MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-438O07
Chromosome	11 (Build37)
Map Location	3,277,652 - 3,277,896
singlet/doublet	singlet
Overlap gene	Limk2
Upstream gene	LOC236604, Sfi1, LOC623257, Eif4enif1, Drg1, Patz1, Pik3ip1
Downstream gene	Rnf185, 8430429K09Rik, LOC100041573, Pla2g3, Pib5pa, Selm, Smtn, Map1lc3-5, LOC625608, Tug1, Morc2a, LOC664900, Osbp2, LOC664920, 4921536K21Rik, Dusp18, Slc35e4, Tcn2, LOC100041720, Pes1, Gal3st1, Sec14l4, Sec14l3, 1700020C11Rik, Sec14l2, LOC625729, Rnf215, 4930562D19Rik, Sf3a1, Tbc1d10a, 2410008K03Rik, LOC625760, Osm, Lif, Hormad2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC236604 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Sfi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78887 MGI:1926137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 2 Proteins pseudo : _no_value

name	Eif4enif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74203 MGI:1921453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Drg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13494 MGI:1343297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Patz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56218 MGI:1891832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216505 MGI:1917016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Limk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16886 MGI:1197517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Rnf185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193670 MGI:1922078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430429K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71523 MGI:1918773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs

name	Pla2g3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237625 MGI:2444945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pib5pa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170835 MGI:2158663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Selm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114679 MGI:2149786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smtn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29856 MGI:1354727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map1lc3-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382473
definition	note : microtubule-associated protein 1 light chain 3 copy 5 pseudogene pseudo : _no_value

name	LOC625608 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Tug1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544752 MGI:2144114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Morc2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74522 MGI:1921772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664900 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Osbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74309 MGI:1921559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	4921536K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67430 MGI:1914680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75219 MGI:1922469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35e4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103710 MGI:2144150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21452 MGI:98534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041720 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 98 ESTs, 23 Proteins pseudo : _no_value

name	Pes1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64934 MGI:1890613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gal3st1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53897 MGI:1858277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec14l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103655 MGI:2144095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec14l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380683 MGI:3617848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700020C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67900 MGI:1916686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec14l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67815 MGI:1915065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625729
definition	note : splicing factor, arginine/serine-rich 10-like pseudo : _no_value

name	Rnf215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71673 MGI:1918923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930562D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:216516 MGI:3041210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67465 MGI:1914715
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d10a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103724 MGI:2144164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410008K03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71962 MGI:1919212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Osm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18413 MGI:104749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lif (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16878 MGI:96787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hormad2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75828 MGI:1923078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sfi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358937 GeneID:78887 MGI:1926137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sfi1 homolog, spindle assembly associated (yeast) transcript_id : NM_030207.2

name	Eif4enif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963810 GeneID:74203 MGI:1921453
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E nuclear import factor 1 transcript_id : NM_023743.1

name	Drg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681224 GeneID:13494 MGI:1343297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : developmentally regulated GTP binding protein 1 transcript_id : NM_007879.1

name	Patz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130669 GeneID:56218 MGI:1891832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POZ (BTB) and AT hook containing zinc finger 1 transcript_id : NM_019574.2

name	Pik3ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120320 GeneID:216505 MGI:1917016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoinositide-3-kinase interacting protein 1 transcript_id : NM_178149.4

name	Limk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443700 GeneID:16886 MGI:1197517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM motif-containing protein kinase 2 transcript_id : NM_173053.1

name	Limk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404369 GeneID:16886 MGI:1197517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM motif-containing protein kinase 2 transcript_id : NM_010718.3

name	Limk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404364 GeneID:16886 MGI:1197517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM motif-containing protein kinase 2 transcript_id : NM_001034030.1

name	Rnf185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384363 GeneID:193670 MGI:1922078
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 185 transcript_id : NM_145355.3

name	LOC100041573 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149261613 GeneID:100041573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 47 ESTs product : similar to 39S ribosomal protein L30, mitochondrial precursor (L30mt) (MRP-L30) transcript_id : XM_001477448.1

name	Pla2g3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370177 GeneID:237625 MGI:2444945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group III transcript_id : NM_172791.1

name	Pib5pa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801905 GeneID:170835 MGI:2158663
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A transcript_id : NM_172439.2

