MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-041C04
Chromosome	12 (Build37)
Map Location	24,920,351 - 24,921,562
singlet/doublet	singlet
Overlap gene	EG668710
Upstream gene	LOC100042903, LOC100043440, EG668518, LOC100043445, LOC668697, LOC100042923, LOC677338, EG668701, LOC668471, LOC668703, LOC546534, 9030624G23Rik
Downstream gene	LOC100042945, EG668711, EG668714, LOC629364, Taf1b, Grhl1, EG629383, Klf11, Cys1, Rrm2, LOC668719, Mboat2, EG629397, C330002I19Rik, Id2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG668518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668518 MGI:3644931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein

name	LOC100043445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	LOC668697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100042923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC677338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG668701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668701 MGI:3647521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 18 Proteins pseudo : _no_value

name	LOC668471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC668703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC546534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins

name	9030624G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66808 MGI:1914058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG668710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668710 MGI:3647775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 1 Protein

name	LOC100042945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	EG668711 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668711 MGI:3646772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs, 1 Protein

name	EG668714 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668714 MGI:3646775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 201 ESTs

name	LOC629364 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 6 Proteins

name	Taf1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21340 MGI:109577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195733 MGI:2182540
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629383 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629383 MGI:3645320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 518 ESTs, 4 Proteins

name	Klf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194655 MGI:2653368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cys1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12879 MGI:2177632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rrm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20135 MGI:98181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668719 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Mboat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67216 MGI:1914466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG629397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629397 MGI:3648564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	C330002I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77480 MGI:1924730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Id2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15902 MGI:96397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262900 GeneID:668518 MGI:3644931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein product : predicted gene, EG668518, transcript variant 1 transcript_id : XM_001004836.2

name	LOC100042923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262808 GeneID:100042923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001479080.1

name	LOC668471 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262901 GeneID:668471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical LOC668471 transcript_id : XM_001480611.1

name	LOC546534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262811 GeneID:546534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 transcript_id : XM_001479109.1

name	9030624G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392513 GeneID:66808 MGI:1914058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 9030624G23 gene transcript_id : XM_001003228.1

name	EG668710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392515 GeneID:668710 MGI:3647775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 1 Protein product : predicted gene, EG668710 transcript_id : XM_001003237.1

name	EG668711 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262813 GeneID:668711 MGI:3646772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 50 ESTs, 1 Protein product : predicted gene, EG668711 transcript_id : XM_001003254.2

name	EG668714 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392519 GeneID:668714 MGI:3646775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 201 ESTs product : predicted gene, EG668714 transcript_id : XM_001003263.1

name	LOC629364 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262815 GeneID:629364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 6 Proteins product : similar to actin related protein 2/3 complex, subunit 5 transcript_id : XM_001479142.1

name	Taf1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10181155 GeneID:21340 MGI:109577
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B transcript_id : NM_020614.1

name	Grhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094138 GeneID:195733 MGI:2182540
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : grainyhead-like 1 (Drosophila) transcript_id : NM_145890.1

name	EG629383 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392437 GeneID:629383 MGI:3645320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 336 ESTs, 4 Proteins product : predicted gene, EG629383, transcript variant 1 transcript_id : XM_001004846.1

name	EG629383 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392439 GeneID:629383 MGI:3645320
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 517 ESTs, 4 Proteins product : predicted gene, EG629383, transcript variant 2 transcript_id : XM_894265.2

name	Klf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364258 GeneID:194655 MGI:2653368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 11 transcript_id : NM_178357.2

name	Cys1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074544 GeneID:12879 MGI:2177632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystin 1 transcript_id : NM_001004455.2

name	Cys1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074540 GeneID:12879 MGI:2177632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cystin 1 transcript_id : NM_138686.3

name	Rrm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106398 GeneID:20135 MGI:98181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonucleotide reductase M2 transcript_id : NM_009104.1

name	Mboat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948717 GeneID:67216 MGI:1914466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane bound O-acyltransferase domain containing 2 transcript_id : NM_026037.3

name	Mboat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053902 GeneID:67216 MGI:1914466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane bound O-acyltransferase domain containing 2 transcript_id : NM_001083341.1

name	EG629397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392522 GeneID:629397 MGI:3648564
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG629397 transcript_id : XM_901428.2

