MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-419I02
Chromosome	11 (Build37)
Map Location	82,717,297 - 82,717,814
singlet/doublet	singlet
Overlap gene	Nle1
Upstream gene	Accn1, Ccl2, Ccl7, Ccl11, Ccl12, Ccl8, Ccl1, Tmem132e, Cct6b, Ccdc16, Lig3, Rffl, Rad51l3, Fndc8
Downstream gene	Unc45b, Slfn5, Set8-ps, Slfn9, Slfn8, LOC668706, Slfn10, Slfn2, Slfn1, Slfn4, Slfn3, LOC100043636, LOC435271, Slfn14, Pex12, Ap2b1, Rasl10b, OTTMUSG00000000934, 1700020L24Rik, Mmp28, Taf15, OTTMUSG00000000990, Ccl5, Ccl9, Ccl6, LOC194905, Ccl3, Ccl4, OTTMUSG00000000971, Expi, 1100001G20Rik, 2700008B19Rik, LOC676191, Tcf2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Accn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11418 MGI:1100867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ccl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20296 MGI:98259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20306 MGI:99512
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20292 MGI:103576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20293 MGI:108224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20307 MGI:101878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20290 MGI:98258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem132e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270893 MGI:2685490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cct6b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12467 MGI:1329013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66983 MGI:1914233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lig3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16882 MGI:109152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rffl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67338 MGI:1914588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rad51l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19364 MGI:1261809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fndc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78919 MGI:1926169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nle1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217011 MGI:2429770
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc45b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217012 MGI:2443377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:327978 MGI:1329004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Set8-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435270
definition	note : SET domain-containing protein 8 pseudogene pseudo : _no_value

name	Slfn9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237886 MGI:2445121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276950 MGI:2672859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 668 ESTs, 9 Proteins

name	Slfn10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237887 MGI:3512288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20556 MGI:1313258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20555 MGI:1313259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20558 MGI:1329010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slfn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20557 MGI:1329005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs

name	LOC435271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins

name	Slfn14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237890 MGI:2684866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins

name	Pex12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103737 MGI:2144177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71770 MGI:1919020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rasl10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:276952 MGI:2685575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000934 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237891 MGI:3652048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66330 MGI:1913580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:118453 MGI:2153062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Taf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70439 MGI:1917689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000990 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629303 MGI:3650286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20304 MGI:98262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20308 MGI:104533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20305 MGI:98263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC194905 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194905
definition	note : ribosomal protein L9 pseudogene pseudo : _no_value

name	Ccl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20302 MGI:98260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20303 MGI:98261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000971 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100034251 MGI:3649773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Expi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14038 MGI:107506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001G20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66107 MGI:1913357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700008B19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217026 MGI:1919790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Tcf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21410 MGI:98505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Accn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074519 GeneID:11418 MGI:1100867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amiloride-sensitive cation channel 1, neuronal (degenerin) transcript_id : NM_001034013.2

name	Ccl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803162 GeneID:20296 MGI:98259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 2 transcript_id : NM_011333.3

name	Ccl7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476054 GeneID:20306 MGI:99512
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 7 transcript_id : NM_013654.2

name	Ccl11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802451 GeneID:20292 MGI:103576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small chemokine (C-C motif) ligand 11 transcript_id : NM_011330.2

name	Ccl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226205 GeneID:20293 MGI:108224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 12 transcript_id : NM_011331.2

name	Ccl8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803310 GeneID:20307 MGI:101878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 8 transcript_id : NM_021443.2

name	Ccl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387472 GeneID:20290 MGI:98258
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 1 transcript_id : NM_011329.2

name	Tmem132e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254490 GeneID:270893 MGI:2685490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 132E transcript_id : NM_023438.2

name	Cct6b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753325 GeneID:12467 MGI:1329013
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chaperonin subunit 6b (zeta) transcript_id : NM_009839.1

name	Ccdc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360645 GeneID:66983 MGI:1914233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 16 transcript_id : NM_025884.4