name	Selm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110825969 GeneID:114679 MGI:2149786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenoprotein M transcript_id : NM_053267.2

name	Smtn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348130 GeneID:29856 MGI:1354727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : smoothelin transcript_id : NM_013870.2

name	Morc2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718975 GeneID:74522 MGI:1921772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 2A transcript_id : NM_198162.1

name	Osbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61744457 GeneID:74309 MGI:1921559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein 2 transcript_id : NM_152818.2

name	4921536K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803346 GeneID:67430 MGI:1914680
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921536K21 gene transcript_id : NM_026150.2

name	Dusp18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51093846 GeneID:75219 MGI:1922469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 18 transcript_id : NM_173745.4

name	Slc35e4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375518 GeneID:103710 MGI:2144150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member E4 transcript_id : NM_153142.3

name	Tcn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131003 GeneID:21452 MGI:98534
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcobalamin 2 transcript_id : NM_015749.2

name	Pes1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130386 GeneID:64934 MGI:1890613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pescadillo homolog 1, containing BRCT domain (zebrafish) transcript_id : NM_022889.3

name	Gal3st1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980854 GeneID:53897 MGI:1858277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactose-3-O-sulfotransferase 1 transcript_id : NM_016922.2

name	Sec14l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165367 GeneID:103655 MGI:2144095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC14-like 4 (S. cerevisiae) transcript_id : NM_146013.1

name	Sec14l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480137 GeneID:380683 MGI:3617848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC14-like 3 (S. cerevisiae) transcript_id : NM_001029937.1

name	1700020C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362099 GeneID:67900 MGI:1916686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700020C11 gene transcript_id : NM_026443.4

name	Sec14l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130014 GeneID:67815 MGI:1915065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC14-like 2 (S. cerevisiae) transcript_id : NM_144520.2

name	Rnf215 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145520 GeneID:71673 MGI:1918923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 215 transcript_id : NM_027859.2

name	4930562D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145527 GeneID:216516 MGI:3041210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930562D19 gene transcript_id : NM_177616.3

name	Sf3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352973 GeneID:67465 MGI:1914715
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3a, subunit 1 transcript_id : NM_026175.4

name	Tbc1d10a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527239 GeneID:103724 MGI:2144164
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 10a transcript_id : NM_134023.1

name	2410008K03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037268 GeneID:71962 MGI:1919212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410008K03 gene transcript_id : NM_028022.1

name	Osm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61656172 GeneID:18413 MGI:104749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oncostatin M transcript_id : NM_001013365.1

name	Lif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014750 GeneID:16878 MGI:96787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukemia inhibitory factor transcript_id : NM_008501.2

name	Lif (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014735 GeneID:16878 MGI:96787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukemia inhibitory factor transcript_id : NM_001039537.1

name	Hormad2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931161 GeneID:75828 MGI:1923078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HORMA domain containing 2 transcript_id : NM_029458.1

name	Sfi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358938 GeneID:78887 MGI:1926137
definition	codon_start : 1 product : Sfi1 homolog, spindle assembly associated protein_id : NP_084483.2

name	Eif4enif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963811 CCDS:CCDS24354.1 GeneID:74203 MGI:1921453
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : eukaryotic translation initiation factor 4E nuclear import factor 1 protein_id : NP_076232.1

name	Drg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681225 CCDS:CCDS24355.1 GeneID:13494 MGI:1343297
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : developmentally regulated GTP binding protein 1 protein_id : NP_031905.1

name	Patz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469133 CCDS:CCDS24356.1 GeneID:56218 MGI:1891832
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS] codon_start : 1 note : transcription factor (MAZ-related) MAZR; POZ-AT hook-zinc finger protein; zinc finger protein 278 product : POZ (BTB) and AT hook containing zinc finger 1 protein_id : NP_062520.1

name	Pik3ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42558273 CCDS:CCDS24357.1 GeneID:216505 MGI:1917016
definition	codon_start : 1 product : calcineurin-regulated kringle domain protein protein_id : NP_835362.2

name	Limk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754550 CCDS:CCDS24358.1 GeneID:16886 MGI:1197517
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005801 - Golgi cis face [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1; LIM-containing protein kinase 2a; Limk2t-1 and Limk2t-2; LIM-containing protein kinase 2t; LIM kinase 2 product : LIM motif-containing protein kinase 2 isoform a protein_id : NP_034848.1