name	C330002I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487038 GeneID:77480 MGI:1924730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330002I19 gene transcript_id : NM_001081378.1

name	Id2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560579 GeneID:15902 MGI:96397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of DNA binding 2 transcript_id : NM_010496.2

name	EG668518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392426 GeneID:668518 MGI:3644931
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_001004836.1

name	LOC100042923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262809 GeneID:100042923
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479130.1

name	LOC668471 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262902 GeneID:668471
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480661.1

name	LOC546534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262812 GeneID:546534
definition	codon_start : 1 product : similar to neural visinin-like Ca2+-binding protein type 3 protein_id : XP_001479159.1

name	9030624G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392514 GeneID:66808 MGI:1914058
definition	codon_start : 1 product : hypothetical protein LOC66808 protein_id : XP_001003228.1

name	EG668710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392516 GeneID:668710 MGI:3647775
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003237.1

name	EG668711 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262814 GeneID:668711 MGI:3646772
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_001003254.2

name	EG668714 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392520 GeneID:668714 MGI:3646775
definition	codon_start : 1 product : similar to protein phosphatase 1cgamma protein_id : XP_001003263.1

name	LOC629364 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262816 GeneID:629364
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479192.1

name	Taf1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181156 GeneID:21340 MGI:109577
definition	GO_component : GO:0000120 - RNA polymerase I transcription factor complex [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence TAS] GO_process : GO:0006360 - transcription from RNA polymerase I promoter [Evidence TAS] codon_start : 1 exception : mismatches in translation note : transcription factor TAFI68 product : TATA box binding protein (Tbp)-associated factor, RNA polymerase I, B protein_id : NP_065639.1

name	Grhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094139 GeneID:195733 MGI:2182540
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : LBP protein 32-like; p61 MGR; p70 MGR; mammalian grainyhead; transcription factor CP2-like 2 product : grainyhead like 1 protein_id : NP_665897.1

name	EG629383 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392438 GeneID:629383 MGI:3645320
definition	codon_start : 1 product : similar to Cox7a2l protein isoform 1 protein_id : XP_001004846.1

name	EG629383 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82941498 GeneID:629383 MGI:3645320
definition	codon_start : 1 product : similar to Cox7a2l protein isoform 2 protein_id : XP_899358.1

name	Klf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30387628 CCDS:CCDS25842.1 GeneID:194655 MGI:2653368
definition	codon_start : 1 note : TGFB-inducible early growth response protein 2b; TGFB inducible early growth response 3; TGFB inducible early growth response 2 product : Kruppel-like factor 11 protein_id : NP_848134.1

name	Cys1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111074545 GeneID:12879 MGI:2177632
definition	GO_component : GO:0005932 - basal body [Evidence IDA]; GO:0035085 - cilium axoneme [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : congenital polycystic kidneys; cystin cilia associated protein product : cystin 1 protein_id : NP_001004455.2

name	Cys1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111074541 GeneID:12879 MGI:2177632
definition	GO_component : GO:0005932 - basal body [Evidence IDA]; GO:0035085 - cilium axoneme [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : congenital polycystic kidneys; cystin cilia associated protein product : cystin 1 protein_id : NP_619627.3

name	Rrm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106399 CCDS:CCDS25844.1 GeneID:20135 MGI:98181
definition	GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004748 - ribonucleoside-diphosphate reductase activity [Evidence IEA] GO_process : GO:0009186 - deoxyribonucleoside diphosphate metabolism [Evidence IEA]; GO:0009262 - deoxyribonucleotide metabolism [Evidence IDA]; GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : ribonucleotide reductase M2 protein_id : NP_033130.1

name	Mboat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981088 CCDS:CCDS25845.1 GeneID:67216 MGI:1914466
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; O-acyltransferase (membrane bound) domain containing 2 product : O-acyltransferase (membrane bound) domain containing 2 isoform a protein_id : NP_080313.2

name	Mboat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053903 GeneID:67216 MGI:1914466
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; O-acyltransferase (membrane bound) domain containing 2 product : O-acyltransferase (membrane bound) domain containing 2 isoform b protein_id : NP_001076810.1

name	EG629397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82941509 GeneID:629397 MGI:3648564
definition	codon_start : 1 product : hypothetical protein protein_id : XP_906521.1

