MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-020J20
Chromosome	12 (Build37)
Map Location	22,578,272 - 22,579,253
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100042796, 6030426L16Rik, LOC434693, EG668645, EG668646, LOC100043416, LOC668650, EG668496, LOC668653, EG432637, LOC668656
Downstream gene	EG629133, EG668660, EG668662, LOC668664, 2410018L13Rik, LOC77114, EG668669, EG668670, LOC668680
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042796 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	6030426L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628850 MGI:1924364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC434693 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 134 ESTs, 7 Proteins

name	EG668645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668645 MGI:3649104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 13 Proteins pseudo : _no_value

name	EG668646 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668646 MGI:3649101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	LOC100043416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 1 Protein

name	LOC668650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG668496 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668496 MGI:3644608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 1 Protein

name	LOC668653 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	EG432637 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432637 MGI:3649058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG629133 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629133 MGI:3644179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 1 Protein

name	EG668660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668660 MGI:3648892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	EG668662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668662 MGI:3647448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	LOC668664 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	2410018L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69732 MGI:1916982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC77114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:77114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	EG668669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668669 MGI:3648889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG668670 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668670 MGI:3645836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins

name	LOC668680 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668680
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC434693 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262894 GeneID:434693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 106 ESTs, 7 Proteins product : similar to muscle protein684, transcript variant 2 transcript_id : XM_001480560.1

name	LOC434693 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262892 GeneID:434693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 134 ESTs, 7 Proteins product : similar to muscle protein684, transcript variant 1 transcript_id : XM_001480557.1

name	LOC100043416 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262896 GeneID:100043416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480563.1

name	EG668496 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262898 GeneID:668496 MGI:3644608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 1 Protein product : predicted gene, EG668496, transcript variant 1 transcript_id : XM_001004831.2

name	EG432637 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921332 GeneID:432637 MGI:3649058
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432637 transcript_id : NM_001004167.1

name	EG629133 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392497 GeneID:629133 MGI:3644179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 1 Protein product : predicted gene, EG629133 transcript_id : XM_893963.2

name	EG668662 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392499 GeneID:668662 MGI:3647448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : predicted gene, EG668662 transcript_id : XM_001002947.1

name	2410018L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575896 GeneID:69732 MGI:1916982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018L13 gene transcript_id : NM_028362.1

name	LOC77114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94392501 GeneID:77114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : similar to development and differentiation enhancing factor 2, transcript variant 2 transcript_id : XM_895036.2

name	EG668669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392502 GeneID:668669 MGI:3648889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, EG668669 transcript_id : XM_001003013.1

name	EG668670 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262806 GeneID:668670 MGI:3645836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : predicted gene, EG668670 transcript_id : XM_001478977.1

name	LOC434693 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262893 GeneID:434693
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480607.1

name	LOC434693 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262895 GeneID:434693
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480610.1

name	LOC100043416 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262897 GeneID:100043416
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480613.1

name	EG668496 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262899 GeneID:668496 MGI:3644608
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_001004831.2

name	EG432637 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921333 GeneID:432637 MGI:3649058
definition	codon_start : 1 product : hypothetical protein LOC432637 protein_id : NP_001004167.1

name	EG629133 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82941386 GeneID:629133 MGI:3644179
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899056.1

name	EG668662 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392500 GeneID:668662 MGI:3647448
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002947.1

name	2410018L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575897 GeneID:69732 MGI:1916982
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69732 protein_id : NP_082638.1

name	LOC77114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82941122 GeneID:77114
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_900129.1

name	EG668669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392503 GeneID:668669 MGI:3648889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003013.1

name	EG668670 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262807 GeneID:668670 MGI:3645836
definition	codon_start : 1 product : similar to neural visinin-like Ca2+-binding protein type 3 protein_id : XP_001479027.1

name	LOC100042796 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042796
definition	number : 3 pseudo : _no_value

name	LOC100042796 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042796
definition	number : 2 pseudo : _no_value

name	LOC100042796 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042796
definition	number : 1 pseudo : _no_value

