality (start - end)	139 (113 - 251)	289 (132 - 420)
definition	CHROMAT_FILE: MSMg01no215_d11.b1 PHD_FILE: MSMg01no215_d11.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:41:48 2005	CHROMAT_FILE: MSMg01no215_d11.g1 PHD_FILE: MSMg01no215_d11.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:41:49 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GGCGCTAATACGACTACTATAGTGCGNGAGCCGCGGAANNCNAGAGATTT TACAATAATGTTCGTCACTCCAAAGAAAGGGAAGGGNGAAAAAAGATTAT TTCTACCATACAGTTATCAAGNATGAAGACTTATTTCCTAATAATCTTAG GCATCTAAAATAATTATAAACACAAGCTCATGGTGATTCTCCTGCCTCAG TCTCCCCAGTTATAACTGTGATTATAATTGTGATTCACCATGCTTAGATC CATAAATAATTTCAAAAATGAAAGGAGCACTGTAAAAGCAGAAAACAATA TTTTTTTTTTTTAGCACCAAGCCTGCCTGAAGGCAGCAAAGCTTTTTTTT TTATTCCCCCCTCCCCCTCTGAAATTGTAAGCAAGATTAATTAAATGCTT CACATTACCATAAAAGAAAAAGAAACAAGGTGCCCCTTCATAGTTACGAT ACCTCTAATAATACAGAAATTGTAACCACCAGTTGGTCATTGATGTGCTA GATCTGACCATGGATTATGTTTGCTAGCATGTTTGATTCGCTTGATGAGA TCAATGCATAACCTTTATTTCAAAACATAAAAAAAATTTGATATACATTG TTTGTTATTCTTCCTGTTAAAAGTAACCCGATATATTATTTATATATTTT TTTTTTAAATAATGATCTTCTTAACTATTATGTTATAATATATACCCTTC AGTACTTATTTGTTTTAATATTTAACAAACTGTGATTGTGATGATATTAA	TTTTTTTCTCTTCTTTTTTNNNNNGATTTTTCCTCTTATTAAAATTAATT ATTTATCTATGCTATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXAGATGTTAATATCCCACTT ACAACTGGTAGAGATTGAGGTATTCACAGTCCAAGTAAAGTTTGCCCCTA GCTTTTGGGACTACAAAACTTAAAAGCATATTCTCTTATAGCCATTTATA GGCAATCCCTTTTCATGACTGTGTTGAATAAAGATATATTGACTTACCTA CAGTACTGCTTTCTGATTCATTTCATTTCAAAGAGTAAATCAGAAACTAT ATCTTCCTTGATTATTTAATCAAAAATACAAAATGAAACAAAATACAACT TCTACCTCTCAGATTAGCTTTGATAATAGTGACCCTCCCCCCCCCTAACT GAGAATATAAAGTAACATCTTCCTGTAAACCAATAAAACATAACAACAAA TCTTAAAGAGATGCGTTTTATATTGGCTAGGTATATTCCAGAATTTAAAG AAATACTCTGAGATGTTCATAAAGATTTATAGACAAGTTATTCTATTCAG AATAATATATATTACACATGTATGGAGAGAAATTATATACCCAAGAGAGA TTAGAGCCCATCTAATATCCAAGGTAAAGTGAAAAGTTAAATTACTAAAG CACTTCTAAAATTAATTTATTTCGAAAGAATAAAGGGAAAAAATTCTTGT TGTCCAAGAAACTTTTTTTAAAATATAAAAAAATACCTTTAATTGTAATT GAAACTTTACATAATT
quality values	Open. Hide. 12 15 16 20 17 28 24 24 16 16 11 18 10 10 9 9 9 19 23 9 9 9 9 9 9 3 0 3 11 10 9 9 9 9 7 15 8 3 0 0 3 0 3 27 19 19 12 9 11 10 9 9 9 9 7 6 7 7 6 6 6 12 9 11 11 22 25 33 31 30 29 15 13 7 7 7 17 18 15 9 9 6 15 7 7 3 0 3 23 21 29 30 31 28 28 21 19 9 9 12 16 9 9 9 6 6 6 6 6 10 13 23 23 23 23 31 28 30 18 18 3 0 3 25 25 37 30 30 30 32 37 39 48 47 47 43 43 40 40 43 47 47 47 43 43 39 42 42 39 43 28 23 23 26 36 24 40 19 19 10 8 8 12 19 30 37 43 47 37 43 41 39 35 35 32 37 32 35 39 39 37 39 39 39 39 41 42 42 47 40 42 24 24 14 28 28 39 42 32 34 23 23 32 32 37 39 37 37 28 28 28 37 37 34 31 23 22 16 15 15 19 18 20 27 28 28 28 17 11 15 8 8 8 10 12 12 11 12 23 30 37 39 43 31 31 20 20 15 26 23 25 22 18 21 21 12 16 21 31 31 20 19 19 15 14 10 15 16 15 19 9 9 13 18 27 24 12 11 11 19 24 13 13 11 11 13 21 28 15 14 14 28 28 39 41 41 30 32 15 16 11 13 17 26 29 31 16 16 14 11 13 21 22 25 25 26 28 23 10 10 8 8 8 13 13 18 10 13 9 9 9 8 8 8 8 8 8 9 10 10 10 10 9 12 12 11 11 20 25 17 17 8 8 8 8 8 8 8 8 8 8 10 9 9 9 9 10 13 13 15 15 13 16 15 13 9 9 9 10 10 13 11 11 9 6 10 8 8 8 8 8 12 14 17 19 10 10 8 10 10 10 10 10 13 8 8 6 6 8 8 8 8 12 10 11 9 9 11 10 18 11 11 11 17 10 10 8 8 8 8 10 11 12 12 15 14 12 11 12 9 10 10 10 10 12 12 9 9 8 10 10 12 10 9 9 8 10 10 12 12 11 8 8 8 8 8 9 13 