name	C330002I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487039 GeneID:77480 MGI:1924730
definition	GO_component : GO:0009573 - ribulose bisphosphate carboxylase complex (sensu Magnoliophyta) [Evidence IEA] GO_function : GO:0016984 - ribulose-bisphosphate carboxylase activity [Evidence IEA] GO_process : GO:0015977 - carbon utilization by fixation of carbon dioxide [Evidence IEA] codon_start : 1 product : kinase D-interacting substrate of 220 kDa protein_id : NP_001074847.1

name	Id2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754276 CCDS:CCDS25846.1 GeneID:15902 MGI:96397
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0048535 - lymph node development [Evidence TAS]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : inhibitor of differentiation 2 product : inhibitor of DNA binding 2 protein_id : NP_034626.1

name	LOC100042903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042903
definition	number : 3 pseudo : _no_value

name	LOC100042903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042903
definition	number : 2 pseudo : _no_value

name	LOC100042903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042903
definition	number : 1 pseudo : _no_value

name	LOC100043440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043440
definition	number : 3 pseudo : _no_value

name	LOC100043440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043440
definition	number : 2 pseudo : _no_value

name	LOC100043440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043440
definition	number : 1 pseudo : _no_value

name	LOC100043445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043445
definition	number : 3 pseudo : _no_value

name	LOC100043445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043445
definition	number : 2 pseudo : _no_value

name	LOC100043445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043445
definition	number : 1 pseudo : _no_value

name	LOC668697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668697
definition	number : 3 pseudo : _no_value

name	LOC668697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668697
definition	number : 2 pseudo : _no_value

name	LOC668697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668697
definition	number : 1 pseudo : _no_value

name	LOC677338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677338
definition	number : 3 pseudo : _no_value

name	LOC677338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677338
definition	number : 2 pseudo : _no_value

name	LOC677338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677338
definition	number : 1 pseudo : _no_value

name	LOC668703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668703
definition	number : 1 pseudo : _no_value

name	LOC668703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668703
definition	number : 2 pseudo : _no_value

name	LOC668703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668703
definition	number : 3 pseudo : _no_value

name	LOC100042945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042945
definition	number : 4 pseudo : _no_value

name	LOC100042945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042945
definition	number : 3 pseudo : _no_value

name	LOC100042945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042945
definition	number : 2 pseudo : _no_value

name	LOC100042945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042945
definition	number : 1 pseudo : _no_value

name	LOC668719 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668719
definition	number : 4 pseudo : _no_value

name	LOC668719 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668719
definition	number : 3 pseudo : _no_value

name	LOC668719 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668719
definition	number : 2 pseudo : _no_value

name	LOC668719 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668719
definition	number : 1 pseudo : _no_value

name	EG668701 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262810 GeneID:668701 MGI:3647521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 18 Proteins product : predicted gene, EG668701 pseudo : _no_value transcript_id : XR_034054.1