name	Lig3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71061469 GeneID:16882 MGI:109152
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligase III, DNA, ATP-dependent transcript_id : NM_010716.2

name	Rffl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922699 GeneID:67338 MGI:1914588
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger and FYVE like domain containing protein transcript_id : NM_001007465.2

name	Rffl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16975487 GeneID:67338 MGI:1914588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger and FYVE like domain containing protein transcript_id : NM_026097.1

name	Rad51l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:127139188 GeneID:19364 MGI:1261809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD51-like 3 (S. cerevisiae) transcript_id : NM_011235.3

name	Fndc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931163 GeneID:78919 MGI:1926169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibronectin type III domain containing 8 transcript_id : NM_030224.1

name	Nle1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703859 GeneID:217011 MGI:2429770
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : notchless homolog 1 (Drosophila) transcript_id : NM_145431.1

name	Unc45b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54607168 GeneID:217012 MGI:2443377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-45 homolog B (C. elegans) transcript_id : NM_178680.3

name	Slfn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801697 GeneID:327978 MGI:1329004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 5 transcript_id : NM_183201.3

name	Slfn9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089295 GeneID:237886 MGI:2445121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 9 transcript_id : NM_172796.2

name	Slfn8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380410 GeneID:276950 MGI:2672859
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 8 transcript_id : NM_181545.3

name	LOC668706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262009 GeneID:668706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 668 ESTs, 9 Proteins product : similar to Ribosomal protein L12 transcript_id : XM_001003212.2

name	Slfn10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089303 GeneID:237887 MGI:3512288
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 10 transcript_id : NM_181542.4

name	Slfn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755569 GeneID:20556 MGI:1313258
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 2 transcript_id : NM_011408.1

name	Slfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755567 GeneID:20555 MGI:1313259
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 1 transcript_id : NM_011407.1

name	Slfn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490390 GeneID:20558 MGI:1329010
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 4 transcript_id : NM_011410.2

name	Slfn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755571 GeneID:20557 MGI:1329005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : schlafen 3 transcript_id : NM_011409.1

name	LOC100043636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262010 GeneID:100043636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs product : hypothetical protein LOC100043636 transcript_id : XM_001480989.1

name	LOC435271 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261966 GeneID:435271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins product : similar to schlafen 4 transcript_id : XM_487182.5

name	Slfn14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149261968 GeneID:237890 MGI:2684866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins product : schlafen family member 14 transcript_id : XM_894124.3

name	Pex12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374304 GeneID:103737 MGI:2144177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 12 transcript_id : NM_134025.3

name	Ap2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403596 GeneID:71770 MGI:1919020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 2, beta 1 subunit transcript_id : NM_001035854.2

name	Ap2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90403599 GeneID:71770 MGI:1919020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 2, beta 1 subunit transcript_id : NM_027915.3

name	Rasl10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83523749 GeneID:276952 MGI:2685575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 10, member B transcript_id : NM_001013386.1

name	OTTMUSG00000000934 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62000635 GeneID:237891 MGI:3652048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000934 transcript_id : NM_001013759.1

name	1700020L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382444 GeneID:66330 MGI:1913580
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700020L24 gene transcript_id : NM_025492.2

name	Mmp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129946 GeneID:118453 MGI:2153062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 28 (epilysin) transcript_id : NM_172797.2

name	Mmp28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131115 GeneID:118453 MGI:2153062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 28 (epilysin) transcript_id : NM_080453.2

name	Taf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803447 GeneID:70439 MGI:1917689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_027427.2

name	OTTMUSG00000000990 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865928 GeneID:629303 MGI:3650286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000990 transcript_id : NM_001045543.1

name	Ccl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803000 GeneID:20304 MGI:98262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 5 transcript_id : NM_013653.2

name	Ccl9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85540457 GeneID:20308 MGI:104533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 9 transcript_id : NM_011338.2

name	Ccl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506295 GeneID:20305 MGI:98263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 6 transcript_id : NM_009139.3