9 9 10 9 10 10 10 11 11 11 12 12 11 11 11 11 8 8 8 8 9 10 19 10 10 10 10 10 10 10 10 10 11 10 9 9 13 12 9 10 10 10 10 9 9 10 16 10 11 13 12 10 8 10 8 8 9 10 8 8 8 8 8 8 8 8 11 10 11 11 10 10 10 10 13 10 10 10 10 12 13 11 11 11 11 12 10 10 9 8 8 8 8 8 8 8 10 10 10 8 8 8 8 8 11 8 8 6 7 8 8 11 13 11 13 12 13 10 10 10 10 10 10 10 8 8 8 8 8 10 8 8 9 9 10 10 10 10 12 12 11 11 11 10 8 8 6 6 8 8 12 12 11 9 9 8 8 6 6 8 8 8 8 9 9 9 10 8 9 9 9 12 10 8 8 8 8 9 12 15 18 11 10 9 9 9 9 9 9 10 15 12 12 8 6 6 6 6 8 6 8 10 8 8 10 8 9 9 9 9 6 8 6 6 6 7 12 6 9 10 11 18 10 8 8 11 8 8 8 8 8 8 6 6 6 6 8 8 9 9 14 18 15 17 17 19 15 14 12 14 11 10 8 8 8 8 6 6 8 8 10 9 7 8 8 8 8 10 11 11 8 8 8 8 8 8 8 8 8 6 6 6	Open. Hide. 12 14 16 16 10 10 6 6 6 6 6 6 8 8 10 8 13 9 3 0 0 0 0 0 3 6 6 10 8 10 10 10 10 9 9 8 19 8 8 8 13 8 8 8 8 8 8 13 15 14 11 10 9 10 8 8 6 6 6 8 8 8 8 8 8 7 7 9 13 10 13 19 19 39 39 37 36 36 36 33 33 31 31 25 28 30 30 26 19 16 16 15 9 9 10 12 13 30 28 25 13 13 13 19 24 28 30 28 42 47 47 43 37 30 28 23 19 17 24 24 33 37 43 42 36 15 15 15 15 14 22 27 47 47 50 50 50 42 41 41 41 42 42 53 68 68 68 68 68 54 54 50 50 48 48 48 34 29 20 20 20 19 24 15 24 24 28 32 36 35 33 33 32 29 28 30 21 23 11 11 11 11 12 12 19 26 33 35 39 39 39 39 37 35 36 43 43 43 43 36 36 39 43 59 59 59 47 42 35 35 42 43 43 54 54 54 54 54 54 54 48 48 48 48 48 48 57 57 57 57 57 68 68 68 68 68 57 59 57 48 48 44 44 44 44 54 57 57 57 44 44 43 46 57 57 57 57 57 59 59 57 57 57 54 54 48 57 57 57 57 57 59 46 46 43 44 44 57 57 57 57 57 54 54 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 57 59 59 59 57 54 54 57 57 57 57 57 57 68 57 57 57 57 57 57 57 57 57 57 57 57 48 48 46 43 46 46 43 43 43 39 39 32 28 20 20 24 32 40 57 57 57 57 57 57 48 48 48 59 48 48 42 47 39 39 36 36 39 39 34 43 37 43 39 59 40 47 29 30 17 17 11 11 11 12 15 27 30 41 41 41 43 43 48 48 59 59 59 48 48 48 48 48 50 50 50 50 50 50 57 50 48 48 48 40 37 34 23 16 10 10 10 10 9 7 7 7 7 7 9 9 9 9 10 10 10 10 9 9 11 17 12 19 18 11 9 8 11 11 11 18 28 34 36 28 21 14 19 19 29 29 39 39 48 47 47 47 42 42 42 57 59 59 59 48 43 34 19 16 10 10 10 18 17 19 17 17 21 21 19 11 10 10 10 10 10 15 17 25 27 39 41 41 47 46 43 28 26 12 12 11 19 21 22 21 11 11 11 19 17 25 28 30 37 37 37 37 33 32 35 35 39 39 37 33 37 32 32 36 37 34 30 28 17 14 14 16 22 28 21 20 23 23 25 21 19 15 12 10 13 10 10 11 11 17 17 31 25 24 33 22 19 12 10 10 10 14 14 28 31 33 29 28 13 13 9 9 9 13 12 12 12 25 30 33 33 19 15 8 8 8 10 8 13 15 10 8 8 10 14 10 9 10 13 9 9 8 8 8 8 12 11 11 10 10 10 8 14 13 13 13 26 22 27 17 12 11 11 14 14 15 19 17 19 24 15 12 11 11 12 10 13 10 15 11 8 10 11 11 11 13 12 20 9 8 8 8 8 13 10 10 9 9 9 15 11 9 8 8 10 8 8 8 8 8 10 14 16 12 10 10 10 16 16 21 21 10 10 10 10 10 12 11 11 11 8 8 8 8 8 8 16 15 15 24 13 13 12 13 10 10 11 8 11 8 8 8 10 8 8 8 10 15 15 13 12 10 8 8 8 8 8 13 9 11 11 11 13 28 19 21 10 10 10 10 8 6 6 6 6 8 10 10 9 9 9 9 14 15 20 18 17 17 7 7 6 6 6 10 16 17 18 11 11 12 12 12 12 14 10 10 19 10 12 12 10 10 8 8 8 8 10 11 13 8 8 8 8 15 15 14 19 8 8 8 9 10 10 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no215_d11.g1 MSMg01no215_d11.g1 CHROMAT_FILE:
MSMg01no215_d11.g1 PHD_FILE: MSMg01no215_d11.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:41:49 2005
         (289 letters)