clone name	MSMg01-299D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451K18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-201K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343C13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-348A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-368I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192P13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396F04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325O20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-041C04.b	B6Ng01-041C04.g
ACC	DH867885	DH867886
length	1,183	1,253
definition	DH867885\|Mus musculus domesticus DNA, BAC clone: B6Ng01-041C04, 5' end.	DH867886\|Mus musculus domesticus DNA, BAC clone: B6Ng01-041C04, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcatagtgtctgatgccctgtggggggctttctttgtgaaaacctt acagaatgttttcctgaggctttttgatttgcttggaaaactaactctag cagcctgagggttgggcataatccccccagacagcagtggggagccaggc actttgcccccaaactttccctttcctgatagtgcttaaaaaacagggtt acattctggttctgtttgttccagtactcctctcctctctctcctgacct ctcccactcagcttgggcttcacagccaatgctgatctcactggctgact ctgcattgcattttggtgagtcccacttactagtgccaagaagtaaacga caagcagctagctcctgtcctggtcaaagtttcctaggggctcccagcat ccccagggtcatgccctgaaccctcccctgagtagaacccctgagtgtgg caaagaaggcccctgcatgggccagacctgtagaaatgtctggttaggca ggctctctgggtccctctgagtaattagctggagacgggagccgagaaag gacaagagcaagggatttgacagcagggttgccagctgatcaatgtggtc tttgttccttgttccaaaaaagatgacacagtgatccagcctggagcttt taggaacaagcagcatccctggaagatgctgctcactactgtgaacagga agagcactgatggcaattcaggagtaacctccatctttcatgtctcaggg gactcatagcccatataagcaggcttctcccttgtctgaagtctgatcct acagatcctgtcctggctagttttatgtcaacttaacacaagctagagtc atctgagaggacaaatctagatttagaaaaatgcttccataagatccagc tgtaaggcattttcttaatgaagaaataaaggcaatttcataattagata tgggagggcccagccaattgagagtgctgtcatctctgggctggtggtct gggtctatataaagcagctgagcaagccaggaggagcaaccataactagc actctcctcctcatgaatctgcatcagctctgctcaagatctccctgtca agctcctgtctggacttcctgtgaagaactggagagtgagcccaagccga tagcctttctctgccagagctggtcatgcgttt	gaattcaaccgctacaagtctggcagatggatgtaacacacgtttcctcc tttaggaggcttcaatacctgcatgtttctgtggatacttgttctggtat catttttgcctcgcctcttacgggggaaaaggcctcacatgtaattcaac attgccttgaagcctggagtgcttggggacaacccaaaattcttaaaaca gataatggaccggcctacacctctcaaaaatttcgacagttctgtcgcca gatgaatgtaactcatttaactggtttgccatacaaccctcagggacaag gcattgtggaacgtgcccaccgcactcttaaatcttacctaatcaaacag aaagggggagtcaacgaggatctgcccttaacaccgagagtggccgtctc tatggcactctttactcttaattttttgaatcttgatgaacaaggccgca ctgcggctgatcgtcactgttcagaaccaaagagacctagagaaatgatc aaatggaaggatgtcttaaccggaaaatggagaggcccggatcctatttt aataagatccaggggagctatttgtgtttttccacaggaagaagacaatc ctctttgggttccagaacgcctcacccgaaggatctccccttcagaagat gtggacaaaagagggaacactgaaacaacgatagatactgacccttctac cggagatcctggttcctagtatatcaggggaattgcgttgggtattatgt ccacctttccctgcccatgcctgtcacgcacagtgcacaagtgagcagtt taagcttatttaaagaaaagagagattttagaatctctgctattatagtt gtcttgatagcaacagcagcaatagctgcctctatcactgcttcggccct tgccttgtctgctacggttcagacaacgcgaatcatcaatgacctttcgg caagagtgacatcggccctggaaagcaggccacggccaatctccagatat agggaggcctcttgttgttaaccaacggatcgatcttggtccagaaaggt ggatatcctgtggccatggctaactgagaagcaaacatagctgcctagct tcgatatccctctgtacaattgaaaatttttaaagacaacatacctgctc agcttgtttcttattgtaagatgggacagatgacgaaccttggacggatg actgactcgtctatgagagatctactgtatcgccaatctctcctaaatat tag
quality values	Open. Hide. 61 47 32 29 61 38 32 61 61 61 47 43 47 61 49 49 61 49 49 61 61 61 61 61 61 36 33 43 45 35 30 26 35 32 55 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 44 55 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 59 55 61 61 61 61 61 61 61 61 55 44 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 55 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 52 61 61 61 61 43 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 35 61 61 61 61 53 39 47 61 53 52 61 61 61 61 61 47 61 53 53 61 61 61 47 52 61 35 53 61 61 50 61 61 52 61 61 61 61 61 53 53 61 61 52 61 61 39 61 50 52 40 61 61 61 61 61 50 52 33 61 61 42 50 