MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-092F04
Chromosome	12 (Build37)
Map Location	20,464,539 - 20,465,697
singlet/doublet	singlet
Overlap gene	LOC100043371, LOC100042755
Upstream gene	EG627871, LOC100042698, LOC629055, EG668588, LOC100042706, EG668594, EG668600, LOC100042727, LOC673301, EG668605, LOC668614, LOC100042751, EG668455
Downstream gene	LOC100043377, LOC625810, 1700030C10Rik, 3110053B16Rik, LOC668698, LOC546752, EG629257, Ddef2, Itgb1bp1, Cpsf3, Iah1, Adam17, Ywhaq, LOC100043407
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG627871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC629055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	EG668588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG668594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668594 MGI:3645724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG668600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668600 MGI:3643303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	LOC100042727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC673301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	EG668605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC668614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100042751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	EG668455 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668455 MGI:3644169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 139 ESTs, 7 Proteins

name	LOC100042755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC100043377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC625810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	1700030C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69513 MGI:1916763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	3110053B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382686 MGI:1920435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	LOC668698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC546752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins pseudo : _no_value

name	EG629257 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629257 MGI:3643096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Ddef2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211914 MGI:2685438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb1bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16413 MGI:1306802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpsf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54451 MGI:1859328
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iah1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67732 MGI:1914982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11491 MGI:1096335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ywhaq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22630 MGI:891963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043407 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	EG668588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392464 GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668588 transcript_id : XM_001002492.1

name	LOC100042727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262801 GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Predicted gene, EG245297 transcript_id : XM_001478694.1

name	LOC100043371 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262883 GeneID:100043371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480491.1

name	EG668455 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392403 GeneID:668455 MGI:3644169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 139 ESTs, 7 Proteins product : predicted gene, EG668455 transcript_id : XM_001004798.1

name	LOC100043377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262885 GeneID:100043377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480493.1

name	LOC668698 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262803 GeneID:668698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478806.1

name	EG629257 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82941416 GeneID:629257 MGI:3643096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG629257 transcript_id : XM_894112.1

name	Ddef2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138527 GeneID:211914 MGI:2685438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : development and differentiation enhancing factor 2 transcript_id : NM_001004364.1

name	Itgb1bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802501 GeneID:16413 MGI:1306802
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 1 binding protein 1 transcript_id : NM_008403.3

name	Cpsf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980903 GeneID:54451 MGI:1859328
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cleavage and polyadenylation specificity factor 3 transcript_id : NM_018813.2

name	Iah1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067105 GeneID:67732 MGI:1914982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae) transcript_id : NM_026347.3

name	Adam17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347484 GeneID:11491 MGI:1096335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 17 transcript_id : NM_009615.5

name	Ywhaq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892422 GeneID:22630 MGI:891963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide transcript_id : NM_011739.3

name	LOC100043407 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262889 GeneID:100043407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100043407 transcript_id : XM_001480548.1

name	EG668588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392465 GeneID:668588 MGI:3648973
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2 protein_id : XP_001002492.1

name	LOC100042727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262802 GeneID:100042727
definition	codon_start : 1 product : similar to Predicted gene, EG245297 protein_id : XP_001478744.1

name	LOC100043371 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262884 GeneID:100043371
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480541.1

name	EG668455 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392404 GeneID:668455 MGI:3644169
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004798.1

name	LOC100043377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262886 GeneID:100043377
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480543.1

name	LOC668698 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262804 GeneID:668698
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478856.1

name	EG629257 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82941417 GeneID:629257 MGI:3643096
definition	codon_start : 1 product : similar to NADH dehydrogenase protein_id : XP_899205.1

name	Ddef2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138528 GeneID:211914 MGI:2685438
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : PYK2 C terminus-associated protein product : development and differentiation enhancing factor 2 protein_id : NP_001004364.1

name	Itgb1bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680488 CCDS:CCDS25833.1 GeneID:16413 MGI:1306802
definition	GO_function : GO:0005178 - integrin binding [Evidence ISS]; GO:0008022 - protein C-terminus binding [Evidence ISS] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0030155 - regulation of cell adhesion [Evidence ISS] codon_start : 1 product : integrin beta 1 binding protein 1 protein_id : NP_032429.1