name	Ccl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432552 GeneID:20302 MGI:98260
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 3 transcript_id : NM_011337.2

name	Ccl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366031 GeneID:20303 MGI:98261
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 4 transcript_id : NM_013652.2

name	OTTMUSG00000000971 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432557 GeneID:100034251 MGI:3649773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000971 transcript_id : NM_001081957.1

name	Expi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126366027 GeneID:14038 MGI:107506
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extracellular proteinase inhibitor transcript_id : NM_007969.4

name	1100001G20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126365757 GeneID:66107 MGI:1913357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001G20 gene transcript_id : NM_183249.2

name	2700008B19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126432548 GeneID:217026 MGI:1919790
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700008B19 gene transcript_id : NM_145432.3

name	Tcf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185899 GeneID:21410 MGI:98505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor 2 transcript_id : NM_009330.2

name	Accn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404288 GeneID:11418 MGI:1100867
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA] GO_function : GO:0015280 - amiloride-sensitive sodium channel activity [Evidence IDA]; GO:0005261 - cation channel activity [Evidence IDA] [Evidence IMP]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IDA] [Evidence IMP]; GO:0050974 - detection of mechanical stimulus during sensory perception [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0007602 - phototransduction [Evidence IMP]; GO:0001101 - response to acid [Evidence IMP] [Evidence IDA]; GO:0009612 - response to mechanical stimulus [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0006814 - sodium ion transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; degenerin product : amiloride-sensitive cation channel 1, neuronal isoform b protein_id : NP_001029185.1

name	Ccl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755430 CCDS:CCDS25139.1 GeneID:20296 MGI:98259
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0001664 - G-protein-coupled receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A2; monocyte chemotactic protein; monocyte chemoattractant protein-1 product : chemokine (C-C motif) ligand 2 protein_id : NP_035463.1

name	Ccl7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305463 GeneID:20306 MGI:99512
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A7; RANTES/sis homolog product : chemokine (C-C motif) ligand 7 protein_id : NP_038682.1

name	Ccl11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755418 GeneID:20292 MGI:103576
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A11 product : small chemokine (C-C motif) ligand 11 protein_id : NP_035460.1

name	Ccl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226206 GeneID:20293 MGI:108224
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : putative; small inducible cytokine A12 (MGD\|MGI:108224) product : chemokine (C-C motif) ligand 12 protein_id : NP_035461.2

name	Ccl8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946818 GeneID:20307 MGI:101878
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A8; monocyte chemoattractant protein-2 product : chemokine (C-C motif) ligand 8 protein_id : NP_067418.1

name	Ccl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755424 GeneID:20290 MGI:98258
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A1; CCR8 ligand product : chemokine (C-C motif) ligand 1 protein_id : NP_035459.1

name	Tmem132e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254491 CCDS:CCDS25144.1 GeneID:270893 MGI:2685490
definition	codon_start : 1 product : transmembrane protein 132E protein_id : NP_075927.2

name	Cct6b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753326 CCDS:CCDS25145.1 GeneID:12467 MGI:1329013
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation function : a testis-specific subunit of the chaperonin containing TCP-1 (CCT); CCT is a molecular chaperone which assists the folding of proteins in eukaryotic cytosol product : chaperonin subunit 6b (zeta) protein_id : NP_033969.1

name	Ccdc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560213 CCDS:CCDS25146.1 GeneID:66983 MGI:1914233
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_process : GO:0001832 - blastocyst growth [Evidence IMP]; GO:0007049 - cell cycle [Evidence IMP]; GO:0051301 - cell division [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : coiled-coil domain containing 16 protein_id : NP_080160.2

name	Lig3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71061470 CCDS:CCDS25147.1 GeneID:16882 MGI:109152
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003910 - DNA ligase (ATP) activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : ligase III, DNA, ATP-dependent protein_id : NP_034846.2

name	Rffl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16975488 CCDS:CCDS25149.1 GeneID:67338 MGI:1914588
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; fring; rififylin product : fring isoform 2 protein_id : NP_080373.1