61 52 47 47 61 42 52 53 61 33 45 53 47 53 57 53 57 45 45 53 57 57 53 36 32 47 53 53 47 50 53 52 50 52 34 53 38 52 45 42 42 43 47 42 57 50 33 53 27 53 52 53 57 42 53 40 40 43 53 45 52 53 53 45 50 53 47 45 34 50 50 53 53 35 57 38 52 31 33 52 57 38 50 52 35 16 45 50 45 57 38 30 14 46 52 31 45 45 26 26 52 50 50 50 34 50 52 45 46 37 42 35 43 57 30 45 50 40 30 7 43 57 57 38 24 53 47 30 53 53 33 52 29 29 35 39 39 53 24 52 33 52 31 36 57 32 53 50 40 42 36 53 41 42 37 52 23 39 38 38 37 30 22 32 42 42 42 42 29 34 39 40 36 37 27 35 37 39 37 57 33 57 36 37 37 35 40 29 33 37 40 29 31 57 57 48 33 27 40 31 37 24 35 30 23 53 39 40 40 20 37 18 24 29 41 39 28 25 40 29 36 32 27 37 39 29 29 43 17 30 14 8 22 28 22 44 31 30 35 36 30 12 30 32 51 48 36 22 47 51 51 51 32 29 31 29 34 41 29 20 21 33 22 38 21 29 19 20 41 16 16 28 37 29 16 25 32 26 29 9 20 21 51 51 39 34 27 35 28 28 28 34 24 32 8 29 51 18 43 12 46 20 33 22 6 28 21 30 43 28 28 21 38 29 38 23 28 29 17 11 7 7 17 31 43 22 40 14 51 26 19 51 26 21 24 28 30 19 20 12 34 29 24 7 9 7 21 34 31 31 29 22 29 23 27 13 12 22 20 21 51 28 13 24 23 27 12 23 26 6 16 18 32 51 33 12 15 21 9 9 26 6 13 28 28 12 20 7 7 5 28 11 21 9 20 19 22 13 21 15 7 22 6 13 13 15 30 15 10 17 19 9 13 25 6 6 29 12 8 20 31 14 14 10 9 14 20 29 8 7 34 10 30 10 15 8 8 9 13 5 12 11 8 10 6 5 5 11 7 15 12 29 9 14 20 4 17 5 6 7 1 4 5 6 19 36 30 5 7 4 6 5 14 6 5 7 29 14 5 18 26 6 8 5 7 9 5 9 4 5 17 24 4 3 6 10 5 4 14 26 10 5 7 5 5 8 5 11 5 8 15 6 14 23 7 7 10 3 12 3 3 7 4 6 1 13 11 10 7 8 6 4 4 13 7 6 17 8 4 12 4 4 6 3 7 10 8 5 5 11 12 7 4 10 21	Open. Hide. 61 61 52 49 43 38 24 22 41 35 19 21 26 22 28 59 59 61 61 61 61 61 61 61 61 59 61 59 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 59 59 59 55 36 35 41 28 55 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 55 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 43 61 61 61 53 61 61 61 43 61 61 61 61 61 61 61 61 61 61 53 61 61 53 53 61 61 61 61 53 61 53 61 61 47 50 61 61 61 61 61 61 61 50 40 61 61 61 47 47 53 61 61 61 61 47 61 39 61 50 50 61 61 61 50 61 61 50 61 45 40 61 53 61 61 61 61 61 61 61 57 57 47 47 52 50 47 28 45 57 47 52 45 47 53 52 53 50 53 57 57 45 57 47 32 57 28 27 53 53 53 47 47 47 53 53 52 45 38 57 47 27 53 30 39 47 57 53 47 45 22 57 53 47 20 53 18 47 45 57 47 52 45 47 57 57 53 57 53 53 43 47 53 42 53 45 53 45 53 37 45 52 40 57 38 47 41 43 53 53 53 40 39 45 53 45 52 41 12 37 30 38 47 45 53 35 22 29 42 52 39 53 47 40 52 41 45 41 37 43 15 57 57 35 33 16 21 41 35 42 42 29 32 52 46 53 20 21 19 37 38 26 43 44 53 37 30 53 32 52 57 53 42 53 46 39 50 32 43 53 34 39 52 25 37 38 53 37 42 36 39 50 37 35 52 35 37 33 53 35 36 40 24 52 40 48 48 48 36 47 28 31 37 57 30 33 37 16 29 20 27 33 31 57 33 22 57 44 18 35 57 57 43 33 53 28 44 30 32 15 57 57 35 41 37 43 30 33 40 37 30 29 32 28 32 24 17 27 31 30 38 13 19 43 29 23 38 22 41 31 28 24 30 21 34 36 36 30 23 28 29 29 20 35 28 23 21 41 24 29 29 37 31 30 29 29 34 33 28 30 28 24 31 31 26 14 34 20 27 21 30 46 36 24 30 32 23 27 35 28 29 23 35 28 33 24 28 27 29 27 22 10 13 27 18 5 29 15 23 28 21 20 22 14 29 28 20 27 20 20 29 26 23 20 33 33 22 28 28 51 43 29 16 29 18 28 28 9 29 8 23 29 29 14 10 22 14 20 21 27 41 24 25 9 12 11 5 5 19 9 27 22 21 16 21 15 19 18 21 20 12 19 11 6 5 12 28 32 7 8 20 7 5 4 5 8 13 6 12 11 24 7 29 16 9 7 5 13 5 21 16 6 16 33 34 10 18 13 14 10 10 16 15 28 14 6 10 12 7 8 13 33 11 8 18 7 6 6 13 4 8 4 6 5 10 17 6 7 17 11 14 14 6 7 7 14 31 9 8 22 11 14 20 9 29 7 8 7 26 9 17 5 4 6 7 14 8 37 25 11 11 9 29 6 12 9 9 20 12 6 5 8 24 9 9 7 6 9 4 7 10 9 5 6 4 11 4 9 4 7 3 7 8 15 11 5 4 4 6 10 10 27 25 6 4 4 26 14 8 9 8 11 5 3 4 4 14 19 6 6 16 7 11 6 11 3 3 14 10 6 7 27 16 13 16 16 3 7 7 1 3 2 5 8 16 4 5 10 5 4 4 5 1 3 3 1 3 1 6 7 4 4 7 3 4 13 7 8 10 3 5 7 4 1 1 4 3 3 4 10 5 6 5 5 6 12 6 8 10 2 1 2 8 6 6 2 9 4 16 5 17 7 6 17 3 3 3 4 3 4 7 10 6 11 6 4 3 5 14 4 5 2 2 1 3 1 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_24920351_24921562
seq2: B6Ng01-041C04.b_45_1227

