MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-132J22
Chromosome	12 (Build37)
Map Location	3,553,427 - 3,704,230
singlet/doublet	doublet
Overlap gene	Dtnb, LOC668197
Upstream gene	LOC668260, LOC668262, LOC668267, LOC668270, EG668274, LOC100041946, 1700012B15Rik, Rab10, Kif3c, LOC100043040, Asxl2, LOC627245
Downstream gene	Dnmt3a, LOC668289, Pomc1, C030014M07Rik, C330021A05Rik, Adcy3, Cenpo, 2410017P09Rik, Ncoa1, LOC100041995, LOC100042005, LOC100042014, Itsn2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668260 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC668262 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC668267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC668270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	EG668274 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668274 MGI:3644455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins

name	1700012B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74173 MGI:1921423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs

name	Rab10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19325 MGI:105066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16570 MGI:107979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043040 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Asxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75302 MGI:1922552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 156 ESTs, 12 Proteins pseudo : _no_value

name	Dtnb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13528 MGI:1203728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 7 Proteins pseudo : _no_value

name	Dnmt3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13435 MGI:1261827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 13 Proteins pseudo : _no_value

name	Pomc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18976 MGI:97742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030014M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668212 MGI:2444851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330021A05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217378 MGI:2443036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adcy3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104111 MGI:99675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52504 MGI:1923800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410017P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69709 MGI:1916959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 33 ESTs, 2 Proteins

name	Ncoa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17977 MGI:1276523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Itsn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20403 MGI:1338049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262772 GeneID:100041946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : similar to 1700012B15Rik protein transcript_id : XM_001477246.1

name	Rab10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352796 GeneID:19325 MGI:105066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB10, member RAS oncogene family transcript_id : NM_016676.4

name	Kif3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781816 GeneID:16570 MGI:107979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 3C transcript_id : NM_008445.2

name	LOC100043040 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262826 GeneID:100043040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : hypothetical protein LOC100043040 transcript_id : XM_001480016.1

name	Asxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801200 GeneID:75302 MGI:1922552
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : additional sex combs like 2 (Drosophila) transcript_id : NM_172421.2

name	Dtnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681234 GeneID:13528 MGI:1203728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrobrevin, beta transcript_id : NM_007886.1

name	Dnmt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145580 GeneID:13435 MGI:1261827
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3A transcript_id : NM_007872.4

name	Dnmt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224481 GeneID:13435 MGI:1261827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3A transcript_id : NM_153743.3

name	Pomc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346465 GeneID:18976 MGI:97742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pro-opiomelanocortin-alpha transcript_id : NM_008895.3

name	C030014M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723101 GeneID:668212 MGI:2444851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030014M07 gene transcript_id : NM_001082483.1

name	C330021A05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352689 GeneID:217378 MGI:2443036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330021A05 gene transcript_id : NM_153082.3

name	Adcy3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475810 GeneID:104111 MGI:99675
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 3 transcript_id : NM_138305.2

name	Cenpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373701 GeneID:52504 MGI:1923800
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein O transcript_id : NM_134046.4

name	Ncoa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754799 GeneID:17977 MGI:1276523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 1 transcript_id : NM_010881.1

name	LOC100041995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262774 GeneID:100041995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041995 transcript_id : XM_001477354.1

name	LOC100042005 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262776 GeneID:100042005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Dmn protein transcript_id : XM_001477368.1

name	LOC100042014 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262778 GeneID:100042014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042014 transcript_id : XM_001477387.1

name	Itsn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560562 GeneID:20403 MGI:1338049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intersectin 2 transcript_id : NM_011365.2

name	LOC100041946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262773 GeneID:100041946
definition	codon_start : 1 product : similar to 1700012B15Rik protein protein_id : XP_001477296.1

name	Rab10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710086 CCDS:CCDS25782.1 GeneID:19325 MGI:105066
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB10, member RAS oncogene family protein_id : NP_057885.1

name	Kif3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781817 CCDS:CCDS25783.1 GeneID:16570 MGI:107979
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : N-4 kinesin product : kinesin family member 3C protein_id : NP_032471.2