name	Rffl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925636 CCDS:CCDS25148.1 GeneID:67338 MGI:1914588
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; fring; rififylin product : fring isoform 1 protein_id : NP_001007466.1

name	Rad51l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755278 GeneID:19364 MGI:1261809
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003678 - DNA helicase activity [Evidence IEA]; GO:0008094 - DNA-dependent ATPase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006260 - DNA replication [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : TRAD/RAD51L3 product : RAD51-like 3 protein_id : NP_035365.1

name	Fndc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931164 CCDS:CCDS25151.1 GeneID:78919 MGI:1926169
definition	codon_start : 1 product : fibronectin type III domain containing 8 protein_id : NP_084500.1

name	Nle1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703860 CCDS:CCDS25152.1 GeneID:217011 MGI:2429770
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0001826 - inner cell mass cell differentiation [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IDA] codon_start : 1 exception : mismatches in translation note : novel WD40 repeat containing protein product : Notchless gene homolog protein_id : NP_663406.1

name	Unc45b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54607169 GeneID:217012 MGI:2443377
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IEA] codon_start : 1 exception : mismatches in translation note : striated muscle UNC45 product : cardiomyopathy associated 4 protein_id : NP_848795.2

name	Slfn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254398 CCDS:CCDS25153.1 GeneID:327978 MGI:1329004
definition	codon_start : 1 exception : mismatches in translation note : expressesd sequence AI956840 product : schlafen 5 protein_id : NP_899024.2

name	Slfn9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089296 CCDS:CCDS25154.1 GeneID:237886 MGI:2445121
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : schlafen 9 protein_id : NP_766384.2

name	Slfn8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559803 CCDS:CCDS25155.1 GeneID:276950 MGI:2672859
definition	codon_start : 1 exception : mismatches in translation product : schlafen 8 protein_id : NP_853523.1

name	LOC668706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94390243 GeneID:668706
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003212.1

name	Slfn10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089304 GeneID:237887 MGI:3512288
definition	codon_start : 1 product : schlafen 10 protein_id : NP_853520.3

name	Slfn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755570 CCDS:CCDS25156.1 GeneID:20556 MGI:1313258
definition	GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : schlafen 2 protein_id : NP_035538.1

name	Slfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755568 CCDS:CCDS25157.1 GeneID:20555 MGI:1313259
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : schlafen 1 protein_id : NP_035537.1

name	Slfn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490391 CCDS:CCDS25158.1 GeneID:20558 MGI:1329010
definition	codon_start : 1 product : schlafen 4 protein_id : NP_035540.2

name	Slfn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755572 CCDS:CCDS25159.1 GeneID:20557 MGI:1329005
definition	GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 product : schlafen 3 protein_id : NP_035539.1

name	LOC100043636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262011 GeneID:100043636
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481039.1

name	LOC435271 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261967 GeneID:435271
definition	codon_start : 1 product : hypothetical protein protein_id : XP_487182.5

name	Slfn14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149261969 GeneID:237890 MGI:2684866
definition	codon_start : 1 product : similar to LRRGT00163 protein_id : XP_899217.2

name	Pex12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527244 CCDS:CCDS25160.1 GeneID:103737 MGI:2144177
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : peroxisomal biogenesis factor 12 protein_id : NP_598786.1

name	Ap2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78711838 CCDS:CCDS25161.1 GeneID:71770 MGI:1919020
definition	GO_component : GO:0030131 - clathrin adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030276 - clathrin binding [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006461 - protein complex assembly [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : adaptor-related protein complex 2, beta 1 subunit isoform a protein_id : NP_001030931.1

name	Ap2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313640 CCDS:CCDS25162.1 GeneID:71770 MGI:1919020
definition	GO_component : GO:0030131 - clathrin adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0030276 - clathrin binding [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006461 - protein complex assembly [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : adaptor-related protein complex 2, beta 1 subunit isoform b protein_id : NP_082191.1

name	Rasl10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83523750 CCDS:CCDS25163.1 GeneID:276952 MGI:2685575
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAS-like, family 10, member B protein_id : NP_001013404.1