seq1  GAATTCATAGTGTCTGATGCCCTGTGGGGGGCTTTCTTTGTGAAAAGCTT  50
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  GAATTCATAGTGTCTGATGCCCTGTGGGGGGCTTTCTTTGTGAAAACCTT  50

seq1  ACAGATTGTTTTCCTGAGGCTTTTTGATTTGCTTGGAAAACCAACTCTAG  100
      ||||| ||||||||||||||||||||||||||||||||||| ||||||||
seq2  ACAGAATGTTTTCCTGAGGCTTTTTGATTTGCTTGGAAAACTAACTCTAG  100

seq1  CAGCCTGAGGGTTGGGCATAATCCCCCCAGACAGCAGTGGGGAGCCAGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTGAGGGTTGGGCATAATCCCCCCAGACAGCAGTGGGGAGCCAGGC  150

seq1  ACTTTGCCCCCAAACTTTCCCTTTTCTGTTAGTGCTTAAAAAACAGGGTT  200
      |||||||||||||||||||||||| ||| |||||||||||||||||||||
seq2  ACTTTGCCCCCAAACTTTCCCTTTCCTGATAGTGCTTAAAAAACAGGGTT  200

seq1  ACATCCTGGTTCTGTTTGTTCCAGTACTCCTCTCCTCTCTCTCCTGACCT  250
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTCTGGTTCTGTTTGTTCCAGTACTCCTCTCCTCTCTCTCCTGACCT  250

seq1  CTCCCACTCAGCTTGGGCTTCACAGCCAATGCTGATCTCACTGGCTGACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCACTCAGCTTGGGCTTCACAGCCAATGCTGATCTCACTGGCTGACT  300

seq1  CTGCATTGCATTTTGGTGAGTCCCACTTACTAGTGCCAAGAAGTGAACGC  350
      |||||||||||||||||||||||||||||||||||||||||||| |||| 
seq2  CTGCATTGCATTTTGGTGAGTCCCACTTACTAGTGCCAAGAAGTAAACG-  349

seq1  AGAAGCAGCTAGCTCCTGTCCTGGTCAAAGTTTCCTAGGGGCTCCCAGCC  400
      | ||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  ACAAGCAGCTAGCTCCTGTCCTGGTCAAAGTTTCCTAGGGGCTCCCAGCA  399

seq1  TCCCCAGGTCCATGCCCTGAACCCTCCCCTGAGTAGAACCCCTGAGTGTG  450
      ||||||||  ||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCAGGGTCATGCCCTGAACCCTCCCCTGAGTAGAACCCCTGAGTGTG  449

seq1  GCAAAGAAGGCCCCTGCATGGGCCAGACCTGTAGAAATGTCTGGTTAGGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGAAGGCCCCTGCATGGGCCAGACCTGTAGAAATGTCTGGTTAGGC  499