>mm_chr11_77072394_77073082
          Length = 689

 Score =  516 bits (267), Expect = e-151
 Identities = 282/287 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   agatgttaatatcccacttacaactggtagagattgaggtattcacagtccaagtaaagt 60
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 487 agatgttaatatcccacttacaactggtagagattgaggtattcacagtacaagtaaagt 428

                                                                       
Query: 61  ttgcccctagcttttgggactacaaaacttaaaagcatattctcttatagccatttatag 120
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 427 ttgcccctagcttttgggactgcaaaacttaaaagcatattctcttatagccatttatag 368

                                                                       
Query: 121 gcaatcccttttcatgactgtgttgaataaagatatattgacttacctacagtactgctt 180
           |||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 367 gcaatcccttttcatgcctgtgttgaataaagatatattgacctacctacagtactgctt 308

                                                                       
Query: 181 tctgattcatttcatttcaaagagtaaatcagaaactatatcttccttgattatttaatc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 307 tctgattcatttcatttcaaagagtaaatcagaaactatatcttccttgattatttaatc 248

                                                          
Query: 241 aaaaatacaaaatgaaacaaaatacaacttctacctctcagattagc 287
           ||||||||||||||||||||||||||||||||| |||||||||||||
Sbjct: 247 aaaaatacaaaatgaaacaaaatacaacttctatctctcagattagc 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 289
Length of database: 689
Length adjustment: 9
Effective length of query: 280
Effective length of database: 680
Effective search space:   190400
Effective search space used:   190400
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information