name	Cpsf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980904 CCDS:CCDS25834.1 GeneID:54451 MGI:1859328
definition	GO_component : GO:0005847 - mRNA cleavage and polyadenylation specificity factor complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003729 - mRNA binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006378 - mRNA polyadenylation [Evidence ISS]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 product : cleavage and polyadenylation specificity factor 3 protein_id : NP_061283.2

name	Iah1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754071 CCDS:CCDS25835.1 GeneID:67732 MGI:1914982
definition	GO_function : GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 product : isoamyl acetate-hydrolyzing esterase 1 homolog protein_id : NP_080623.2

name	Adam17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347485 CCDS:CCDS25836.1 GeneID:11491 MGI:1096335
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : a disintegrin and metalloproteinase domain 17; TNF-alpha converting enzyme product : a disintegrin and metalloprotease domain 17 protein_id : NP_033745.4

name	Ywhaq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756039 CCDS:CCDS25837.1 GeneID:22630 MGI:891963
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0019904 - protein domain specific binding [Evidence IDA] GO_process : GO:0006605 - protein targeting [Evidence IDA]; GO:0007165 - signal transduction [Evidence TAS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IPI] codon_start : 1 note : 14-3-3 theta; 14-3-3 tau product : tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide protein_id : NP_035869.1

name	LOC100043407 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262890 GeneID:100043407
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480598.1

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 1 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 2 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 3 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 4 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 1 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 2 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 2 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 2 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 3 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 4 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 1 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 2 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 3 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 4 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 1 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 2 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 3 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 1 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 2 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 3 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 4 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 5 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 6 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 1 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 2 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 3 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 4 pseudo : _no_value

name	LOC625810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625810
definition	number : 1 pseudo : _no_value

name	LOC625810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625810
definition	number : 2 pseudo : _no_value

name	LOC625810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625810
definition	number : 3 pseudo : _no_value

name	3110053B16Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382686
definition	number : 3

name	3110053B16Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382686
definition	number : 2

name	3110053B16Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382686
definition	number : 1

name	EG627871 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94392463 GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627871 transcript_id : XR_002310.1

name	LOC629055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262881 GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034711.1

name	EG668605 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262882 GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : predicted gene, EG668605 pseudo : _no_value transcript_id : XR_002219.2

name	1700030C10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262887 GeneID:69513 MGI:1916763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 1700030C10 gene transcript_id : XR_035444.1

name	LOC546752 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262888 GeneID:546752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_035702.1