name	LOC100043040 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262827 GeneID:100043040
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480066.1

name	Asxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369555 GeneID:75302 MGI:1922552
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : polycomb group protein ASXH2 homolog protein_id : NP_766009.1

name	Dtnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681235 GeneID:13528 MGI:1203728
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dystrobrevin, beta protein_id : NP_031912.1

name	Dnmt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681209 GeneID:13435 MGI:1261827
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0000791 - euchromatin [Evidence ISS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS] [Evidence IDA]; GO:0006349 - imprinting [Evidence IMP] [Evidence ISS]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DNA methyltransferase 3A isoform 1 protein_id : NP_031898.1

name	Dnmt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371231 CCDS:CCDS25784.1 GeneID:13435 MGI:1261827
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0000791 - euchromatin [Evidence ISS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS] [Evidence IDA]; GO:0006349 - imprinting [Evidence IMP] [Evidence ISS]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DNA methyltransferase 3A isoform 2 protein_id : NP_714965.1

name	Pomc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679415 CCDS:CCDS25785.1 GeneID:18976 MGI:97742
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IDA] GO_process : GO:0008217 - blood pressure regulation [Evidence IGI]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : adrenal corticotropic hormone; alpha-melanocyte stimulating hormone; beta-melanocyte stimulating hormone; gamma-melanocyte stimulating hormone product : pro-opiomelanocortin-alpha protein_id : NP_032921.1

name	C030014M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723102 GeneID:668212 MGI:2444851
definition	codon_start : 1 product : hypothetical protein LOC668212 protein_id : NP_001075952.1

name	C330021A05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887607 CCDS:CCDS25786.1 GeneID:217378 MGI:2443036
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] codon_start : 1 product : Rab-related GTP-binding protein protein_id : NP_694722.2

name	Adcy3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270241 CCDS:CCDS25787.1 GeneID:104111 MGI:99675
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : adenylyl cyclase 3 product : adenylate cyclase 3 protein_id : NP_612178.1

name	Cenpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336049 CCDS:CCDS25788.1 GeneID:52504 MGI:1923800
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : centromere protein O protein_id : NP_598807.2

name	Ncoa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754800 CCDS:CCDS25789.1 GeneID:17977 MGI:1276523
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcriptional coactivator for steroid and nuclear hormone receptors note : SRC-a/NCoA-1; steroid receptor coactivator-1 product : nuclear receptor coactivator 1 protein_id : NP_035011.1

name	LOC100041995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262775 GeneID:100041995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477404.1

name	LOC100042005 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262777 GeneID:100042005
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477418.1

name	LOC100042014 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262779 GeneID:100042014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477437.1

name	Itsn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560563 GeneID:20403 MGI:1338049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : Eh domain, SH3 domain regulator of endocytosis 2 product : SH3 domain protein 1B protein_id : NP_035495.2

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 1 pseudo : _no_value

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 2 pseudo : _no_value

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 3 pseudo : _no_value

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 4 pseudo : _no_value

name	LOC668262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668262
definition	number : 1 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 1 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 2 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 3 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 4 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 5 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 6 pseudo : _no_value

name	EG668274 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668274
definition	number : 2 pseudo : _no_value

name	EG668274 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668274
definition	number : 1 pseudo : _no_value

name	LOC668270 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262771 GeneID:668270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to mKIAA1116 protein pseudo : _no_value transcript_id : XR_033129.1

name	1700012B15Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262825 GeneID:74173 MGI:1921423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : RIKEN cDNA 1700012B15 gene transcript_id : XR_035415.1

name	LOC627245 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262828 GeneID:627245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 156 ESTs, 12 Proteins product : similar to Odc1 protein pseudo : _no_value transcript_id : XR_034503.1

name	LOC668197 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262829 GeneID:668197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 7 Proteins product : similar to ribosomal protein S26 pseudo : _no_value transcript_id : XR_034504.1

name	LOC668289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262830 GeneID:668289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 13 Proteins product : similar to peptidylprolyl isomerase H (cyclophilin H) pseudo : _no_value transcript_id : XR_034506.1