name	EG668646 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668646
definition	number : 3 pseudo : _no_value

name	EG668646 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668646
definition	number : 2 pseudo : _no_value

name	EG668646 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668646
definition	number : 1 pseudo : _no_value

name	LOC668650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668650
definition	number : 3 pseudo : _no_value

name	LOC668650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668650
definition	number : 2 pseudo : _no_value

name	LOC668650 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668650
definition	number : 1 pseudo : _no_value

name	LOC668653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668653
definition	number : 3 pseudo : _no_value

name	LOC668653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668653
definition	number : 2 pseudo : _no_value

name	LOC668653 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668653
definition	number : 1 pseudo : _no_value

name	LOC668656 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668656
definition	number : 3 pseudo : _no_value

name	LOC668656 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668656
definition	number : 2 pseudo : _no_value

name	LOC668656 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668656
definition	number : 1 pseudo : _no_value

name	EG668660 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668660
definition	number : 1 pseudo : _no_value

name	EG668660 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668660
definition	number : 2 pseudo : _no_value

name	EG668660 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668660
definition	number : 3 pseudo : _no_value

name	LOC668664 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668664
definition	number : 1 pseudo : _no_value

name	LOC668664 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668664
definition	number : 2 pseudo : _no_value

name	LOC668664 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668664
definition	number : 3 pseudo : _no_value

name	LOC668680 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668680
definition	number : 3 pseudo : _no_value

name	LOC668680 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668680
definition	number : 2 pseudo : _no_value

name	LOC668680 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668680
definition	number : 1 pseudo : _no_value

name	6030426L16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262891 GeneID:628850 MGI:1924364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : RIKEN cDNA 6030426L16 gene transcript_id : XR_035730.1

name	EG668645 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262805 GeneID:668645 MGI:3649104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 13 Proteins product : predicted gene, EG668645 pseudo : _no_value transcript_id : XR_033945.1

