MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-069D10
Chromosome	12 (Build37)
Map Location	89,279,052 - 89,280,176
singlet/doublet	singlet
Overlap gene	LOC100039191
Upstream gene	2310044G17Rik, Zdhhc22, Tmem63c, Ngb, Pomt2, Gstz1, EG625237, Tmed8, Gm263, 4933437F05Rik, AI413782, Ahsa1, Thsd3, Sptlc2, LOC667287, Nrp, 1810035L17Rik, Snw1, LOC100042747, EG544883, EG666806, EG633031, Oog1, LOC100042776, LOC100042778, LOC100042239, LOC100042786, BB287469, LOC100038964, LOC673658, LOC100038992, LOC100038982, LOC674027, LOC100039042, LOC100039052, LOC100039076, LOC100039087, LOC100039100, LOC100039203, LOC627873, LOC100039162, LOC627881, LOC100039129
Downstream gene	LOC636517, LOC544884, LOC100039226, LOC432715, EG667350, LOC546543, EG667388, LOC627971, LOC667395, LOC100039315, EG638008, EG666862, EG435337, LOC100039154, LOC633093, LOC667440, LOC100039383, EG266459, LOC667475, LOC620915, LOC435314, Adck1, LOC100039261, EG666915, Nrxn3
Link	Open Mouse BAC browser

Click to get alignment info.

name	2310044G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217732 MGI:1919185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238331 MGI:2685108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem63c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217733 MGI:2444386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64242 MGI:2151886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pomt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217734 MGI:2444430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gstz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14874 MGI:1341859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625237 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625237 MGI:3647745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tmed8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382620 MGI:1923480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238333 MGI:2685109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins

name	4933437F05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71275 MGI:1918525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI413782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104799 MGI:2144805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ahsa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217737 MGI:2387603
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thsd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217738 MGI:2685110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	Sptlc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20773 MGI:108074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 170 ESTs, 2 Proteins pseudo : _no_value

name	Nrp (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810035L17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380773 MGI:1916394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snw1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66354 MGI:1913604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042747 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG544883 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544883 MGI:3647569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 13 Proteins

name	EG666806 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666806 MGI:3643794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 10 ESTs, 13 Proteins

name	EG633031 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633031 MGI:3646386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins pseudo : _no_value

name	Oog1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193322 MGI:2679150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042776 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 14 ESTs, 13 Proteins

name	LOC100042778 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs, 2 Proteins pseudo : _no_value

name	LOC100042239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042786 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins

name	BB287469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544881 MGI:3034635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100038964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 77 ESTs, 2 Proteins pseudo : _no_value

name	LOC673658 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673658
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100038992 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins

name	LOC100038982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 9 Proteins

name	LOC674027 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039042 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 24 ESTs, 14 Proteins

name	LOC100039052 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 14 Proteins

name	LOC100039076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 12 Proteins

name	LOC100039087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 327 ESTs, 43 Proteins

name	LOC100039100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 14 Proteins

name	LOC100039191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 ESTs, 2 Proteins pseudo : _no_value

name	LOC627873 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins

name	LOC100039162 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 14 Proteins

name	LOC627881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins

name	LOC100039129 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 14 Proteins

name	LOC636517 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 14 Proteins pseudo : _no_value

name	LOC544884 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 6 Proteins pseudo : _no_value

name	LOC100039226 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 13 Proteins

name	LOC432715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins pseudo : _no_value

name	EG667350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667350 MGI:3646799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins

name	LOC546543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins

name	EG667388 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667388 MGI:3643180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC627971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs, 21 Proteins pseudo : _no_value

name	LOC667395 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667395
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 10 Proteins pseudo : _no_value

name	LOC100039315 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 327 ESTs, 45 Proteins

name	EG638008 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638008 MGI:3648711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 21 Proteins pseudo : _no_value

name	EG666862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666862 MGI:3644018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 14 Proteins

name	EG435337 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435337 MGI:3648257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039154 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC633093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC667440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039383 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins pseudo : _no_value

name	EG266459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266459 MGI:3648085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 13 Proteins pseudo : _no_value

name	LOC667475 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 7 Proteins pseudo : _no_value

name	LOC620915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 9 Proteins pseudo : _no_value

name	LOC435314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Adck1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72113 MGI:1919363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039261 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 90 ESTs

name	EG666915 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666915 MGI:3648198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Nrxn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18191 MGI:1096389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310044G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343461 GeneID:217732 MGI:1919185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310044G17 gene transcript_id : NM_173735.2

name	Zdhhc22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384075 GeneID:238331 MGI:2685108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC-type containing 22 transcript_id : NM_001080943.2