name	2410017P09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262835 GeneID:69709 MGI:1916959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 33 ESTs, 2 Proteins product : RIKEN cDNA 2410017P09 gene transcript_id : XR_001632.2

clone name	MSMg01-528O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026P17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-132J22.b	B6Ng01-132J22.g
ACC	DH933377	DH933378
length	1,148	1,102
definition	DH933377\|Mus musculus domesticus DNA, BAC clone: B6Ng01-132J22, 5' end.	DH933378\|Mus musculus domesticus DNA, BAC clone: B6Ng01-132J22, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(3,703,088 - 3,704,230)	(3,553,427 - 3,554,531)
sequence	gaattctgcatgtgtccagataaacatgaatttatgggaattacttgcaa aggcatgggtaactcttaggaaactgcatccccaaaagcccgacccaagc atactccagcaccccaaaactgttgtgcagctgaggcctgattatatgaa gtgagatggggtaaggggctggaatctcaggtaagggtgggtctgcagtc atcagtcttctcctagaaggtaacgacctcatcttgtgggatgtctcagg aagcaatcacatctgctctaatttcaagatgataaaggcatgtcaccccc agaagacagagctccacagctataattccagaactcaggaggccacggca ggaggaccatgagtttgaggtcagcctgggatacacagtaggaacctatc ttaaaaacaaagacagacaaacccacacagctgcacatacaattagataa gacacgaagagtatgaaggagtaaaaccatgtcagatggcatgatctcac atgtagaaaaccctccagaactcacacaaaaggactactagagcagagtt cagcgcagctgcaggacgcaagatcaatgaacaaaacatcaattatattt ccaaatattaacagtgaacaagtctaaagtctagaaaaacaaattcattt acaatagcatcaaaataataaaatagccatgataaacataaccaaagtgt aagacttgcattcttaaaactataaaacatgcagtaggagacaacataaa taaatggaaggatgcctcgcattcatgagttagaaaactccaaagttgga aggtgacaacctccctgacatgacctgtagatggaatgcttccattatca atgccatagcagccctttttctgcagagcccattgagcagatttaataga aacacaaggagtatgggaaaagctaacctttacatccaaagggtcaaagc tggatgacaggtaaggcatgaattcagactttatttcaagaaagccagtt gatatctgttcaaatggtctgtagattctttagcaccacagaacatacca aatactaagagcttcctccacccttgcaagtgttcaggtcagaagttcag acccacacaatacatgttattgttgcctacgacccagagtaaagttca	gaattccatgatcgtgggcccactgtctgtgaaatgagctccttggtcag aagcaatactgtgtggaataccatgacgatagataaggcattctgtcagt ccctgaatggtggttttagcagaggcattacgtgcaggaaaggcaaatcc ataaccagaataagtatctactccagtaagaacaaaacgctgtcctttcc acgaaggaagtggtccaatgtagtcaacctgccaccaggttgctggctgg tcacctcgaggaatggtgccatatctggggctcagtgttggtttctgctg ttggcagatctggcattcagcagctgctgtagccaggtcagccttgttga ttggaagtccgtgttgctgagcccaagcataacctccatctcaaccacca tggccaggatcctgagtctgactcctggagcacacatcatcctgggcgca gtgtcatgcatccatgctgccgcatacccatatcaaacaggaggtggggg cagaggaatccatcagaagccctcctagaaagtatggtggcagaaacaag agagaccacgcctcaaaaacacaaaaggtggaaggaaagacccaaggccc