name	OTTMUSG00000000934 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000636 CCDS:CCDS25164.1 GeneID:237891 MGI:3652048
definition	codon_start : 1 product : hypothetical protein LOC237891 protein_id : NP_001013781.1

name	1700020L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313524 CCDS:CCDS25165.1 GeneID:66330 MGI:1913580
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66330 protein_id : NP_079768.1

name	Mmp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348964 CCDS:CCDS25167.1 GeneID:118453 MGI:2153062
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; epilysin; matrix metalloproteinase 28 (epilysin) product : matrix metalloproteinase 28 (epilysin) isoform 2 protein_id : NP_766385.1

name	Mmp28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348960 CCDS:CCDS25166.1 GeneID:118453 MGI:2153062
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; epilysin; matrix metalloproteinase 28 (epilysin) product : matrix metalloproteinase 28 (epilysin) isoform 1 protein_id : NP_536701.1

name	Taf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794412 CCDS:CCDS25168.1 GeneID:70439 MGI:1917689
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA binding protein 56); TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68 kDa product : TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_081703.1

name	OTTMUSG00000000990 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865929 GeneID:629303 MGI:3650286
definition	codon_start : 1 product : hypothetical protein LOC629303 protein_id : NP_001039008.1

name	Ccl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305461 GeneID:20304 MGI:98262
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : small inducible cytokine A5 product : chemokine (C-C motif) ligand 5 protein_id : NP_038681.1

name	Ccl9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755434 CCDS:CCDS25170.1 GeneID:20308 MGI:104533
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A9; MIP-1 gamma; small inducible cytokine A10 product : chemokine (C-C motif) ligand 9 protein_id : NP_035468.1

name	Ccl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677883 CCDS:CCDS25171.1 GeneID:20305 MGI:98263
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A6; CC chemokine; CC chemokine C10 product : chemokine (C-C motif) ligand 6 protein_id : NP_033165.1

name	Ccl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755432 GeneID:20302 MGI:98260
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A3; MIP1 (a); MIP-1 alpha; macrophage inflammatory protein-1alpha product : chemokine (C-C motif) ligand 3 protein_id : NP_035467.1

name	Ccl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305459 GeneID:20303 MGI:98261
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A4; MIP-1 beta product : chemokine (C-C motif) ligand 4 protein_id : NP_038680.1

name	OTTMUSG00000000971 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126432558 GeneID:100034251 MGI:3649773
definition	codon_start : 1 note : novel protein similar to extracellular proteinase inhibitor Expi product : extracellular proteinase inhibitor family member protein_id : NP_001075426.1

name	Expi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921600 CCDS:CCDS25175.1 GeneID:14038 MGI:107506
definition	codon_start : 1 product : extracellular proteinase inhibitor protein_id : NP_031995.3

name	1100001G20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304022 GeneID:66107 MGI:1913357
definition	codon_start : 1 product : WDNM1-like protein protein_id : NP_899072.1

name	2700008B19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249080 GeneID:217026 MGI:1919790
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217026 protein_id : NP_663407.2

name	Tcf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185900 CCDS:CCDS25179.1 GeneID:21410 MGI:98505
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IPI] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0030902 - hindbrain development [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : putative; transcription factor 2 (MGD\|MGI:98505); hepatocyte nuclear factor-1 beta product : transcription factor 2 protein_id : NP_033356.2

name	LOC676191 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676191
definition	number : 1 pseudo : _no_value