name	Tmem63c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475966 GeneID:217733 MGI:2444386
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 63c transcript_id : NM_172583.2

name	Ngb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543322 GeneID:64242 MGI:2151886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroglobin transcript_id : NM_022414.2

name	Pomt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130103 GeneID:217734 MGI:2444430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein-O-mannosyltransferase 2 transcript_id : NM_153415.3

name	Gstz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892597 GeneID:14874 MGI:1341859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutathione transferase zeta 1 (maleylacetoacetate isomerase) transcript_id : NM_010363.3

name	EG625237 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392982 GeneID:625237 MGI:3647745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG625237 transcript_id : XM_893545.2

name	Tmed8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360188 GeneID:382620 MGI:1923480
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 domain containing 8 transcript_id : NM_001033475.2

name	Gm263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393037 GeneID:238333 MGI:2685109
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : gene model 263, (NCBI) transcript_id : XM_138106.6

name	4933437F05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116812876 GeneID:71275 MGI:1918525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933437F05 gene transcript_id : NM_027744.1

name	AI413782 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981633 GeneID:104799 MGI:2144805
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI413782 transcript_id : NM_134044.2

name	Ahsa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122514 GeneID:217737 MGI:2387603
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AHA1, activator of heat shock protein ATPase homolog 1 (yeast) transcript_id : NM_146036.1

name	Thsd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393044 GeneID:217738 MGI:2685110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : thrombospondin, type I, domain containing 3 transcript_id : XM_138107.7

name	Sptlc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366849 GeneID:20773 MGI:108074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine palmitoyltransferase, long chain base subunit 2 transcript_id : NM_011479.3

name	Nrp (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:62909988 GeneID:654309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neural regeneration protein transcript_id : NM_001013372.1

name	1810035L17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802683 GeneID:380773 MGI:1916394
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810035L17 gene transcript_id : NM_026958.2

name	Snw1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328070 GeneID:66354 MGI:1913604
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNW domain containing 1 transcript_id : NM_025507.1

name	LOC100042747 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263353 GeneID:100042747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042747 transcript_id : XM_001479340.1

name	EG544883 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263355 GeneID:544883 MGI:3647569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 13 Proteins product : predicted gene, EG544883 transcript_id : XM_001479359.1

name	EG544883 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392985 GeneID:544883 MGI:3647569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 13 Proteins product : predicted gene, EG544883, transcript variant 1 transcript_id : XM_619013.3

name	EG666806 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392990 GeneID:666806 MGI:3643794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 13 Proteins product : predicted gene, EG666806, transcript variant 2 transcript_id : XM_994328.1

name	EG666806 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392988 GeneID:666806 MGI:3643794
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 13 Proteins product : predicted gene, EG666806, transcript variant 1 transcript_id : XM_994314.1

name	Oog1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38490532 GeneID:193322 MGI:2679150
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oogenesin 1 transcript_id : NM_178657.3

name	LOC100042776 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263358 GeneID:100042776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 14 ESTs, 13 Proteins product : hypothetical protein LOC100042776 transcript_id : XM_001479394.1

name	LOC100042786 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263361 GeneID:100042786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 6 Proteins product : similar to beacon transcript_id : XM_001479404.1

name	LOC100038992 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263411 GeneID:100038992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : similar to beacon transcript_id : XM_001472024.1

name	LOC100038982 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263409 GeneID:100038982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 9 Proteins product : similar to REX1, RNA exonuclease 1 homolog (S. cerevisiae) transcript_id : XM_001472039.1

name	LOC100039042 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263413 GeneID:100039042
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 24 ESTs, 14 Proteins product : hypothetical protein LOC100039042 transcript_id : XM_001472050.1

name	LOC100039052 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263415 GeneID:100039052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 14 Proteins product : hypothetical protein LOC100039052 transcript_id : XM_001472074.1

name	LOC100039076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263418 GeneID:100039076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 12 Proteins product : hypothetical protein LOC100039076 transcript_id : XM_001472109.1

name	LOC100039087 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263422 GeneID:100039087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 319 ESTs, 43 Proteins product : similar to Oog1 protein, transcript variant 1 transcript_id : XM_001472144.1

name	LOC100039087 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263424 GeneID:100039087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 221 ESTs product : similar to Oog1 protein, transcript variant 2 transcript_id : XM_001472167.1

name	LOC100039100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263426 GeneID:100039100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 6 ESTs, 14 Proteins product : hypothetical protein LOC100039100 transcript_id : XM_001472207.1

name	LOC100039191 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263439 GeneID:100039191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100039191 transcript_id : XM_001472368.1

name	LOC627873 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263437 GeneID:627873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : similar to beacon transcript_id : XM_001472350.1