ttttgaaaagctgccctctggggctggtgagatggctcagcgggtaagag cactgactgctcttccagaggtcctgagttcaaatcccaaaaaccacatg gtggctcacaactacctataatgagatctgacgccctcttctggtgtgtc tgaagctatagtgtacttatgtataataataaataaatattttaaaaaaa aaagaaagaaagctgtcctctgacctctgcatgggcaccatgcacacacg tatcccctcccccaacagattttgaagaaaaaaaaaaaaaaaaaccctgt tgcctggagaggtgacctcattagttaagagcccttgctgttcttgcaga ggacctgggtttagttatcagcactcccatggtgactcacacttgtctgt aacctccaggttctaggggttctgatgcttttctggtctctgagggcttt gtggcacacttaatacatggagggcaaatgctcataccaccaaactctaa aa
quality values	Open. Hide. 47 34 23 30 61 61 43 32 53 39 61 61 61 61 61 61 38 24 61 61 61 61 61 61 13 15 14 13 9 10 22 43 28 49 49 55 55 55 61 61 59 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 59 55 55 55 61 61 61 61 61 61 59 44 55 37 36 37 35 43 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 53 53 52 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 53 61 61 61 61 61 61 61 50 61 53 61 50 61 53 61 53 50 61 61 61 61 61 50 61 53 61 39 53 61 61 50 61 61 61 53 53 61 61 61 50 61 53 61 61 53 61 53 61 61 61 61 53 61 61 61 61 50 61 61 61 57 53 53 57 53 43 53 57 53 53 57 47 52 53 53 50 53 57 57 53 53 53 52 50 53 52 39 53 57 53 53 57 57 50 53 53 53 47 47 50 35 34 52 57 45 53 40 47 50 47 47 50 43 53 57 53 53 47 53 53 53 57 50 57 45 57 39 50 45 43 50 47 57 57 57 50 47 46 53 45 50 52 45 53 53 45 47 46 50 45 47 20 47 50 53 39 47 50 53 53 53 53 53 57 45 53 52 52 30 57 57 38 45 50 34 43 38 36 52 57 37 42 46 43 41 47 40 52 53 41 34 43 32 41 46 52 42 52 23 52 50 31 34 17 50 53 53 40 42 52 53 42 52 40 42 53 53 50 37 52 50 50 42 53 53 53 37 40 53 53 42 34 52 37 52 16 52 53 36 27 23 12 33 53 30 53 40 57 33 40 40 57 52 37 57 27 36 34 17 57 31 29 40 21 33 30 30 35 33 33 28 35 34 25 40 41 53 20 18 9 18 36 47 57 57 37 29 29 21 53 27 44 48 40 41 43 31 33 32 31 15 51 17 44 30 29 15 32 32 48 41 36 46 47 27 32 31 17 20 29 29 29 29 22 29 46 22 38 25 32 23 29 46 25 39 31 41 24 26 21 29 21 25 24 29 38 35 35 29 29 21 36 12 29 24 25 22 28 36 26 24 29 44 31 31 46 39 46 16 27 28 29 18 16 15 29 18 18 36 23 19 26 28 33 28 25 28 26 11 8 5 39 51 14 29 30 27 26 38 46 17 24 21 12 23 26 27 46 27 14 9 7 12 11 39 11 29 41 46 31 16 31 26 13 26 19 18 16 29 15 10 29 20 29 25 41 20 43 18 12 51 33 18 24 23 41 29 19 23 25 34 31 16 28 27 30 17 20 20 29 11 20 12 9 39 14 19 29 28 14 27 21 38 20 16 19 34 19 15 38 19 8 5 30 32 13 17 19 20 36 38 11 17 13 11 8 8 17 36 19 10 7 10 22 12 10 30 19 34 29 14 31 22 28 20 33 18 16 18 15 6 14 16 33 20 8 18 9 32 7 8 9 5 5 5 20 