clone name	MSMg01-309D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-411K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232M24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-351A17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-266M22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-360I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-264G03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-480I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399C22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-419I02.T7 (MSMg01no419_i02.b1)	MSMg01-419I02.TJ (MSMg01no419_i02.g1)
ACC	AG514591	AG514592
length	741	719
length of high quality (start - end)	249 (77 - 325)	537 (72 - 608)
definition	CHROMAT_FILE: MSMg01no419_i02.b1 PHD_FILE: MSMg01no419_i02.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:39:04 2005	CHROMAT_FILE: MSMg01no419_i02.g1 PHD_FILE: MSMg01no419_i02.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:39:04 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NNNNTTTTTCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTCCAGAGGA TCCGCGGAATTCTCTTCCCTTCCGGTGTTACAGCTCGATACAACAGGCAC GCTCAGACAGGCTTCAGTGAAGTAACTCCTGCACTTTATTCCTTGTGGAT AGGATCTTATAAACATTTTGAAGTGGGTTGGGGTCTAAAGGCAGATGCTT TCTATTGGCTTGCTCTGAGATGTTAGGGATGCCTCATCTGCATGTGCAGG GGCTTCAAGTGTTGCCCCTACATGACTGATTGTCACAATCCTCTCTATGG GGTGTCATGGTCATGTGCTCCAGGACTGTAACCTGGTCGGGAGTAGATTT AAATGCCTACCATTCTCAATTATGAGACTTGTCGGGGTTCCTAAATTACT CACCAGGTTTTCTGTCTGGTGGCATAGTCCACCACCTCACATCCTCAGGC CTTTCTATACCTCAGAACTTACATAAACTTANAACCTTTTCTTAAATATT TTAATTTTTTGCTTTATTCTAAGATGACAAGAAAGTTTCAAGGTTATTTC CTTTTTTGTTTTCAATTAAAGACAAAGCTAAGCCCCAACCGGATCAACCA GAATTTTTTTCTCCAGGTAACCTTTCTGTCGGACCCCCTCCAACCGGAAC CTGGAAGGCAAAAAGGGTTTCGGAAAATTTTTTAGTCCCCCTCCCCCCCC TGGAAAGGGGGGGGTTTTTCCTGTCTTTTTTATTCCCCCTT	ATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXTCATCTCCTCCTGTACCATGTCTGCCTGG ATGCTGCTATGATCCCACCTTGATGATAATGGACTGAACCTCTGAACCTG TAAGCCAGCCCCAGTTAAATGTTGCCCCTATACGACTTGCCTTGTCGTGG TGTCTGTTCACAGCAGTAAAACCCTAACTAAGACAACCAAGAACAACTTT TTGGAACAGAAACACTGAAAGGGGCTAGAAGGGAGAGAGGCCCAAGTGAC TGGAGTTTCTGTGGTCGTTATTATAAGAGTCCAGAGCTGGGACTTCATGT TGGTGGCACATACTCACCCGCACAAGGTTGTAGCGGCTCGATGCCCTCTC CTTCAGCTCCTTCACTGTGCAGGAATGGGGAGAGAGAGAGAGAGAAAGAA CCAGACTGGTTACACATCCACCCACTAGGCAGGAGAACTGGCTCCTTCCC GTAGGCAGCCTGCTCCCCTCCTCCCTCTCACTCACAGGACCCCTGCAGGT CTTGGGCATTCACTGTGGCTTCAGCAGGCTCAAAGGCCCCTGTGCGCAGG GCATAGTCTGTGCTAAGTGCCATAGTGTTCACCCAGTGGCCATGACCTTG AAGAGTACGACTCAGCACACCCCAGGGCAGGAGAAGACAGGTCCCATATA CCCTTACTTTCCTTAGCTC
quality values	Open. Hide. 0 0 0 0 3 7 6 6 6 8 8 8 8 9 12 11 19 11 11 11 9 9 9 12 18 25 22 22 22 32 34 37 24 24 20 16 16 10 18 11 11 10 10 12 9 10 10 8 10 8 8 13 17 34 39 39 28 23 18 23 25 30 43 36 27 20 9 9 7 8 8 8 7 10 15 19 20 24 24 29 30 31 36 36 57 53 53 53 42 43 47 37 40 40 40 40 47 50 50 50 48 48 48 48 42 48 48 50 50 53 50 59 50 50 50 50 50 50 68 68 68 57 59 59 57 57 57 57 57 57 48 57 57 57 68 68 68 68 68 68 68 68 57 57 68 68 51 51 50 50 50 51 51 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 59 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 54 54 59 59 59 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 41 34 28 19 12 10 8 8 8 8 8 13 16 23 30 41 59 59 59 50 