name	LOC100039162 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263434 GeneID:100039162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 14 Proteins product : hypothetical protein LOC100039162 transcript_id : XM_001472322.1

name	LOC627881 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263432 GeneID:627881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins product : hypothetical LOC627881 transcript_id : XM_001472292.1

name	LOC100039129 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263430 GeneID:100039129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 14 Proteins product : hypothetical protein LOC100039129 transcript_id : XM_001472259.1

name	LOC100039226 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263444 GeneID:100039226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 13 Proteins product : hypothetical protein LOC100039226 transcript_id : XM_001472441.1

name	EG667350 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263420 GeneID:667350 MGI:3646799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins product : predicted gene, EG667350 transcript_id : XM_990056.2

name	LOC546543 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263446 GeneID:546543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins product : similar to beacon transcript_id : XM_001472466.1

name	LOC100039315 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263454 GeneID:100039315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 221 ESTs product : similar to Oog1 protein, transcript variant 2 transcript_id : XM_001472553.1

name	LOC100039315 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263452 GeneID:100039315
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 319 ESTs, 45 Proteins product : similar to Oog1 protein, transcript variant 1 transcript_id : XM_001472527.1

name	EG666862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392996 GeneID:666862 MGI:3644018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 11 ESTs, 14 Proteins product : predicted gene, EG666862, transcript variant 2 transcript_id : XM_994590.1

name	EG666862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392994 GeneID:666862 MGI:3644018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 14 Proteins product : predicted gene, EG666862, transcript variant 1 transcript_id : XM_994582.1

name	EG435337 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802727 GeneID:435337 MGI:3648257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG435337 transcript_id : NM_001013824.2

name	Adck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130450 GeneID:72113 MGI:1919363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 1 transcript_id : NM_028105.3

name	LOC100039261 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263448 GeneID:100039261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 90 ESTs product : hypothetical protein LOC100039261 transcript_id : XM_001472563.1

name	EG666915 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392999 GeneID:666915 MGI:3648198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG666915 transcript_id : XM_994782.1

name	Nrxn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353846 GeneID:18191 MGI:1096389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurexin III transcript_id : NM_172544.2

name	2310044G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424567 GeneID:217732 MGI:1919185
definition	codon_start : 1 product : RIKEN cDNA 2310044G17 protein_id : NP_776096.1

name	Zdhhc22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301180 GeneID:238331 MGI:2685108
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC-type containing 22 protein_id : NP_001074412.1

name	Tmem63c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369826 CCDS:CCDS26069.1 GeneID:217733 MGI:2444386
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 63c protein_id : NP_766171.1

name	Ngb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967939 GeneID:64242 MGI:2151886
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005344 - oxygen transporter activity [Evidence IDA] GO_process : GO:0015671 - oxygen transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : neuroglobin protein_id : NP_071859.1

name	Pomt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70794795 CCDS:CCDS26070.1 GeneID:217734 MGI:2444430
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence ISS] GO_function : GO:0004169 - dolichyl-phosphate-mannose-protein mannosyltransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : protein-O-mannosyltransferase 2 protein_id : NP_700464.2

name	Gstz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754092 CCDS:CCDS26071.1 GeneID:14874 MGI:1341859
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004364 - glutathione transferase activity [Evidence TAS]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016034 - maleylacetoacetate isomerase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IEA]; GO:0006559 - L-phenylalanine catabolism [Evidence TAS]; GO:0006572 - tyrosine catabolism [Evidence TAS] codon_start : 1 note : maleylacetoacetate isomerase product : glutathione transferase zeta 1 (maleylacetoacetate isomerase) protein_id : NP_034493.1

name	EG625237 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82942795 GeneID:625237 MGI:3647745
definition	codon_start : 1 product : similar to Gag protein_id : XP_898638.1

name	Tmed8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794627 CCDS:CCDS26072.1 GeneID:382620 MGI:1923480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane emp24 domain containing 8 protein_id : NP_001028647.1

name	Gm263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393038 GeneID:238333 MGI:2685109
definition	codon_start : 1 product : hypothetical protein protein_id : XP_138106.6

name	4933437F05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116812877 GeneID:71275 MGI:1918525
definition	GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71275 protein_id : NP_082020.1

name	AI413782 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981634 CCDS:CCDS26074.1 GeneID:104799 MGI:2144805
definition	codon_start : 1 product : hypothetical protein LOC104799 protein_id : NP_598805.2

name	Ahsa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122515 CCDS:CCDS26075.1 GeneID:217737 MGI:2387603
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0001671 - ATPase stimulator activity [Evidence ISS]; GO:0030189 - chaperone activator activity [Evidence ISS]; GO:0051087 - chaperone binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006457 - protein folding [Evidence ISS] [Evidence IEA]; GO:0006950 - response to stress [Evidence ISS]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 product : AHA1, activator of heat shock 90kDa protein ATPase homolog 1 protein_id : NP_666148.1