name	Limk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443701 CCDS:CCDS24359.1 GeneID:16886 MGI:1197517
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005801 - Golgi cis face [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2; LIM-containing protein kinase 2a; Limk2t-1 and Limk2t-2; LIM-containing protein kinase 2t; LIM kinase 2 product : LIM motif-containing protein kinase 2 isoform b protein_id : NP_774958.1

name	Limk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404365 CCDS:CCDS24360.1 GeneID:16886 MGI:1197517
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005801 - Golgi cis face [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : isoform c is encoded by transcript variant 3; LIM-containing protein kinase 2a; Limk2t-1 and Limk2t-2; LIM-containing protein kinase 2t; LIM kinase 2 product : LIM motif-containing protein kinase 2 isoform c protein_id : NP_001029202.1

name	Rnf185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981757 CCDS:CCDS24361.1 GeneID:193670 MGI:1922078
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 185 protein_id : NP_663330.2

name	LOC100041573 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149261614 GeneID:100041573
definition	codon_start : 1 product : similar to 39S ribosomal protein L30, mitochondrial precursor (L30mt) (MRP-L30) protein_id : XP_001477498.1

name	Pla2g3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370178 GeneID:237625 MGI:2444945
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006644 - phospholipid metabolism [Evidence IEA] codon_start : 1 product : phospholipase A2, group III protein_id : NP_766379.1

name	Pib5pa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369946 CCDS:CCDS24364.1 GeneID:170835 MGI:2158663
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS]; GO:0001726 - ruffle [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004445 - inositol-polyphosphate 5-phosphatase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : proline-rich inositol polyphosphate 5-phosphatase product : phosphatidylinositol (4,5) bisphosphate 5-phosphatase, A protein_id : NP_766027.1

name	Selm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956246 CCDS:CCDS24365.1 GeneID:114679 MGI:2149786
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : selenoprotein M precursor protein_id : NP_444497.1 transl_except : (pos:3416276..3416278,aa:Sec)

name	Smtn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305505 CCDS:CCDS24366.1 GeneID:29856 MGI:1354727
definition	codon_start : 1 exception : mismatches in translation product : smoothelin protein_id : NP_038898.1

name	Morc2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718976 GeneID:74522 MGI:1921772
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger, CW-type with coiled-coil domain 1 product : microrchidia 2A protein_id : NP_937805.1

name	Osbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61744458 CCDS:CCDS24367.1 GeneID:74309 MGI:1921559
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol binding protein 2 protein_id : NP_690031.2

name	4921536K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385654 CCDS:CCDS24368.1 GeneID:67430 MGI:1914680
definition	codon_start : 1 product : hypothetical protein LOC67430 protein_id : NP_080426.1

name	Dusp18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424589 CCDS:CCDS24369.1 GeneID:75219 MGI:1922469
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] codon_start : 1 note : low molecular weight dual specificity phosphatase 20 product : dual specificity phosphatase 18 protein_id : NP_776106.1

name	Slc35e4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346587 CCDS:CCDS24370.1 GeneID:103710 MGI:2144150
definition	codon_start : 1 product : solute carrier family 35, member E4 protein_id : NP_694782.1

name	Tcn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657639 CCDS:CCDS24371.1 GeneID:21452 MGI:98534
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0050897 - cobalt ion binding [Evidence IEA]; GO:0015087 - cobalt ion transporter activity [Evidence IEA] GO_process : GO:0006824 - cobalt ion transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transcobalamin 2 protein_id : NP_056564.1

name	Pes1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12584984 CCDS:CCDS24372.1 GeneID:64934 MGI:1890613
definition	GO_component : GO:0000793 - condensed chromosome [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008283 - cell proliferation [Evidence IEA]; GO:0000089 - mitotic metaphase [Evidence IDA]; GO:0007000 - nucleolus organization and biogenesis [Evidence IMP]; GO:0007046 - ribosome biogenesis [Evidence IMP] codon_start : 1 product : pescadillo homolog 1, containing BRCT domain protein_id : NP_075027.1