seq1  AGGCTCTCTGGGTCCCTCTGAGTAATTAGCTGGAGATGGGAGCCCAGCAA  550
      |||||||||||||||||||||||||||||||||||| ||||||| || ||
seq2  AGGCTCTCTGGGTCCCTCTGAGTAATTAGCTGGAGACGGGAGCCGAGAAA  549

seq1  GGACAAGAGCAAGGGATTTGACAGCAGGGTTGCCCGCTGATCAATGTGGT  600
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  GGACAAGAGCAAGGGATTTGACAGCAGGGTTGCCAGCTGATCAATGTGGT  599

seq1  CTTTGTTCCTTGTTCCAAAAAAGATGACACAGTGATCTAGCCTGAAGCTT  650
      ||||||||||||||||||||||||||||||||||||| |||||| |||||
seq2  CTTTGTTCCTTGTTCCAAAAAAGATGACACAGTGATCCAGCCTGGAGCTT  649

seq1  TTAGGAACAAGCAGCATCCCTGGAAGATGCTGCTCACTACTGTGAACCAG  700
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  TTAGGAACAAGCAGCATCCCTGGAAGATGCTGCTCACTACTGTGAA-CAG  698

seq1  GAAGAGCACTGATGGCAAGCCAGGAGTAACCTCCATCCTTCATGTCTCAG  750
      ||||||||||||||||||  ||||||||||||||||| ||||||||||||
seq2  GAAGAGCACTGATGGCAATTCAGGAGTAACCTCCATCTTTCATGTCTCAG  748

seq1  GGGACTCATAGCCCATATAAGCAGGCTTCTCCCTTGTCTGAAGTCTGATC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACTCATAGCCCATATAAGCAGGCTTCTCCCTTGTCTGAAGTCTGATC  798

seq1  CTACAGATCCTGTCCTGGCTAGTTTTATGTCAACTTAACACAAGCTAGAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACAGATCCTGTCCTGGCTAGTTTTATGTCAACTTAACACAAGCTAGAG  848

seq1  TCATCTGAGAGGAGAAATCTAGATTTAGAAAAATGCTTCCATAAGATCCA  900
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TCATCTGAGAGGACAAATCTAGATTTAGAAAAATGCTTCCATAAGATCCA  898

seq1  GCTGTAAGGCATTTTCTTAATGAAGAAATTAAGGCAATTTCATAATTAGA  950
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  GCTGTAAGGCATTTTCTTAATGAAGAAATAAAGGCAATTTCATAATTAGA  948

seq1  TATGGGAGGGCCCAGCCAATTGAGGGTGCTGTCATCTCTGGGCTGGCGGG  1000
      |||||||||||||||||||||||| |||||||||||||||||||||  ||
seq2  TATGGGAGGGCCCAGCCAATTGAGAGTGCTGTCATCTCTGGGCTGG-TGG  997

seq1  CCTGGGTTCTATAAGAAAGCAGGCTGAGCAAGCCAGGAGAAGCAAACCAA  1050
       ||||| ||||| | |||||| ||||||||||||||||| |||||  | |
seq2  TCTGGG-TCTAT-ATAAAGCA-GCTGAGCAAGCCAGGAGGAGCAA--CCA  1042

seq1  TAACTAGCACTCTCTCCTTCATGACCTCTGCATCAGCTCCTGCCTCCAGG  1100
      ||||||||||||||  | ||||||  |||||||||||| ||| ||| || 
seq2  TAACTAGCACTCTCCTCCTCATGA-ATCTGCATCAGCT-CTG-CTCAAGA  1089

seq1  TTTCTGCCCTGCTCAAGTTCCTGTTCTGACTTCCTTTGATGATGAACTGT  1150
      | |   ||||| ||||| ||||||   ||||||||    ||| |||||| 
seq2  TCT---CCCTG-TCAAGCTCCTGTCTGGACTTCCT---GTGAAGAACTG-  1131

seq1  GAG-GTGGAAGCCTAAGCCAAATAAGCCCTTTTCTCTGCCAAGATGCTTT  1199
      ||| |||  |||| ||||| |   ||||  |||||||||| ||| ||  |
seq2  GAGAGTG--AGCCCAAGCCGA--TAGCC--TTTCTCTGCC-AGA-GC--T  1171

seq1  GGTCATGCTGTTT  1212
      |||||||| ||||
seq2  GGTCATGC-GTTT  1183

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information