name	Thsd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393045 GeneID:217738 MGI:2685110
definition	codon_start : 1 product : hypothetical protein protein_id : XP_138107.7

name	Sptlc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755656 CCDS:CCDS26076.1 GeneID:20773 MGI:108074
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004758 - serine C-palmitoyltransferase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : serine palmitoyltransferase, long chain base subunit 2 protein_id : NP_035609.1

name	Nrp (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:62909989 CCDS:CCDS26077.1 GeneID:654309
definition	codon_start : 1 function : survival and neuronal proliferation induction, chemoattraction and promotion of neuronal differentiation product : neural regeneration protein protein_id : NP_001013390.1

name	1810035L17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058962 GeneID:380773 MGI:1916394
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC380773 protein_id : NP_081234.1

name	Snw1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328071 GeneID:66354 MGI:1913604
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence ISS]; GO:0042809 - vitamin D receptor binding [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 exception : mismatches in translation product : SKI interacting protein protein_id : NP_079783.1

name	LOC100042747 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263354 GeneID:100042747
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479390.1

name	EG544883 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263356 GeneID:544883 MGI:3647569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479409.1

name	EG544883 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63635154 GeneID:544883 MGI:3647569
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_619013.1

name	EG666806 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392989 GeneID:666806 MGI:3643794
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_999408.1

name	EG666806 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392991 GeneID:666806 MGI:3643794
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_999422.1

name	Oog1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38490533 GeneID:193322 MGI:2679150
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy product : oogenesin 1 protein_id : NP_848772.2

name	LOC100042776 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263359 GeneID:100042776
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479444.1

name	LOC100042786 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263362 GeneID:100042786
definition	codon_start : 1 product : similar to beacon protein_id : XP_001479454.1

name	LOC100038992 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263412 GeneID:100038992
definition	codon_start : 1 product : similar to beacon protein_id : XP_001472074.1

name	LOC100038982 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263410 GeneID:100038982
definition	codon_start : 1 product : similar to REX1, RNA exonuclease 1 homolog (S. cerevisiae) protein_id : XP_001472089.1

name	LOC100039042 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263414 GeneID:100039042
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472100.1

name	LOC100039052 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263416 GeneID:100039052
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472124.1

name	LOC100039076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263419 GeneID:100039076
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472159.1

name	LOC100039087 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263423 GeneID:100039087
definition	codon_start : 1 product : similar to Oog1 protein isoform 1 protein_id : XP_001472194.1

name	LOC100039087 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263425 GeneID:100039087
definition	codon_start : 1 product : similar to Oog1 protein isoform 2 protein_id : XP_001472217.1

name	LOC100039100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263427 GeneID:100039100
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472257.1

name	LOC100039191 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263440 GeneID:100039191
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472418.1

name	LOC627873 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263438 GeneID:627873
definition	codon_start : 1 product : similar to beacon protein_id : XP_001472400.1

name	LOC100039162 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263435 GeneID:100039162
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472372.1

name	LOC627881 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263433 GeneID:627881
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472342.1

name	LOC100039129 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263431 GeneID:100039129
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472309.1

name	LOC100039226 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263445 GeneID:100039226
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472491.1

name	EG667350 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263421 GeneID:667350 MGI:3646799
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995150.2

name	LOC546543 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263447 GeneID:546543
definition	codon_start : 1 product : similar to beacon protein_id : XP_001472516.1

name	LOC100039315 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263453 GeneID:100039315
definition	codon_start : 1 product : similar to Oog1 protein isoform 1 protein_id : XP_001472577.1

name	LOC100039315 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263455 GeneID:100039315
definition	codon_start : 1 product : similar to Oog1 protein isoform 2 protein_id : XP_001472603.1

name	EG666862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392995 GeneID:666862 MGI:3644018
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_999676.1

name	EG666862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392997 GeneID:666862 MGI:3644018
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_999684.1

name	EG435337 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701506 GeneID:435337 MGI:3648257
definition	codon_start : 1 product : hypothetical protein LOC435337 protein_id : NP_001013846.1

name	Adck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312430 CCDS:CCDS26087.1 GeneID:72113 MGI:1919363
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : aarF domain containing kinase 1 protein_id : NP_082381.1

name	LOC100039261 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263449 GeneID:100039261
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472613.1

name	EG666915 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393000 GeneID:666915 MGI:3648198
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999876.1

name	LOC100042239 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042239
definition	number : 4 pseudo : _no_value