clone name	MSMg01-125M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523G16
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-169G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169H19
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-020J20.b	B6Ng01-020J20.g
ACC	DH853367	DH853368
length	1,049	973
definition	DH853367\|Mus musculus domesticus DNA, BAC clone: B6Ng01-020J20, 5' end.	DH853368\|Mus musculus domesticus DNA, BAC clone: B6Ng01-020J20, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccacttttatgtttgatgccaaattctttacaaaatgaagtaaaa tttttgctagaataggatggccctttatctgtcttaataagtttaggcaa tcccatggcattaaaggcttgtaggcaatgatcagttacatttttggagg cttctccagtatgcagagaagcaaaaagaaatcctgaacaagtgtcaata caaacatgtatatattttaattttccaaattctgcataataagttaacat ccatttgccaaatatgattagtcataagaccttgtggattaactcctaaa tgtggcactggagataatgtaataatgtaatttagaacattgttttacaa tcattcttgcctgctccttagtgatcttaaggtatggctagagagataaa aattttcatgatcacgtttggccaaagcaacaggatctgaaattaaggct tctcctattagagctatgtctatgcaatcattggtgaaggtacagcctca gttgcaattgatggcccaggactgaaggggtcatgcagtgttttggagat gccagtaccatgagatgaccaccaagaacagcagcagcagtggagtacag gtatctggagcctagaggacaatgcgtgtgctacaaagggcatggctgga gaagtgacccaaacccttggaggagcccagaagatcgtgagttgaatccc agacattggatggttggagattgatttttgcttttgattgtgactgtgcc atgatattttccctcttgaaggaagaaactatttcagtggagcccacagt taagagacttttaattgtaaaaagactttggatttttaaaagagatggat attttaaagagattgaaattttaagaatatgtaaagactgtgggatgttt aaagttatttagaccttggggatgatagaatgtaaggttgaggcttacta gtgatgtgtttgtgtgtcagttgacagggacaatgtactgcctagtttgt gtcacctgatacagctgtagtactcagagaaaggagctcagttgatgaa	gaattcacagtagtagttgtttgtaagcacagagccaggtctacaggcct cagaatcctgccgctgtttttgagtcagggcctctctctgaacccagaga gtacttatcatcatcttgtctagactagctggacagaacgaccctagaat tggctcctgttgtctctatcccacagtgccagggtcacagaaaacaagga catatgtggcgctttacacgggtgatggggatctgaacccaggtccttat gcttacacacagggagcactccacctctcagactgcggcttcctgcattt ctgcatttaatactttgccaccgtgaacccccttcagtgcccgcaaacaa agcaggatacacacactgtttataactgtgagtcagggctgcatgacaat tcagaggttcagcatgaggctcaggagactcttcctatcctggaggctca aacactttgtgacctccagggttagggactcaggaaggaatgtgagggat gtgggtaaattagtcttctagaaagctccattctggcacaatagtgacag tagaatagacacgcagaaatgtgtcacactaggggctgttcacttgccag atggtgatgttcctccttttagagagcaatcaagctatagggtcccaagt aaggcttcttgttccttcccaagaggtcattatcatcaaagatgctcatc accagaccagaccttttacaggcctctgcttctgtatggaaccagcagga catctgggcagccagttctcagcggtggaggaggggaaagcaaaaagcat tgtgtgggtgtgtgccagggccagagctaagagaactcactgccctgcag cacacaacagctgtccaatgaggaagtgatagtatccccacaggaaagag gtcggccagcttacagatgactacccagcacactaggaactgcatgggat agctggaaaacttgaaaggcagg
quality values	Open. Hide. 53 30 27 39 61 61 32 13 33 37 31 37 47 50 36 36 61 61 61 47 61 38 43 61 43 32 61 43 52 52 52 49 55 61 55 49 55 55 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 59 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 47 52 61 61 53 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 57 52 57 50 53 32 47 52 57 52 53 53 53 53 51 35 57 57 57 52 53 47 57 57 43 47 45 57 53 47 57 53 57 53 47 53 53 57 48 53 57 53 53 57 53 47 52 57 53 57 45 52 50 53 50 52 57 50 42 45 57 53 57 57 53 30 57 57 40 53 42 47 39 47 52 36 40 50 43 57 53 52 53 57 52 52 53 50 34 45 45 52 52 50 