clone name	MSMg01-495C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-274C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-406L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062N07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-092F04.b	B6Ng01-092F04.g
ACC	DH904114	DH904115
length	1,154	1,268
definition	DH904114\|Mus musculus domesticus DNA, BAC clone: B6Ng01-092F04, 5' end.	DH904115\|Mus musculus domesticus DNA, BAC clone: B6Ng01-092F04, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcagaggacaacttgtggaagctggttctcttttcctaccatgtgg gtcttagggattgaacccaggctgccaggcttggaagcaagcgcctttac ccacagagtcagctctctggactaaatacagagatggtttagagcatgga gcaggaaggatgcagggtgcacataagcaccgctcctgtgaagaactgac tgctgactcatcctttactgtgtcgttctgatttctataggaagccctat agacagctaatgtgtgtgtatgctatacatgtgtgtgcagatgaacaccc acccgtgcagaggccaaacaggaataccggtgttcacagtataacctttt ctctctcactgaacccaaccggggcttaacattgtagctacgctgcctgc tcagcaagcttctgggactcacttgtcccctagttctagggtttccggca tgctcagccactcctggcatttccatgggtgttgggatcagatcaggtcc tcatgctgggtatcaagtgctcttccccactgagccattttcccagttct tgctttgacaattcttaatcacctatctcagatctcattagaggtttgtt tccttttcttttcttttcttttcttttcttttcttttcttttaaaaaaag acccgttttatagaattgtgtgaataaacctgatggatgagctcagctgg gacctgatgtccagcaagcaatcgatagatgcttggcttttatcgttact ctctgcaaagacatgcagtcctttagtacaccaggtagcaagtgggcaga ggaatgacctggtgtatggggccggggatgggggtcctggatccctgcac tccccatgcttaaggccctgtcaagtgcaggtacctgcactatctccagc atttcactgcagctgatgtagccattgctgtctaggtcagacatgctgag gcccacttcagcttctgttccagcttgtcccaagaggtcatgctcacagc aatgatgaaaacttggaagttgatggtgctgtcgccgttggtgtcaaagg gtgggaagacaatgttcaccgaacttgaaggcatctctgtaggggaagaa gttgggctgatcttgaattgtccacggccaggtgccggggacagtcattg agga	gaattcctctcgaaagtctttaccctatttatttaaaatgttcataagca ttacaggtgaaacttcaactcaatttcctttaaaatgttatggtacttac attataacttctgtgtcaggaagtcagtggaggaagcaccagaattgcat gaatatatggtcaaggaagcgtacatttactttacagtgatgtcagtacc atgctttgtgatgtacacatgtatgggatattttaggatgcagtgactta tgatgatgtgcatgtgaacttcactggggaagagtggaatttcctggatc cttcccagaagagtctctacaaagatgtgatgctggagacctactggaac ctcactgttataggtatgactgtgaattttcttttgcttttcaaaatagt ggggagacatgtctcttggttactgatggggctttgttatttcaattgag aacaaggaagactgagctgaataaatagtgtccagtgatgtgaaaattca cagtaccttgaattttgccttatttccaatactgtatcattcattattct ggtattgtcttttaggctacacttgggaaaaccatcatattgaaagacat tgtcaaagttcaagaagaaatgaaaggtaattttcacgtgaaagcttatg caattatgcctctaaggaaattttactatgatatggacgctctaaatcaa agcaggagtgtaaaatgtcaatacttgaagtgtaactatagttacaatat ttttaaaatatttattaatttattgtatataagtacactgtagctgtccg cagatactccagaaaagggcatcaaattttgttacagatggttatgaacc accatgtggttgccggaatttgatctcaggaccttcggaagagcagtctg tgctcttaccactgagccatcacggcagccctaattatactatcttaaaa aatgtactgcctagatatagttatcttatttatctatcaaagcattcttt tttaaaaaaaaaaagacgaggaacaatggccttaggataccttatcaatt gtacctctactagagctatactgatctgacatgtgttagactacagacta gatattgccactccgaaggtataaatattatgccaaaccttcgcatagca atatctcatggaaggtgtgtatccttatcttttatgaatgtactggtagt aagttgagagtcaagctgcgctggtgtgtccctagagaaactagtcctat atatcacgctcattgaga
quality values	Open. Hide. 61 47 35 37 61 38 33 43 61 61 61 47 49 55 61 61 61 61 61 61 61 61 61 61 43 55 59 55 59 52 61 61 61 61 61 61 61 61 61 61 61 61 61 59 49 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 53 61 61 61 61 61 52 61 47 52 61 50 61 61 47 61 52 61 61 61 61 53 61 61 61 61 61 61 61 61 61 53 61 52 61 61 61 61 61 61 61 61 61 47 61 61 61 50 61 61 61 61 50 61 61 45 61 61 61 57 52 57 53 41 57 57 57 53 53 57 57 53 53 57 57 57 53 50 24 57 53 57 53 53 53 50 57 53 53 42 53 57 53 57 57 57 53 53 45 50 57 45 45 53 50 40 53 53 50 45 57 34 47 32 53 57 57 50 57 53 50 57 45 57 57 53 57 40 57 57 53 57 35 57 57 53 57 50 57 57 53 57 50 57 57 57 57 50 57 57 57 57 42 57 57 53 57 38 57 57 53 52 57 57 57 47 57 57 34 53 23 28 47 53 50 57 57 52 50 42 50 30 57 52 45 57 52 33 52 50 