name	LOC100042239 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042239
definition	number : 3 pseudo : _no_value

name	LOC100042239 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042239
definition	number : 2 pseudo : _no_value

name	LOC100042239 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042239
definition	number : 1 pseudo : _no_value

name	LOC673658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673658
definition	number : 4 pseudo : _no_value

name	LOC673658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673658
definition	number : 3 pseudo : _no_value

name	LOC673658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673658
definition	number : 2 pseudo : _no_value

name	LOC673658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673658
definition	number : 1 pseudo : _no_value

name	LOC674027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674027
definition	number : 1 pseudo : _no_value

name	LOC674027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674027
definition	number : 2 pseudo : _no_value

name	LOC674027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674027
definition	number : 3 pseudo : _no_value

name	EG667388 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667388
definition	number : 1 pseudo : _no_value

name	EG667388 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667388
definition	number : 2 pseudo : _no_value

name	EG667388 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667388
definition	number : 3 pseudo : _no_value

name	LOC100039154 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039154
definition	number : 2 pseudo : _no_value

name	LOC100039154 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039154
definition	number : 1 pseudo : _no_value

name	LOC667440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667440
definition	number : 1 pseudo : _no_value

name	LOC667440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667440
definition	number : 2 pseudo : _no_value

name	LOC667440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667440
definition	number : 3 pseudo : _no_value

name	LOC435314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435314
definition	number : 3 pseudo : _no_value

name	LOC435314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435314
definition	number : 2 pseudo : _no_value

name	LOC435314 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435314
definition	number : 1 pseudo : _no_value

name	LOC667287 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263346 GeneID:667287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 170 ESTs, 2 Proteins product : hypothetical LOC667287 pseudo : _no_value transcript_id : XR_033365.1

name	EG633031 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263357 GeneID:633031 MGI:3646386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins product : predicted gene, EG633031 pseudo : _no_value transcript_id : XR_034175.1

name	LOC100042778 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263360 GeneID:100042778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs, 2 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_034181.1

name	BB287469 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263407 GeneID:544881 MGI:3034635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence BB287469 pseudo : _no_value transcript_id : XR_035091.1

name	LOC100038964 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263408 GeneID:100038964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 77 ESTs, 2 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_030517.1

name	LOC100039203 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263441 GeneID:100039203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 ESTs, 2 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_030695.1

name	LOC636517 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263442 GeneID:636517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 14 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_030702.1

name	LOC544884 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263428 GeneID:544884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 122 ESTs, 6 Proteins product : similar to protein phosphatase 2A inhibitor-2 I-2PP2A pseudo : _no_value transcript_id : XR_030625.1

name	LOC432715 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263417 GeneID:432715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : similar to GLE1 RNA export mediator-like (yeast pseudo : _no_value transcript_id : XR_030604.1

name	LOC627971 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263450 GeneID:627971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 60 ESTs, 21 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_030722.1

name	LOC667395 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263451 GeneID:667395
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 12 ESTs, 10 Proteins product : hypothetical LOC667395 pseudo : _no_value transcript_id : XR_030733.1

name	EG638008 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263429 GeneID:638008 MGI:3648711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 21 Proteins product : predicted gene, EG638008 pseudo : _no_value transcript_id : XR_035650.1

name	LOC633093 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263436 GeneID:633093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins product : similar to REX1, RNA exonuclease 1 homolog (S. cerevisiae) pseudo : _no_value transcript_id : XR_030689.1

name	LOC100039383 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263456 GeneID:100039383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 19 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_030817.1

name	EG266459 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263458 GeneID:266459 MGI:3648085
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 13 Proteins product : predicted gene, EG266459 pseudo : _no_value transcript_id : XR_035755.1

name	LOC667475 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263457 GeneID:667475
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 7 Proteins product : similar to small nuclear ribonucleoprotein polypeptide A pseudo : _no_value transcript_id : XR_030827.1

name	LOC620915 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263443 GeneID:620915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 35 ESTs, 9 Proteins product : similar to Cdk5 and Abl enzyme substrate 2 pseudo : _no_value transcript_id : XR_030718.1