57 57 33 39 41 53 57 38 53 53 57 41 40 53 57 30 52 53 43 42 53 53 30 19 38 53 57 57 52 53 46 46 52 20 50 52 23 53 57 46 37 39 57 57 38 37 14 50 38 40 52 46 31 29 50 38 42 41 36 37 57 38 27 32 50 36 35 53 52 53 30 34 25 52 52 32 50 42 50 53 37 42 20 34 52 33 25 57 57 57 52 30 28 52 57 57 41 33 37 30 36 53 27 40 37 29 36 53 31 36 31 47 24 33 52 39 28 35 21 57 57 27 37 57 48 40 40 21 53 37 39 41 19 40 30 32 24 47 57 28 34 37 36 41 57 53 37 30 25 29 32 30 34 15 31 51 40 28 30 32 32 24 46 29 38 23 48 22 34 20 48 51 51 16 27 33 30 31 48 24 39 51 51 47 34 25 29 22 22 51 30 30 29 19 11 51 51 51 28 29 51 46 32 15 41 20 37 28 31 29 30 22 29 32 46 51 25 29 43 33 27 43 28 29 21 35 28 28 51 33 28 51 51 33 23 33 18 29 32 28 28 29 29 25 29 46 26 20 27 22 26 29 11 33 41 21 16 7 26 17 46 33 27 51 26 26 28 28 28 24 51 28 24 14 28 20 34 28 29 29 51 51 35 21 15 21 39 26 36 7 29 39 28 28 9 23 11 11 18 13 25 28 33 13 41 20 25 23 22 29 31 34 9 10 22 31 28 26 22 31 22 39 9 19 14 33 26 16 11 20 35 34 32 7 10 24 9 32 16 32 26 12 15 17 21 38 9 13 12 8 4 15 7 13 17 9 17 33 23 13 22 10 19 27 10 19 11 7 25 12 14 6 4 10 8 8 7 22 11 4 11 5 4 3 7 7 5 7 5 8 5 5 14 9 12 12 15 8 19 31 9 7 5 5 5 5 12 8 16 18 7	Open. Hide. 61 61 43 61 61 49 37 49 38 43 34 34 27 50 41 37 61 61 59 61 61 61 59 61 61 61 59 61 59 61 59 59 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 52 61 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 55 55 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 52 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 50 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 53 52 50 53 61 61 61 61 61 61 61 61 61 61 61 53 47 61 61 61 53 61 61 53 39 61 47 61 61 47 61 61 61 39 61 43 61 61 61 61 53 61 53 61 52 47 61 61 61 61 61 61 53 61 42 61 61 61 53 53 53 53 53 47 53 57 57 47 57 57 43 42 50 45 45 53 53 53 57 57 53 22 11 13 9 11 10 47 47 52 47 38 47 46 50 53 42 53 23 17 45 30 24 28 53 53 53 57 53 42 53 50 57 53 45 50 57 57 57 52 53 53 45 53 53 42 52 53 57 53 52 47 29 30 57 36 52 53 31 47 41 32 47 53 33 53 57 36 39 52 30 57 57 30 45 34 57 42 57 45 45 37 33 45 37 37 41 45 53 52 45 52 45 33 57 47 24 39 57 53 37 47 28 50 23 43 22 34 28 53 37 34 10 25 38 30 33 34 52 42 42 33 45 39 22 50 37 52 16 32 16 50 42 41 38 36 40 44 36 36 33 14 46 46 36 40 25 50 37 50 42 35 50 50 36 47 50 30 30 40 31 50 31 31 35 15 50 42 57 57 53 30 37 19 8 34 17 38 42 42 29 42 33 33 41 42 31 52 28 32 36 37 36 36 47 28 40 19 17 31 16 14 13 34 21 17 32 37 37 31 57 53 32 31 31 37 40 28 31 36 48 31 32 32 34 32 40 26 30 25 41 37 44 22 16 37 8 45 46 38 36 47 45 21 32 23 27 30 27 26 19 24 22 9 13 18 14 34 29 48 45 21 9 10 23 33 23 29 24 13 11 13 44 44 13 14 11 7 17 6 24 14 11 7 7 12 16 27 24 14 29 28 14 28 20 20 26 47 25 23 27 23 24 13 29 18 24 28 33 13 12 13 16 11 21 29 28 6 19 20 14 20 28 29 29 24 9 24 35 10 7 10 25 30 30 21 35 23 28 29 38 33 23 11 16 29 31 12 7 5 5 5 12 11 22 22 28 16 14 14 17 18 15 17 22 6 20 22 29 18 19 14 23 28 30 7 33 12 12 6 10 7 9 12 19 18 19 15 7 10 14 16 21 19 14 18 8 13 7 11 14 17 6 5 10 12 31 23 23 12 11 22 17 17 9 13 9 16 17 14 9 16 10 12 21 19 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_22578272_22579253
seq2: B6Ng01-020J20.g_66_1038