6 19 14 6 31 17 10 4 4 7 6 9 20 38 31 14 21 19 13 22 15 5 3 4 5 9 14 24 12 16 17 10 7 10 12 11 8 9 6 16 5 14 6 8 19 5 17 12 9 13 30 5 4 7 9 17 5 4 6 21 9 12 5 4 4 6 9 8 10 7 7 8 6 8 6 11 8 9 23 8 12 8 5 9 12 6 24 9 10 11 7 5 4 7 9 3 30 23 5 4 24 10 10 25 32 23 12 6 4 5 15	Open. Hide. 61 61 55 49 61 20 28 9 18 23 12 20 21 20 28 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 52 49 38 31 36 30 26 30 41 45 52 61 61 61 61 61 59 59 59 59 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 55 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 61 55 52 61 55 55 55 52 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 55 50 55 50 61 61 61 61 61 61 61 61 50 55 50 50 49 55 61 61 61 61 61 61 61 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 40 61 61 61 61 53 47 50 61 61 61 53 61 61 53 61 61 47 47 47 47 50 50 52 61 61 61 61 61 53 47 61 61 46 61 61 47 53 53 61 61 57 53 39 57 53 57 45 57 53 53 38 53 50 53 47 53 53 53 50 52 47 47 57 47 52 38 53 53 57 47 53 47 41 29 57 57 57 52 43 57 53 57 53 52 52 32 47 47 32 38 53 53 33 47 47 50 50 57 57 53 53 57 52 53 43 44 43 47 43 35 41 53 45 41 52 57 57 52 34 53 53 52 45 57 57 29 41 39 52 41 24 47 53 37 42 53 41 52 57 37 53 57 34 57 30 52 38 52 52 52 53 42 50 53 43 52 45 50 53 23 43 26 36 52 15 53 28 45 47 37 53 52 27 36 33 29 31 46 31 39 47 47 47 24 50 53 53 20 36 37 28 37 33 38 53 53 31 53 53 30 53 38 36 31 20 53 44 42 32 44 37 28 35 42 33 40 32 53 42 33 37 33 37 34 39 32 28 26 32 46 44 37 40 26 53 41 36 34 30 27 53 37 53 37 39 40 37 40 40 32 41 48 28 40 30 40 37 53 27 33 29 10 33 29 40 53 33 34 48 33 29 28 32 37 32 28 46 31 38 30 45 28 31 27 31 51 51 40 32 51 46 45 46 44 46 46 46 44 28 48 48 48 28 45 45 43 29 30 31 29 30 28 29 29 28 28 29 29 20 29 30 29 28 35 28 23 29 48 51 22 25 29 29 29 21 23 28 33 30 29 20 29 25 29 25 35 34 38 28 30 26 25 35 33 30 26 26 24 14 23 20 21 17 16 6 51 46 33 19 27 33 16 46 51 46 46 46 51 51 46 41 46 46 41 51 51 51 28 24 23 36 13 15 25 21 13 18 19 8 6 18 11 16 6 21 15 25 16 16 28 33 23 33 27 15 28 20 29 14 33 20 34 36 14 29 14 18 30 19 11 38 20 8 8 28 15 15 15 5 27 16 19 15 6 23 13 14 23 15 19 15 22 51 38 15 51 28 20 17 28 23 27 29 22 25 6 5 7 16 22 12 5 7 7 15 13 7 5 25 25 9 5 6 13 18 30 6 9 6 6 12 11 8 10 11 26 31 16 9 23 9 29 9 7 5 5 7 13 26 20 26 37 33 24 9 9 16 10 15 29 22 9 8 5 29 7 6 5 5 14 16 13 9 5 5 8 15 8 7 19 29 5 9 29 12 18 9 6 11 3 5 8 5 9 19 8 8 4 11 14 14 6 20 15 9 26 9 21 11 5 19 26 12 6 20 8 8 7 5 7 5 8 7 4 14 23 11 36 18 5 4 5 1 4 36 31 1