clone name	MSMg01-424D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461G21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-372M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-474B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-441G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-116G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-193H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-069D10.b	B6Ng01-069D10.g
ACC	DH887588	DH887589
length	811	1,105
definition	DH887588\|Mus musculus domesticus DNA, BAC clone: B6Ng01-069D10, 5' end.	DH887589\|Mus musculus domesticus DNA, BAC clone: B6Ng01-069D10, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaatacagaatggctgagaagcacctgaaaaaatg ttcagcatccttaatcatcagagaaatgcaaatcaaaacaacactgagat tccatctcacacaagtaagaaaggctaagataaaaaattcaggtgacagc agatgctggtgaggatgtggagaaagaggatcactcctccattgttggtg ggattgcaagcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacataatactaccggaggatcctgcaatacctctcctggga atatatccagaagatgtcccaaccagaaagtaggactcatgttccactat gttcagagcagtcttatttataatagccagaagctggaaagaacccagat gccccgcaacagaggaatggatacaaaaaatgtggtacatttacacattg gagtactactcaactattaaaaagaatgagtttatgaaattcctagggaa atggatggacctagagggcatcatcctgagtgaggaacacaatcacaaaa gaactcaaatgatatgttctttttttttttttttttctcttttttttttt tttcatttttaatccatttttatttttgtttctttcttgagtacagtttt ttttccattttttattaggtattttagctcatttacatttccaatgctat accaaaagtcccccttacccacccacccccactcccctacccacccactc cccccctttgggtctgggtttttccctgttccttgggattcaaaatcctg cgggtccaatg	gaattctttctgagtcatgatttcagagtattcagtcagagcttgcttgg ccccacattcttgcaatagggtgggatgaaaccccatgtggaaaaaaaaa atgaagaggccagtgaaagggatggaatccatcatgacaggcaaaaagag aggcagcaggaccagaaaccttcctttcttttttatttttttggtttaaa ccattttttattagatattttttcatttacaattcaaatgctatcctcaa agcccactataacctccccactccctgctccccaacccacccactcccac ttcctggctctggcattcccctgtactggggatataatctttgcaagacc aagggcctctcctcccaatgatggccgattagtccatcttctgttacata tgcaggtagagacatgagatcggtgttctggttagtttatattgctgttc ctcctatagggttacagaccccttcagctccttgggtactttctctagtt cctctattcaaggaggggtctgtgtaccatccaatagatgtctgtgagca tccacttctgtatttgccaggcactggcatagcctcataagagacagcta tatcagggtcatgtcagcaaaatcttgctggaatatacaatagtatctgc gtttggtgactgattatggtatggatccccaggtggggaagtctctggat ggtccttccttctgtctcagctccaaactttgtctctgtaactccttaca tggtattttgttccccattctaaggagggacgaagcatccatactttggt cttccttctccttgagcagcaccctttttagggcagtgcatgagaggaag tcaaaaccacagagaaatgaaaatagagatatcaattaagtcattgctct tactgtgcccaatcctcaaacttcgaatgaaatgcagtatggccaaaggc tcttcacatccaagagtatggaaagtggatttgcagtggagaagacaaat acatgtttatgatcagctggagaggtggtaaagatgtgctagagtatctt cagccagaaaaattagaacatgatgactgtaaaatatgtatcttgattac tcaaa
quality values	Open. Hide. 50 39 13 30 52 38 39 33 23 53 53 47 61 61 47 47 61 24 27 55 55 38 38 61 47 38 61 17 13 18 15 26 12 19 19 7 24 34 52 59 61 61 59 61 61 59 61 59 49 44 59 52 59 43 36 52 59 59 59 59 59 59 59 61 61 59 59 61 59 59 52 61 52 61 59 59 59 59 50 44 49 59 61 59 59 59 61 61 59 55 59 61 61 61 61 59 61 59 59 59 59 59 59 59 61 61 61 61 59 59 59 61 59 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 59 59 61 61 59 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 59 52 59 61 61 61 59 59 52 59 59 59 61 61 61 61 61 59 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 61 52 59 59 61 61 61 61 61 59 61 59 59 59 59 59 39 61 59 61 61 61 61 61 59 59 59 59 61 59 59 61 59 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 