50 53 47 50 53 52 53 47 57 53 53 52 32 57 57 41 32 50 53 33 57 53 50 37 45 53 52 46 57 52 34 17 43 52 57 38 26 46 33 53 52 39 45 53 41 53 52 53 30 46 52 40 40 50 40 52 44 47 34 47 50 53 50 53 53 30 57 41 41 37 40 42 40 36 32 39 38 50 50 42 53 50 52 50 37 25 57 53 40 38 23 24 52 47 44 39 36 30 40 34 39 57 37 40 40 32 33 38 28 38 52 33 27 57 35 52 30 42 26 42 40 42 53 57 53 40 37 29 52 21 53 53 24 30 39 33 10 29 37 44 34 37 40 30 34 35 53 57 45 45 24 53 27 53 53 40 29 14 39 57 57 57 48 33 32 53 27 47 25 28 25 23 39 32 30 32 21 23 28 29 25 45 44 31 24 29 48 28 16 34 32 39 34 39 6 44 31 30 44 32 35 20 35 39 28 29 21 29 25 38 25 25 20 30 25 29 21 23 29 32 33 31 33 33 28 29 28 28 27 25 37 51 34 31 19 29 29 29 28 30 22 30 38 27 14 11 27 31 31 23 35 41 15 32 34 34 28 29 26 22 30 28 32 23 29 19 33 30 12 39 14 14 28 33 34 28 24 25 5 16 6 41 26 15 28 25 23 25 22 5 16 23 28 18 20 31 24 15 28 21 21 20 26 24 5 13 7 9 20 15 9 7 10 24 10 20 14 25 19 22 28 16 12 18 9 10 8 10 23 23 24 20 29 33 18 15 19 25 7 7 8 12 13 7 16 18 34 12 31 28 9 28 9 21 22 9 20 12 8 7 7 8 8 38 38 8 22 13 35 11 12 12 10 10 8 38 15 27 14 7 5 5 10 11 33 13 6 15 7 9 12 19 13 22 8 15 11 8 16 8 17 17 8 10 7 6 5 12 18 6 4 7 7 7 8 10 6 5 8 6 18 34 42 8 8 4 5 11 6 4 8 7 12 26 19 12 10 5 9 4 5 17 20 5 29 5 11 11 5 4 8 11 6 8 15 12 7 8 8 10 22 9 21 3 4 8 6 13 20 10 6 9 7 4 5 11 15 20 10 14 5 12 16	Open. Hide. 55 47 55 49 49 52 52 43 50 49 50 28 43 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 47 61 61 61 53 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 47 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 52 61 61 61 53 47 40 61 61 61 61 61 61 61 61 61 61 53 61 61 61 45 61 61 61 61 61 61 61 61 61 50 53 43 57 57 50 57 45 57 57 53 53 40 53 52 53 53 57 52 57 57 57 57 57 57 57 57 53 53 45 53 47 53 53 52 57 50 53 57 57 53 57 53 53 57 30 42 47 57 57 47 53 47 57 57 43 45 57 39 38 57 53 57 53 35 57 47 47 35 53 53 47 42 45 41 23 53 45 45 57 57 57 52 42 52 52 50 53 45 57 57 38 53 53 53 53 45 53 50 33 43 39 52 45 38 45 45 52 45 45 50 45 47 22 57 42 57 38 42 57 52 53 38 50 42 39 53 41 39 38 45 50 53 44 27 27 50 53 53 45 41 24 53 52 45 52 37 47 43 38 37 29 15 43 37 42 40 53 29 18 57 57 40 38 52 19 36 25 38 42 36 50 52 57 53 39 50 42 47 47 21 40 40 47 40 44 53 37 29 21 14 24 48 24 40 37 43 31 57 57 57 44 33 57 57 47 34 38 25 41 36 37 29 23 29 48 37 57 41 40 36 40 46 28 40 37 37 40 28 51 39 41 37 43 27 38 24 44 27 41 35 41 40 40 24 30 57 22 33 29 19 40 24 26 34 35 33 48 28 32 46 46 45 29 24 46 47 35 20 31 29 27 44 34 26 51 51 39 20 15 31 21 29 18 28 34 20 30 39 10 34 29 28 29 28 33 29 23 11 25 29 26 35 48 34 39 33 35 34 28 22 48 27 29 26 31 31 51 31 23 20 15 29 27 28 14 17 12 23 10 29 23 39 28 14 27 29 29 23 41 14 28 27 14 34 29 26 30 24 29 28 26 28 29 39 14 31 16 16 26 27 29 29 23 33 28 16 28 25 16 20 20 29 23 29 22 30 36 26 13 20 39 25 31 20 28 19 28 22 24 25 6 5 20 27 51 46 46 46 38 24 25 16 16 26 21 29 21 19 17 23 17 26 14 14 28 19 12 27 15 20 18 16 30 15 13 12 38 12 10 11 15 12 7 11 19 22 29 19 8 21 17 33 7 22 9 44 44 51 51 51 16 39 44 44 44 44 44 44 44 44 30 8 32 12 6 15 7 20 32 23 9 6 9 28 5 14 24 30 20 6 7 5 6 6 11 26 26 9 6 7 8 28 6 8 5 29 27 12 7 9 24 5 3 7 10 5 6 11 6 4 6 10 11 11 7 9 5 10 9 17 11 25 9 6 17 8 5 25 4 3 4 4 4 8 7 3 10 20 20 4 5 18 5 10 8 21 6 6 16 11 13 25 19 24 9 6 8 5 5 3 5 6 6 5 2 4 6 25 5 9 30 10 16 4 3 6 6 10 9 15 10 16 27 12 5 21 6 13 17 7 4 3 3 20 10 7 10 9 4 13 3 6 6 12 6 4 18 3 8 13 6 3 4 9 5 8 1 3 5 19 18 6 12 6 18 4 5 14 13 8 1 1 3 4 5 5 2 1 2 3 7 1 3 9 1 9 4 6 3 4 1 12 4 15 7 5 7 5 19 6 8 4 4 9 7 4 9 4 4 4 4 18 4 8 4 16 8 9 8 12 10 18 4 6 16 19 3 13 5 3 4 7 5 4 5 2 3 6 8 4 8 4 3 3 10 4 5 7 5 9 9 7 8 5 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_20464539_20465697
seq2: B6Ng01-092F04.b_43_1196 (reverse)