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_3703088_3704230
seq2: B6Ng01-132J22.b_50_1197 (reverse)

seq1  TGAACTTTACTCTGGGTTCTGTAGGCAACAATAACATGTA-TGTGTGTGT  49
      |||||||||||||||||   |||||||||||||||||||| |||||| ||
seq2  TGAACTTTACTCTGGGT--CGTAGGCAACAATAACATGTATTGTGTGGGT  48

seq1  CTGAAC-TCTGACCTGAACACTTGGCAGGGTGGAGG-AGCTCTTAGTATT  97
      |||||| |||||||||||||||||  |||||||||| |||||||||||||
seq2  CTGAACTTCTGACCTGAACACTTGCAAGGGTGGAGGAAGCTCTTAGTATT  98

seq1  TGTTGTGTTCTGTGGTGCT-AAGAATCTACAGACCATTTGAACAGATATC  146
      || | |||||||||||||| ||||||||||||||||||||||||||||||
seq2  TGGTATGTTCTGTGGTGCTAAAGAATCTACAGACCATTTGAACAGATATC  148

seq1  AAACTGGCTTTCTTGAAAT-AAGTCTGAATTCATGCCTTACCTGTCATCC  195
       |||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  -AACTGGCTTTCTTGAAATAAAGTCTGAATTCATGCCTTACCTGTCATCC  197

seq1  AGCTTTGACCCTTTGGATGT-AAGGTTAGCTTTT-CCATACTCCTTGTGT  243
      |||||||||||||||||||| ||||||||||||| |||||||||||||||
seq2  AGCTTTGACCCTTTGGATGTAAAGGTTAGCTTTTCCCATACTCCTTGTGT  247

seq1  TTCTATTAAATCTGCTCAATGGGCTCTGCAG-AAAAGGGCTGCTATGGCA  292
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TTCTATTAAATCTGCTCAATGGGCTCTGCAGAAAAAGGGCTGCTATGGCA  297

seq1  TTGATAATGGAAGCATTCCATCTACAGGTCATGTCAGGGAGGTTGTCACC  342
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATAATGGAAGCATTCCATCTACAGGTCATGTCAGGGAGGTTGTCACC  347

seq1  TTCCAACTTTGGAGTTTTCTAACTCATGAATGCGAGGCATCCTTCCATTT  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAACTTTGGAGTTTTCTAACTCATGAATGCGAGGCATCCTTCCATTT  397

seq1  ATTTATGTTGTCTCCTACTGCATGTTTTATAGTTTTAAGAATGCAAGTCT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATGTTGTCTCCTACTGCATGTTTTATAGTTTTAAGAATGCAAGTCT  447

seq1  TACACTTTGGTTATGTTTATCATGGCTATTTTATTATTTTGATGCTATTG  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACTTTGGTTATGTTTATCATGGCTATTTTATTATTTTGATGCTATTG  497

seq1  TAAATGAATTTGTTTTTCTAGACTTTAGACTTGTTCACTGTTAATATTTG  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGAATTTGTTTTTCTAGACTTTAGACTTGTTCACTGTTAATATTTG  547

seq1  GAAATATAATTGATGTTTTGTTCATTGATCTTGCGTCCTGCAGCTGCGCT  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATATAATTGATGTTTTGTTCATTGATCTTGCGTCCTGCAGCTGCGCT  597

seq1  GAACTCTGCTCTAGTAGTCCTTTTGTGTGAGTTCTGGAGGGTTTTCTACA  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCTGCTCTAGTAGTCCTTTTGTGTGAGTTCTGGAGGGTTTTCTACA  647

seq1  TGTGAGATCATGCCATCTGACATGGTTTTACTCCTTCATACTCTTCGTGT  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAGATCATGCCATCTGACATGGTTTTACTCCTTCATACTCTTCGTGT  697

seq1  CTTATCTAATTGTATGTGCAGCTGTGTGGGTTTGTCTGTCTTTGTTTTTA  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTATCTAATTGTATGTGCAGCTGTGTGGGTTTGTCTGTCTTTGTTTTTA  747

seq1  AGATAGGTTCCTACTGTGTATCCCAGGCTGACCTCAAACTCATGGTCCTC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAGGTTCCTACTGTGTATCCCAGGCTGACCTCAAACTCATGGTCCTC  797

seq1  CTGCCGTGGCCTCCTGAGTTCTGGAATTATAGCTGTGGAGCTCTGTCTTC  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCGTGGCCTCCTGAGTTCTGGAATTATAGCTGTGGAGCTCTGTCTTC  847

seq1  TGGGGGTGACATGCCTTTATCATCTTGAAATTAGAGCAGATGTGATTGCT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGTGACATGCCTTTATCATCTTGAAATTAGAGCAGATGTGATTGCT  897

seq1  TCCTGAGACATCCCACAAGATGAGGTCGTTACCTTCTAGGAGAAGACTGA  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGAGACATCCCACAAGATGAGGTCGTTACCTTCTAGGAGAAGACTGA  947

seq1  TGACTGCAGACCCACCCTTACCTGAGATTCCAGCCCCTTACCCCATCTCA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGCAGACCCACCCTTACCTGAGATTCCAGCCCCTTACCCCATCTCA  997