59 59 59 59 59 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 59 59 61 61 61 61 59 59 61 61 43 52 52 52 52 52 61 55 55 55 61 55 61 61 61 55 55 55 52 55 61 61 55 61 55 61 61 61 55 61 61 61 61 61 55 61 61 61 61 28 12 17 12 21 12 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 32 55 43 55 55 47 61 55 55 55 55 55 41 43 43 37 43 34 49 50 49 55 24 41 41 35 50 37 36 49 50 47 49 30 38 39 43 34 37 29 31 37 37 34 31 28 37 37 37 37 37 37 37 24 20 25 43 37 37 28 43 43 61 61 50 50 35 31 25 13 22 33 43 43 43 24 15 38 43 31 12 23 10 19 19 18 21 36 43 29 43 50 35 43 50 53 43 35 35 24 50 50 45 35 35 26 28 31 35 23 24 19 31 35 27 32 24 50 50 50 27 27 24 33 27 27 23 27 24 24 10 11 8 14 10 13 10 8 10 13 13 23 13 17 14 13 9 12 9 7 8 11 19 19 14 12 11 10 13 11 8 13 10 10 13 14 10 18 8 12 13 24 10 15 6 9 12 15 7 10 8 8 8 13 10 8 12 8 6 10 10 6 8 9 8 8 9 15 13 7 8 11 7 10 8 14 20 16 10 7 12 13 10 13 7 9 10 8 11 8 10 10 12 13	Open. Hide. 59 59 59 59 61 61 59 59 31 32 23 22 28 18 26 20 22 59 61 61 61 61 61 59 59 59 61 61 61 61 59 61 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 35 37 30 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 59 59 61 61 61 59 59 59 61 61 59 59 59 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 55 61 59 59 59 59 61 59 61 61 61 59 59 59 59 59 59 59 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 59 59 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 59 61 59 61 59 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 59 59 59 52 61 61 61 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 50 61 61 52 61 61 61 61 61 61 53 61 61 47 61 61 61 52 61 61 61 53 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 53 61 61 61 52 61 42 42 53 61 61 61 61 61 61 61 61 61 61 53 45 53 61 53 53 47 53 61 61 61 57 34 57 50 53 45 52 53 52 52 50 53 53 50 47 57 53 50 53 45 53 57 53 53 53 53 53 53 57 57 53 52 50 50 50 53 47 50 52 47 53 40 42 42 38 53 53 53 53 38 57 39 52 52 53 53 52 53 40 53 47 47 52 57 41 27 53 42 37 52 53 37 27 50 50 45 41 46 20 52 50 57 47 34 28 45 47 47 53 32 43 50 42 52 57 57 27 31 36 27 50 52 27 38 45 57 53 38 18 53 52 24 37 47 45 42 38 32 41 47 45 36 52 34 38 38 36 34 20 38 44 38 39 16 57 33 29 57 41 26 53 37 50 42 39 30 52 31 38 38 38 40 27 53 34 42 36 33 27 29 53 57 34 41 30 57 57 27 53 29 20 36 57 57 36 27 53 37 33 28 33 19 9 19 33 17 57 57 29 18 17 40 32 22 48 28 37 25 40 24 37 27 33 23 57 37 40 46 37 37 18 47 23 30 23 48 30 29 31 31 20 44 30 29 12 29 31 23 29 28 9 45 12 47 44 51 45 31 25 26 46 47 22 23 20 24 29 20 14 29 37 34 27 29 20 36 31 30 24 28 27 28 47 47 31 36 31 9 32 12 23 31 13 31 43 24 29 35 32 51 43 18 19 14 26 36 18 25 14 18 18 29 27 14 29 38 30 25 24 30 21 14 29 23 29 21 22 29 23 28 26 28 28 34 28 34 25 39 19 24 14 14 21 28 27 28 18 51 15 21 29 14 27 15 34 33 22 10 11 42 14 12 33 22 23 19 22 29 20 31 32 16 31 16 42 24 19 29 13 15 12 14 33 20 17 13 6 7 19 32 19 23 14 21 9 28 23 26 18 22 17 5 5 12 9 34 22 20 29 51 21 14 27 14 30 9 30 29 14 6 10 24 15 24 7 25 29 20 16 11 20 24 20 14 7 35 32 25 21 12 19 22 23 7 27 10 15 31 14 22 7 22 7 32 15 14 39 15 34 34 13 8 26 13 29 9 12 7 8 4 5 10 7 29 18 10 15 7 13 25 5 6 6 17 9 5 4 7 14 20 11 10 4 6 13 26 8 20 6 8 6 7 10 10 14 17 10 11 15 18 27 26 16 6 6 16 11 5 4 11 9 8 13 20 8 10 4 4 4 6 7 13 27 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_89279052_89280176
seq2: B6Ng01-069D10.g_69_1173