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 59 59 59 57 68 68 57 57 57 57 48 43 43 43 43 43 47 44 44 54 59 54 59 59 59 54 54 54 57 54 59 54 68 43 44 43 48 48 57 57 57 57 57 57 48 48 48 43 47 39 43 47 47 48 41 41 43 43 36 39 39 32 32 20 20 18 26 32 37 34 30 28 28 34 34 39 37 37 44 43 59 47 41 41 41 41 42 42 41 41 41 34 32 20 20 20 26 26 39 37 37 35 35 31 32 22 22 16 12 12 16 18 24 30 27 27 22 22 14 10 9 10 13 8 12 3 0 3 8 8 9 11 12 17 22 17 18 14 16 21 10 10 10 11 11 27 27 26 26 26 26 26 31 24 22 20 18 15 18 16 19 11 14 11 10 12 9 9 9 9 9 8 8 8 8 8 8 9 9 14 14 8 8 7 7 6 8 8 9 8 10 10 16 18 17 11 11 11 17 21 10 10 10 10 10 10 9 10 11 10 10 19 21 14 10 10 10 10 12 14 8 10 8 8 8 8 8 8 9 8 8 8 10 8 8 6 6 6 6 6 6 8 8 8 8 8 8 10 10 10 18 22 10 12 9 8 8 8 8 8 8 6 10 11 10 12 9 6 6 7 7 8 6 8 8 8 8 8 8 8 8 8 8 7 7 8 10 9 9 8 8 8 8 8 10 10 8 8 8 9 9 9 11 11 10 8 8 8 8 8 8 8 8 8 9 9 10 10 10 15 12 12 13 14 13 8 8 8 8 8 8 8 8 9 13 10 11 11 16 15 15 22 11 9 8 10 10 10 11 11 11 11 15 18 29 21 10 8 8 8 6 7 10 8 12 6 6 6 8 8 8 8 8 11 12 15 10 9 9 9 9 12 24 26 25 20	Open. Hide. 8 11 8 8 8 8 19 21 21 9 9 11 21 27 42 41 46 47 44 44 44 39 39 44 27 25 23 9 9 6 6 6 6 6 7 15 17 20 19 27 21 28 37 44 36 36 36 33 33 33 50 42 41 25 25 8 7 7 7 8 10 12 12 12 15 13 16 28 32 33 33 33 36 36 36 50 59 59 59 59 59 59 59 57 57 50 50 50 47 47 47 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 68 50 51 50 51 51 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 68 57 57 57 57 57 57 57 57 59 59 57 59 59 68 68 68 68 68 68 68 68 57 57 57 59 59 59 59 59 68 68 68 68 68 59 59 59 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 68 68 68 57 57 57 52 54 57 59 59 59 68 59 59 59 57 54 57 57 57 57 57 57 59 57 57 57 57 57 57 57 59 59 59 59 47 35 35 42 44 57 54 57 57 57 57 57 57 57 57 57 57 68 57 59 59 57 57 59 59 59 59 59 54 54 54 59 59 68 68 68 68 57 57 57 57 57 59 59 59 57 57 57 57 53 53 57 57 57 57 59 59 59 59 59 59 30 27 12 12 9 9 8 8 8 8 8 8 10 11 22 37 59 59 59 59 59 59 59 59 59 59 59 53 53 53 48 48 57 59 59 59 59 57 57 57 68 57 57 47 47 43 43 47 59 59 59 48 48 48 57 59 59 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 68 68 57 57 54 54 59 59 59 68 68 59 57 57 57 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 42 42 37 59 59 68 68 68 68 68 68 57 57 54 54 54 54 57 54 54 54 57 57 54 68 53 53 53 57 59 59 59 59 59 59 59 59 59 59 59 59 59 48 59 59 59 59 59 59 59 59 59 44 41 41 44 59 59 47 47 59 59 59 48 59 59 59 59 59 59 59 59 48 48 48 59 57 57 57 57 57 57 57 57 57 50 47 47 42 42 39 57 59 59 48 48 47 41 41 37 37 37 32 39 39 44 44 41 41 41 40 46 48 48 46 39 32 32 21 21 13 10 11 20 23 37 39 37 23 17 10 9 9 9 12 11 27 27 35 30 20 12 12 12 12 12 19 26 19 24 29 25 23 32 15 15 11 11 16 16 16 19 27 15 12 10 15 15 18 17 19 33 31 31 28 30 16 18 10 8 8 8 8 10 19 10 8 8 8 8 8 11 13 23 16 11 11 14 13 11 8 9 9 11 22 19 18 11 10 10 10 11 11 11 12 16 19 29 30 17 15 10 11 10 9 11 11 12 12 10 11 9 9 9 10 10 8 8 8 8 10 10 13 12 10 16 11 11 11 10 9 10 9 10 7 11 6 7 8 10 9 9 6 6 6 8 8 8 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no419_i02.g1 MSMg01no419_i02.g1 CHROMAT_FILE:
MSMg01no419_i02.g1 PHD_FILE: MSMg01no419_i02.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:39:04 2005
         (537 letters)