seq1  TCCTCAATGACTGTCCCACTGGCCACCTGACCGTGGACAATTTCAAGATC  50
      |||||||||||||||||    | |||||| |||||||||| |||||||||
seq2  TCCTCAATGACTGTCCC---CGGCACCTGGCCGTGGACAA-TTCAAGATC  46

seq1  TAGCCCAACTTCTTCCCCTACAGAGATGCCTCCAAGTTCGCTGAACA-TG  99
       |||||||||||||||||||||||||||||| |||||||| |||||| ||
seq2  -AGCCCAACTTCTTCCCCTACAGAGATGCCTTCAAGTTCGGTGAACATTG  95

seq1  TCTTCCACACCTTTGACACCAACGGCGACAGCACCATCAACTTCCAAGTG  149
      ||||||   |||||||||||||||||||||||||||||||||||||||| 
seq2  TCTTCCCACCCTTTGACACCAACGGCGACAGCACCATCAACTTCCAAGTT  145

seq1  TTCATCATTGCTGTGAGCATGACCTCTTGGGACAAGCTGGAACAGAAGCT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATCATTGCTGTGAGCATGACCTCTTGGGACAAGCTGGAACAGAAGCT  195

seq1  GAAGTGGGCCTTCAGCATGTCTGACCTAGACAGCAATGGCTACATCAGCT  249
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  GAAGTGGGCC-TCAGCATGTCTGACCTAGACAGCAATGGCTACATCAGCT  244

seq1  GCAGTGAAATGCTGGAGATAGTGCAGGTACCTGCACTTGACAGGGCCTTA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTGAAATGCTGGAGATAGTGCAGGTACCTGCACTTGACAGGGCCTTA  294