seq1  GAATTCTTTCTGAGTCATGATTTCAGAGTATTCAGTCAGAGCTTGCTTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCTGAGTCATGATTTCAGAGTATTCAGTCAGAGCTTGCTTGG  50

seq1  CCCCACATTCTTGCAATAGGGTGGGATGAAACCCCATGTGGAAAAAAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACATTCTTGCAATAGGGTGGGATGAAACCCCATGTGGAAAAAAAAA  100

seq1  ATGAAGAGGCCAGTGAAAGGGATGGAATCCATCATGACAGGCAAAAAGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAGAGGCCAGTGAAAGGGATGGAATCCATCATGACAGGCAAAAAGAG  150

seq1  AGGCAGCAGGACCAGAAACCTTCCTTTCTTTTTTATTTTTTTGGTTTAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGCAGGACCAGAAACCTTCCTTTCTTTTTTATTTTTTTGGTTTAAA  200

seq1  CCATTTTTTATTAGATATTTTTTCATTTACAATTCAAATGCTATCCTCAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTTTTTATTAGATATTTTTTCATTTACAATTCAAATGCTATCCTCAA  250

seq1  AGCCCACTATAACCTCCCCACTCCCTGCTCCCCAACCCACCCACTCCCAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCACTATAACCTCCCCACTCCCTGCTCCCCAACCCACCCACTCCCAC  300

seq1  TTCCTGGCTCTGGCATTCCCCTGTACTGGGGATATAATCTTTGCAAGACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGGCTCTGGCATTCCCCTGTACTGGGGATATAATCTTTGCAAGACC  350

seq1  AAGGGCCTCTCCTCCCAATGATGGCCGATTAGTCCATCTTCTGTTACATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGCCTCTCCTCCCAATGATGGCCGATTAGTCCATCTTCTGTTACATA  400

seq1  TGCAGGTAGAGACATGAGATCGGTGTTCTGGTTAGTTTATATTGCTGTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGGTAGAGACATGAGATCGGTGTTCTGGTTAGTTTATATTGCTGTTC  450

seq1  CTCCTATAGGGTTACAGACCCCTTCAGCTCCTTGGGTACTTTCTCTAGTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTATAGGGTTACAGACCCCTTCAGCTCCTTGGGTACTTTCTCTAGTT  500

seq1  CCTCTATTCAAGGAGGGGTCTGTGTACCATCCAATAGATGTCTGTGAGCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTATTCAAGGAGGGGTCTGTGTACCATCCAATAGATGTCTGTGAGCA  550

seq1  TCCACTTCTGTATTTGCCAGGCACTGGCATAGCCTCATAAGAGACAGCTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACTTCTGTATTTGCCAGGCACTGGCATAGCCTCATAAGAGACAGCTA  600

seq1  TATCAGGGTCATGTCAGCAAAATCTTGCTGGAATATACAATAGTATCTGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAGGGTCATGTCAGCAAAATCTTGCTGGAATATACAATAGTATCTGC  650

seq1  GTTTGGTGACTGATTATGGTATGGATCCCCAGGTGGGGAAGTCTCTGGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGGTGACTGATTATGGTATGGATCCCCAGGTGGGGAAGTCTCTGGAT  700

seq1  GGTCCTTCCTTCTGTCTCAGCTCCAAACTTTGTCTCTGTAACTCCTTACA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCCTTCCTTCTGTCTCAGCTCCAAACTTTGTCTCTGTAACTCCTTACA  750

seq1  TGGTATTTTGTTCCCCATTCTAAGGAGGGACGAAGCATCCATACTTTGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTATTTTGTTCCCCATTCTAAGGAGGGACGAAGCATCCATACTTTGGT  800

seq1  CTTCCTTCTCCTTGAGCAGCAACCTTTTTAGGGCAGTGCATGAGAGGAAG  850
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CTTCCTTCTCCTTGAGCAGCACCCTTTTTAGGGCAGTGCATGAGAGGAAG  850

seq1  TCAAAACCACAGAGAAATGAAAATAGAGATATCAATTAAGTCATTGCTCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAACCACAGAGAAATGAAAATAGAGATATCAATTAAGTCATTGCTCT  900

seq1  TACTGTGCCCAATCCTCAAACTTCGAATGAAATGCAGTATGGCCAAAGGC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGTGCCCAATCCTCAAACTTCGAATGAAATGCAGTATGGCCAAAGGC  950

seq1  TCTTCAACCAATCCAAGAGTATGGACAGTGGATTTGCAGGTGGAGAAGAC  1000
      ||||||    ||||||||||||||| |||||||||||| |||||||||||
seq2  TCTTCA---CATCCAAGAGTATGGAAAGTGGATTTGCA-GTGGAGAAGAC  996

seq1  AAAAATTACAATGTTTATGATCAGGCCTGGAGAGGTGGTAAAGATGTGGC  1050
      |||   ||| ||||||||||||||  ||||||||||||||||||||| ||
seq2  AAA---TAC-ATGTTTATGATCAG--CTGGAGAGGTGGTAAAGATGT-GC  1039

seq1  TCAGAGTATCTACAGGCCCAGTAAAAATCTAGACCATGATGACCTTGTAA  1100
      | ||||||||| |||  |||| |||||| |||| |||||||||  ||| |
seq2  T-AGAGTATCTTCAG--CCAG-AAAAAT-TAGAACATGATGAC--TGT-A  1081

seq1  AAATATGTATCTTGATTATCTCAAA  1125
      |||||||||||||||||| ||||||
seq2  AAATATGTATCTTGATTA-CTCAAA  1105

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information