name	Gal3st1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980855 CCDS:CCDS24373.1 GeneID:53897 MGI:1858277
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IEA]; GO:0000139 - Golgi membrane [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001733 - galactosylceramide sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006682 - galactosylceramide biosynthesis [Evidence IDA]; GO:0009247 - glycolipid biosynthesis [Evidence TAS]; GO:0042552 - myelination [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : GalCer sulfotransferase; 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase; cerebroside (3'-phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase; galactosylceramide sulfotransferase product : galactose-3-O-sulfotransferase 1 protein_id : NP_058618.2

name	Sec14l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165368 CCDS:CCDS24374.1 GeneID:103655 MGI:2144095
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : alpha-tocopherol associated protein; supernatant protein factor; squalene transfer protein product : SEC14 (S. cerevisiae)-like 2 protein_id : NP_666125.1

name	Sec14l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480138 CCDS:CCDS24375.1 GeneID:380683 MGI:3617848
definition	codon_start : 1 note : novel protein, ortholog of human and rat SEC14-like 3 (S. cerevisiae) SEC14L3 product : SEC14-like 3 protein_id : NP_001025108.1

name	1700020C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980939 CCDS:CCDS24376.1 GeneID:67900 MGI:1916686
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007006 - mitochondrial membrane organization and biogenesis [Evidence ISS] codon_start : 1 product : mitochondrial protein 18 kDa protein_id : NP_080719.2

name	Sec14l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362309 CCDS:CCDS24377.1 GeneID:67815 MGI:1915065
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005543 - phospholipid binding [Evidence ISS]; GO:0008320 - protein carrier activity [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA]; GO:0008431 - vitamin E binding [Evidence ISS] GO_process : GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0045540 - regulation of cholesterol biosynthesis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : SEC14-like 2 protein_id : NP_653103.1

name	Rnf215 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145521 CCDS:CCDS24378.1 GeneID:71673 MGI:1918923
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 215 protein_id : NP_082135.2

name	4930562D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145528 CCDS:CCDS24379.1 GeneID:216516 MGI:3041210
definition	codon_start : 1 product : hypothetical protein LOC216516 protein_id : NP_808284.2

name	Sf3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34576561 CCDS:CCDS24380.1 GeneID:67465 MGI:1914715
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : splicing factor 3a, subunit 1 protein_id : NP_080451.3

name	Tbc1d10a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527240 GeneID:103724 MGI:2144164
definition	codon_start : 1 note : novel protein, ortholog of human EBP50-PDZ interactor EPI64 product : TBC1 domain family, member 10a protein_id : NP_598784.1

name	2410008K03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037269 CCDS:CCDS24381.1 GeneID:71962 MGI:1919212
definition	codon_start : 1 product : hypothetical protein LOC71962 protein_id : NP_082298.1

name	Osm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656173 CCDS:CCDS24382.1 GeneID:18413 MGI:104749
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA]; GO:0005147 - oncostatin-M receptor binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0048266 - behavioral response to pain [Evidence IMP]; GO:0006955 - immune response [Evidence IEA]; GO:0007422 - peripheral nervous system development [Evidence IMP]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0009408 - response to heat [Evidence IMP]; GO:0042508 - tyrosine phosphorylation of Stat1 protein [Evidence IDA]; GO:0042503 - tyrosine phosphorylation of Stat3 protein [Evidence IDA]; GO:0042506 - tyrosine phosphorylation of Stat5 protein [Evidence IDA] codon_start : 1 product : oncostatin M protein_id : NP_001013383.1

name	Lif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678694 CCDS:CCDS24383.1 GeneID:16878 MGI:96787
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA] [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005146 - leukemia inhibitory factor receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0048644 - muscle morphogenesis [Evidence IMP]; GO:0048666 - neuron development [Evidence IGI]; GO:0042503 - tyrosine phosphorylation of Stat3 protein [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : leukemia inhibitory factor isoform a protein_id : NP_032527.1

name	Lif (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014736 CCDS:CCDS24384.1 GeneID:16878 MGI:96787
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IDA] [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005146 - leukemia inhibitory factor receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0048644 - muscle morphogenesis [Evidence IMP]; GO:0048666 - neuron development [Evidence IGI]; GO:0042503 - tyrosine phosphorylation of Stat3 protein [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : leukemia inhibitory factor isoform b protein_id : NP_001034626.1

name	Hormad2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931162 GeneID:75828 MGI:1923078
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : HORMA domain containing 2 protein_id : NP_083734.1