seq1  GAATTCACAGTAGTAGTTGTTTGTAAGCACAGAGCCAGGTCTACAGGCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACAGTAGTAGTTGTTTGTAAGCACAGAGCCAGGTCTACAGGCCT  50

seq1  CAGAATCCTGCCGCTGTTTTTGAGTCAGGGCCTCTCTCTGAACCCAGAGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATCCTGCCGCTGTTTTTGAGTCAGGGCCTCTCTCTGAACCCAGAGA  100

seq1  GTACTTATCATCATCTTGTCTAGACTAGCTGGACAGAACGACCCTAGAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTTATCATCATCTTGTCTAGACTAGCTGGACAGAACGACCCTAGAAT  150

seq1  TGGCTCCTGTTGTCTCTATCCCACAGTGCCAGGGTCACAGAAAACAAGGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCCTGTTGTCTCTATCCCACAGTGCCAGGGTCACAGAAAACAAGGA  200

seq1  CATATGTGGCGCTTTACACGGGTGATGGGGATCTGAACCCAGGTCCTTAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATGTGGCGCTTTACACGGGTGATGGGGATCTGAACCCAGGTCCTTAT  250

seq1  GCTTACACACAGGGAGCACTCCACCTCTCAGACTGCGGCTTCCTGCATTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTACACACAGGGAGCACTCCACCTCTCAGACTGCGGCTTCCTGCATTT  300

seq1  CTGCATTTAATACTTTGCCACCGTGAACCCCCTTCAGTGCCCGCAAACAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCATTTAATACTTTGCCACCGTGAACCCCCTTCAGTGCCCGCAAACAA  350

seq1  AGCAGGATACACACACTGTTTATAACTGTGAGTCAGGGCTGCATGACAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGATACACACACTGTTTATAACTGTGAGTCAGGGCTGCATGACAAT  400

seq1  TCAGAGGTTCAGCATGAGGCTCAGGAGACTCTTCCTATCCTGGAGGCTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGAGGTTCAGCATGAGGCTCAGGAGACTCTTCCTATCCTGGAGGCTCA  450

seq1  AACACTTTGTGACCTCCAGGGTTAGGGACTCAGGAAGGAATGTGAGGGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACTTTGTGACCTCCAGGGTTAGGGACTCAGGAAGGAATGTGAGGGAT  500

seq1  GTGGGTAAATTAGTCTTCTAGAAAGCTCCATTCTGGCACAATAGTGACAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGTAAATTAGTCTTCTAGAAAGCTCCATTCTGGCACAATAGTGACAG  550

seq1  TAGAATAGACACGCAGAAATGTGTCACACTAGGGGCTGTTCACTTGCCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATAGACACGCAGAAATGTGTCACACTAGGGGCTGTTCACTTGCCAG  600

seq1  ATGGTGATGTTCCTCCTTTTAGAGAGCAATCAAGCTATAGGGTCCCAAGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTGATGTTCCTCCTTTTAGAGAGCAATCAAGCTATAGGGTCCCAAGT  650

seq1  AAGGCTTCTTGTTCCTTCCCAAGAGGTCATTATCATCAAAGATGCTCATC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTTCTTGTTCCTTCCCAAGAGGTCATTATCATCAAAGATGCTCATC  700

seq1  ACCAGACCAGACCTTTTACAGGCCTCTGCTTCTGTATGGAACCAGCAGGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGACCAGACCTTTTACAGGCCTCTGCTTCTGTATGGAACCAGCAGGA  750

seq1  CATCTGGGCAGCCAGTTCTCAGCGGTGGAGGAGGGGAAAGCAAAAAGCAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  CATCTGGGCAGCCAGTTCTCAGCGGTGGAGGAGGGGAAAGCAAAAAGCAT  800

seq1  TGTGTGGGTGTGTGCCAGGGCCAGAGCTAAGGAGAACTCACTGCCCTGCA  850
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TGTGTGGGTGTGTGCCAGGGCCAGAGCTAA-GAGAACTCACTGCCCTGCA  849

seq1  GCACACAACAGCTGCCCAATGAGGAAGTGATAGTATCCCCACAGGGACAG  900
      |||||||||||||| |||||||||||||||||||||||||||| ||| ||
seq2  GCACACAACAGCTGTCCAATGAGGAAGTGATAGTATCCCCACA-GGAAAG  898

seq1  AGGTCGGCCAGCTAACAAGATGACCAACCCAAGCACACTAGGAACTGGCA  950
      ||||||||||||| || ||||||| |  || ||||||||||||||| |||
seq2  AGGTCGGCCAGCTTAC-AGATGACTA--CCCAGCACACTAGGAACT-GCA  944

seq1  ATGGGGATAGCTGGAAAAACATGAAAGGCAGG  982
         ||||||||||| ||||| |||||||||||
seq2  --TGGGATAGCTGG-AAAACTTGAAAGGCAGG  973

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information