seq1  AGCATGGGGAGTGCAGGGATCCAGGACCCCCATCCCCGGCCCCATACACC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATGGGGAGTGCAGGGATCCAGGACCCCCATCCCCGGCCCCATACACC  344

seq1  AGGTCATTCCTCTGCCCACTTGCTACCTGGTGTACTAAAGGACTGCATGT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCATTCCTCTGCCCACTTGCTACCTGGTGTACTAAAGGACTGCATGT  394

seq1  CTTTGCAGAGAGTAACGATAAAAGCCAAGCATCTATCGATTGCTTGCTGG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGCAGAGAGTAACGATAAAAGCCAAGCATCTATCGATTGCTTGCTGG  444

seq1  ACATCAGGTCCCAGCTGAGCTCATCCATCAGGTTTATTCACACAATTCTA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCAGGTCCCAGCTGAGCTCATCCATCAGGTTTATTCACACAATTCTA  494

seq1  TAAAACGGGTCTTTTTTTAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACGGGTCTTTTTTTAAAAGAAAAGAAAAGAAAAGAAAAGAAAAGAA  544

seq1  AAGAAAAGGAAACAAACCTCTAATGAGATCTGAGATAGGTGATTAAGAAT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAAAAGGAAACAAACCTCTAATGAGATCTGAGATAGGTGATTAAGAAT  594

seq1  TGTCAAAGCAAGAACTGGGAAAATGGCTCAGTGGGGAAGAGCACTTGATA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAAAGCAAGAACTGGGAAAATGGCTCAGTGGGGAAGAGCACTTGATA  644

seq1  CCCAGCATGAGGACCTGATCTGATCCCAACACCCATGGAAATGCCAGGAG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCATGAGGACCTGATCTGATCCCAACACCCATGGAAATGCCAGGAG  694

seq1  TGGCTGAGCATGCCGGAAACCCTAGAACTAGGGGACAAGTGAGTCCCAGA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTGAGCATGCCGGAAACCCTAGAACTAGGGGACAAGTGAGTCCCAGA  744

seq1  AGCTTGCTGAGCAGGCAGCGTAGCTACAATGTTAAGCCCCGGTTGGGTTC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTGCTGAGCAGGCAGCGTAGCTACAATGTTAAGCCCCGGTTGGGTTC  794

seq1  AGTGAGAGAGAAAAGGTTATACTGTGAACACCGGTATTCCTGTTTGGCCT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAGAGAGAAAAGGTTATACTGTGAACACCGGTATTCCTGTTTGGCCT  844

seq1  CTGCACGGGTGGGTGTTCATCTGCACACACATGTATAGCATACACACACA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCACGGGTGGGTGTTCATCTGCACACACATGTATAGCATACACACACA  894

seq1  TTAGCTGTCTATAGGGCTTCCTATAGAAATCAGAACGACACAGTAAAGGA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTGTCTATAGGGCTTCCTATAGAAATCAGAACGACACAGTAAAGGA  944

seq1  TGAGTCAGCAGTCAGTTCTTCACAGGAGCGGTGCTTATGTGCACCCTGCA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGTCAGCAGTCAGTTCTTCACAGGAGCGGTGCTTATGTGCACCCTGCA  994

seq1  TCCTTCCTGCTCCATGCTCTAAACCATCTCTGTATTTAGTCCAGAGAGCT  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCCTGCTCCATGCTCTAAACCATCTCTGTATTTAGTCCAGAGAGCT  1044

seq1  GACTCTGTGGGTAAAGGCGCTTGCTTCCAAGCCTGGCAGCCTGGGTTCAA  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCTGTGGGTAAAGGCGCTTGCTTCCAAGCCTGGCAGCCTGGGTTCAA  1094

seq1  TCCCTAAGACCCACATGGTAGGAAAAGAGAACCAGCTTCCACAAGTTGTC  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTAAGACCCACATGGTAGGAAAAGAGAACCAGCTTCCACAAGTTGTC  1144

seq1  CTCTGAATTC  1159
      ||||||||||
seq2  CTCTGAATTC  1154

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information