name	LOC625608 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625608
definition	number : 1 pseudo : _no_value

name	LOC664900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664900
definition	number : 1 pseudo : _no_value

name	LOC664920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664920
definition	number : 1 pseudo : _no_value

name	LOC664920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664920
definition	number : 2 pseudo : _no_value

name	LOC664920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664920
definition	number : 3 pseudo : _no_value

name	LOC625760 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625760
definition	number : 1 pseudo : _no_value

name	LOC236604 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261593 GeneID:236604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylserine decarboxylase pseudogene pseudo : _no_value transcript_id : XR_035646.1

name	LOC623257 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261611 GeneID:623257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 2 Proteins product : similar to eukaryotic translation elongation factor 2 pseudo : _no_value transcript_id : XR_033045.1

name	8430429K09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149261612 GeneID:71523 MGI:1918773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : RIKEN cDNA 8430429K09 gene transcript_id : XR_033224.1

name	Tug1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:68303551 GeneID:544752 MGI:2144114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taurine upregulated gene 1 transcript_id : NR_002321.1

name	Tug1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:68303550 GeneID:544752 MGI:2144114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : taurine upregulated gene 1 transcript_id : NR_002322.1

name	LOC100041720 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149261618 GeneID:100041720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 98 ESTs, 23 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_033351.1