>mm_chr11_82717097_82718026
          Length = 930

 Score =  930 bits (481), Expect = 0.0
 Identities = 515/537 (95%), Gaps = 19/537 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcatctcctcctgtaccatgtctgcctggatgctgctatgatcccaccttgatgataatg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tcatctcctcctgtaccatgtctgcctggatgctgctatgatcccaccttgatgataatg 260

                                                                       
Query: 61  gactgaacctctgaacctgtaagccagccccagttaaatgttgcccctatacgacttgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gactgaacctctgaacctgtaagccagccccagttaaatgttgcccctatacgacttgcc 320

                                                                       
Query: 121 ttgtcgtggtgtctgttcacagcagtaaaaccctaactaagacaaccaagaacaactttt 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 ttgtcgtggtgtctgttcacagcagtaaaaccctaactaagacaaccaagaacaactttt 380

                                                                       
Query: 181 tggaacagaaacactgaaaggggctagaagggagagaggcccaagtgactggagtttctg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tggaacagaaacactgaaaggggctagaagggagagaggcccaagtgactggagtttctg 440

                                                                       
Query: 241 tggtcgttattataagagtccagagctgggacttcatgttggtggcacatactcacccgc 300
           ||||||  || | |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 tggtcgg-atgagaagagtccagagctgggacttcatgttggtggcacatactcacccgc 499

                                                                       
Query: 301 acaaggttgtagcggctcgatgccctctccttcagctccttcactgtgcaggaatgggga 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500 acaaggttgtagcggctcgatgccctctccttcagctccttcactgtgcaggaatgggga 559

                                                                       
Query: 361 gagagagagagagaaagaaccagactggttacacatccacccactaggcaggagaactgg 420
           ||||||||      |||||||||||||||||||||||||||||||||||           
Sbjct: 560 gagagaga------aagaaccagactggttacacatccacccactaggc----------- 602

                                                                       
Query: 421 ctccttcccgtaggcagcctgctcccctcctccctctcactcacaggacccctgcaggtc 480
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 603 -tccttcccgtaggcagcctgctcccctcctccctctcactcacaggacccctgcaggtc 661

                                                                    
Query: 481 ttgggcattcactgtggcttcagcaggctcaaaggcccctgtgcgcagggcatagtc 537
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 ttgggcattcactgtggcttcagcaggctcaaaggcccctgtgcgcagggcatagtc 718


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 27
Number of extensions: 4
Number of successful extensions: 4
Number of sequences better than 10.0: 1
Number of HSP's gapped: 2
Number of HSP's successfully gapped: 1
Length of query: 537
Length of database: 930
Length adjustment: 10
Effective length of query: 527
Effective length of database: 920
Effective search space:   484840
Effective search space used:   484840
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information