clone name	MSMg01-496I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462M10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-487N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288F06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-277B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-192D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-438O07.T7 (MSMg01no438_o07.b1)	MSMg01-438O07.TJ (MSMg01no438_o07.g1)
ACC	AG529379	AG529380
length	737	763
length of high quality (start - end)	536 (47 - 582)	246 (73 - 318)
definition	CHROMAT_FILE: MSMg01no438_o07.b1 PHD_FILE: MSMg01no438_o07.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:04:50 2005	CHROMAT_FILE: MSMg01no438_o07.g1 PHD_FILE: MSMg01no438_o07.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:04:50 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	GCTCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCATTGTCTCTCTTCACATTCCTCAGGACCCGGCCCAGACTCTGCA AGTGGTAGACGCTCATATTTAACAATAAAAAACAATGGGCAGGGGAGATG GCTTAGCTGCCAGGCAAGCATAAGAACCTGAGTTCAGAAAGCCACACCCA CATAAAAAGCCAGGTGTGGTTGGTGACCCCAGCTGGGGACAGGGATGGCT GATAGGCAGATCTCTGGAACTCACTGGTCAGCCAGCCTAGCCTAGTAGAT AAGCTTTGGGGTTTAACGAGAGACATTTGCTCACCCGTGTTCCTTGCTGC TCCATTGATGATAGCCAGAAGCTGGAACCAGCCTAACCATCCCTCATCAG ATGGCTACCTAGTGGAAAGGATGTACGCTCACACAATTGAACATTGTTCA GCTGTTAAAGAAAACAAGATTAGGAAATTTGGAGATAGGAAAAAAAAAAT AATCCTGAGTCAGGGAACCCAGACCCACAAAACAAATGTCGTATGTGTTG TCTTCCATGTGGATGTATGTGTGCTACAATTCAAATAACCACAGAGCTTA GGTGCCTGGTAAGGGACCAGGCGTGAGGAAAGGATCTTCTAGGGGAAGGG AGAATTAAAATAGTGCTGGGGAAGAGACATATGAAAAATCAAATCTTATG AGTTACGGAACGTTTAGGAATATGTAAAATTAACGCT	CAATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXTTTCCACAAAATTCACTATGTAGACCAGGCTGGCCTTGAG CTCAGTAATCTGACTGCTTCCACCTCCTGAATGCTGGGATTAAATGGTGC ATCACTGTTGCCACCTCCTTTTTCCAGATGAAGAAATGAAGGTTGGGAAT GTTGTTCAGTCTCATGAGTAAAAACTGACAAGGTTGGGATCTAACGCGAG TCTCTGAACTCCGGCTCTGACACACTGAGGGTGCTGCAAACAGCTGTTCT GTACTTGCTACTTGGTCTCGGTGCATTCTTTCAAGGTGTGGTTGAGGAAC AGCTATCTGTTCTCCACTGGGAAAACGAGGCTATCCCTGGCACCACCCAG CCACACAGCCCCAGAGGTTCTGAGGGTGAGGGAAAGAATCTGAACTTTAT ATCTTCGTTGTTGTTTTGAGACAGTATCTCTCTGTGTAACCCTGTCTGCC CTGGAGCTCCACCTGTCTCTGCTTCCTGTTTGTCGGTTGATTACTGATAT GTGTACCACCTTCCCTCACTCTGTTTCCTATATTTCTATTTTTAATATAC CCTTTTTGCATTTCGACTTTTTTGGCCTTTTGTTTGTTTCCTTCCTAACT CTCTTCTCATTTTTTTTTTTCTTTTTCTTATTCTTCTCCACCTGCTCAAA CACAACACCATTTCATTCCTTATTTATCTCTCTTTTTACTTCTCCCCTTC CTCTCCTTTATTN
quality values	Open. Hide. 8 8 6 10 8 8 8 8 9 15 27 19 13 13 25 14 19 17 23 23 22 26 26 39 44 39 30 24 30 21 15 10 11 8 9 9 9 9 9 16 16 21 21 22 20 18 18 28 33 41 35 35 31 31 31 28 33 30 21 33 12 9 9 9 9 9 9 11 21 17 30 30 30 31 48 31 35 36 36 36 36 53 53 53 53 59 57 53 53 53 53 53 53 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 68 68 68 50 50 50 50 50 68 68 68 68 68 68 68 68 68 50 50 50 68 68 68 68 57 57 48 48 48 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 59 59 68 68 59 68 68 59 59 59 59 68 68 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 59 59 59 57 57 57 62 62 62 62 62 62 62 62 45 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 52 62 62 62 62 68 68 68 68 68 68 68 68 68 62 68 68 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 43 39 23 14 12 15 13 14 16 27 43 44 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 57 52 52 57 57 57 59 59 57 57 57 57 57 57 57 57 57 59 57 57 57 57 57 52 57 57 57 59 57 57 57 57 57 57 57 59 57 57 57 52 52 57 59 68 68 68 68 59 59 57 57 57 57 57 54 54 54 54 57 57 57 57 57 59 59 59 59 59 59 59 59 57 54 54 54 57 57 57 57 54 54 59 59 59 59 54 50 50 35 35 35 42 47 57 59 57 57 46 43 43 43 44 42 42 35 35 37 42 42 47 48 44 44 42 42 32 32 28 37 36 43 44 46 46 40 39 43 46 42 41 36 36 22 24 22 28 28 40 40 54 54 54 57 48 48 47 47 47 48 57 43 43 39 39 39 43 39 43 43 48 48 47 34 43 32 32 23 24 18 21 10 9 9 11 15 23 22 15 11 11 14 14 14 22 33 30 35 29 30 18 16 10 10 9 12 12 24 22 30 39 39 23 23 18 21 17 19 12 10 13 15 17 9 9 8 8 8 8 8 9 20 14 14 12 10 8 8 8 10 10 13 10 14 20 22 22 10 13 13 10 9 9 9 11 8 9 10 10 8 15 11 10 8 8 8 8 8 8 8 9 8 8 9 10 10 10 8 8 8 8 8 8 10 10 15 10 10 8 8 8 8 10 10 9 9 9 10 11 10 10 13 10 10 10 10 10 10 9 9 9 9 9 10 10 10 10 10 8 8 7 9 8 8 8 8 9 8 8 6 7 7 7 7 8 10 10 10	Open. Hide. 10 10 10 10 9 11 9 8 7 7 9 9 14 19 30 37 59 43 27 27 3 0 3 23 18 32 26 21 16 15 9 9 6 7 7 7 6 6 9 9 9 11 17 12 12 27 23 33 33 33 33 33 33 42 41 25 25 9 9 9 9 8 8 8 8 8 8 11 10 16 16 16 26 21 25 33 33 41 59 44 57 57 57 53 53 57 57 57 57 59 59 59 59 59 59 57 57 57 57 57 40 50 50 43 42 50 50 53 38 36 36 44 37 34 25 25 25 30 27 27 15 15 15 27 31 59 59 59 37 41 41 53 53 50 57 57 36 36 36 37 37 50 50 53 53 53 53 53 50 53 68 68 68 68 68 68 68 59 59 48 48 48 48 48 48 59 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 54 57 48 50 50 50 50 50 57 57 57 68 57 57 57 57 57 57 57 68 57 59 59 59 59 59 59 59 68 68 68 68 68 57 57 57 57 57 59 43 50 39 43 43 57 44 50 50 50 54 57 59 68 68 68 68 68 68 57 57 57 57 57 57 42 32 27 15 24 12 13 13 14 12 23 16 36 38 57 57 68 68 68 68 68 68 68 57 57 54 54 54 54 54 57 57 54 54 57 59 68 68 68 68 68 68 59 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 59 59 48 48 42 47 47 41 59 23 23 9 11 9 9 9 11 7 6 6 6 6 8 17 22 34 32 50 50 50 43 59 37 35 35 59 59 59 59 59 48 48 48 57 57 48 48 48 48 59 59 34 41 18 12 11 11 11 15 23 15 24 19 25 15 15 15 24 32 30 39 35 39 37 43 43 43 37 59 42 43 43 41 41 20 20 20 31 32 47 44 44 28 31 20 28 28 28 32 18 23 19 26 24 28 28 36 33 42 42 32 30 25 23 23 31 30 30 12 12 11 11 11 23 16 18 18 28 27 41 41 43 43 46 48 48 48 54 54 48 48 48 48 48 48 48 43 43 43 34 30 30 15 11 11 11 11 22 29 29 37 33 29 29 17 15 19 19 18 11 10 11 11 15 23 32 40 40 34 34 23 18 17 15 15 13 13 13 17 13 11 11 10 11 11 11 11 12 12 12 13 15 18 23 28 17 16 15 16 15 19 15 15 14 14 14 15 15 21 15 13 13 12 22 12 8 8 6 6 8 8 12 9 8 8 6 6 7 6 6 8 8 6 6 8 8 8 8 8 8 9 10 10 13 13 19 12 15 8 10 7 6 8 8 10 8 8 8 8 11 10 11 10 9 8 10 10 8 8 12 8 8 8 8 8 17 15 13 9 8 8 8 6 6 6 6 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 10 15 15 15 10 10 9 9 11 11 14 14 12 12 8 10 12 12 10 10 10 10 10 13 15 16 15 8 9 9 8 8 7 7 10 10 10 10 12 10 10 10 15 30 24 37 37 37 30 18 9 12 9 9 12 10 17 10 10 8 8 8 8 11 8 9 8 8 10 8 8 8 8 8 13 13 13 18 14 11 11 11 11 11 8 8 8 8 8 8 18 11 10 13 8 8 6 7 10 10 10 11 10 10 10 10 9 9 9 15 10 10 16 22 31 15 12 9 9 9 9 10 10 10 10 10 8 8 8 8 8 9 15 8 8 7 6 8 8 10 8 8 8 3 0

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no438_o07.g1 MSMg01no438_o07.g1 CHROMAT_FILE:
MSMg01no438_o07.g1 PHD_FILE: MSMg01no438_o07.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:04:50 2005
         (246 letters)



>mm_chr11_3277452_3278097
          Length = 646

 Score =  458 bits (237), Expect = e-133
 Identities = 243/245 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   tcactatgtagaccaggctggccttgagctcagtaatctgactgcttccacctcctgaat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tcactatgtagaccaggctggccttgagctcagtaatctgactgcttccacctcctgaat 260

                                                                       
Query: 61  gctgggattaaatggtgcatcactgttgccacctcctttttccagatgaagaaatgaagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gctgggattaaatggtgcatcactgttgccacctcctttttccagatgaagaaatgaagg 320

                                                                       
Query: 121 ttgggaatgttgttcagtctcatgagtaaaaactgacaaggttgggatctaacgcgagtc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 321 ttgggaatgttgttcagtctcatgagtaaaaactgacaaggttgggatctaacacgagtc 380

                                                                       
Query: 181 tctgaactccggctctgacacactgagggtgctgcaaacagctgttctgtacttgctact 240
           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 381 tctgaactccggctctgacacactgagggtgctgcaaacagctgttctgcacttgctact 440

                
Query: 241 tggtc 245
           |||||
Sbjct: 441 tggtc 445


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 12
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 246
Length of database: 646
Length adjustment: 9
Effective length of query: 237
Effective length of database: 637
Effective search space:   150969
Effective search space used:   150969
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information