seq1  CTTCATATAATCAGGCCTCAGCTGCACAACAGTTTTGGGGTGCTGGAGTA  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCATATAATCAGGCCTCAGCTGCACAACAGTTTTGGGGTGCTGGAGTA  1047

seq1  TGCTTGGGTCGGGCTTTTGGGGATGCAGTTTCCTAAGAGTTACCCATGCC  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTGGGTCGGGCTTTTGGGGATGCAGTTTCCTAAGAGTTACCCATGCC  1097

seq1  TTTGCAAGTAATTCCCATAAATTCATGTTTATCTGGACACATGCAGAATT  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCAAGTAATTCCCATAAATTCATGTTTATCTGGACACATGCAGAATT  1147

seq1  C  1143
      |
seq2  C  1148

seq1: chr12_3553427_3554531
seq2: B6Ng01-132J22.g_66_1167

seq1  GAATTCCATGATCGTGGGCCCACTGTCTGTGAAATGAGCTCCTTGGTCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATGATCGTGGGCCCACTGTCTGTGAAATGAGCTCCTTGGTCAG  50

seq1  AAGCAATACTGTGTGGAATACCATGACGATAGATAAGGCATTCTGTCAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAATACTGTGTGGAATACCATGACGATAGATAAGGCATTCTGTCAGT  100

seq1  CCCTGAATGGTGGTTTTAGCAGAGGCATTACGTGCAGGAAAGGCAAATCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGAATGGTGGTTTTAGCAGAGGCATTACGTGCAGGAAAGGCAAATCC  150

seq1  ATAACCAGAATAAGTATCTACTCCAGTAAGAACAAAACGCTGTCCTTTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACCAGAATAAGTATCTACTCCAGTAAGAACAAAACGCTGTCCTTTCC  200

seq1  ACGAAGGAAGTGGTCCAATGTAGTCAACCTGCCACCAGGTTGCTGGCTGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAAGGAAGTGGTCCAATGTAGTCAACCTGCCACCAGGTTGCTGGCTGG  250

seq1  TCACCTCGAGGAATGGTGCCATATCTGGGGCTCAGTGTTGGTTTCTGCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCTCGAGGAATGGTGCCATATCTGGGGCTCAGTGTTGGTTTCTGCTG  300

seq1  TTGGCAGATCTGGCATTCAGCAGCTGCTGTAGCCAGGTCAGCCTTGTTGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCAGATCTGGCATTCAGCAGCTGCTGTAGCCAGGTCAGCCTTGTTGA  350

seq1  TTGGAAGTCCGTGTTGCTGAGCCCAAGCATAACCTCCATCTCAACCACCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAAGTCCGTGTTGCTGAGCCCAAGCATAACCTCCATCTCAACCACCA  400

seq1  TGGCCAGGATCCTGAGTCTGACTCCTGGAGCACACATCATCCTGGGCGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCAGGATCCTGAGTCTGACTCCTGGAGCACACATCATCCTGGGCGCA  450

seq1  GTGTCATGCATCCATGCTGCCGCATACCCATATCAAACAGGAGGTGGGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCATGCATCCATGCTGCCGCATACCCATATCAAACAGGAGGTGGGGG  500

seq1  CAGAGGAATCCATCAGAAGCCCTCCTAGAAAGTATGGTGGCAGAAACAAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGAATCCATCAGAAGCCCTCCTAGAAAGTATGGTGGCAGAAACAAG  550

seq1  AGAGACCACGCCTCAAAAACACAAAAGGTGGAAGGAAAGACCCAAGGCCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGACCACGCCTCAAAAACACAAAAGGTGGAAGGAAAGACCCAAGGCCC  600

seq1  TTTTGAAAAGCTGCCCTCTGGGGCTGGTGAGATGGCTCAGCGGGTAAGAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGAAAAGCTGCCCTCTGGGGCTGGTGAGATGGCTCAGCGGGTAAGAG  650

seq1  CACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCCAAAAACCACATG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATCCCAAAAACCACATG  700

seq1  GTGGCTCACAACTACCTATAATGAGATCTGACGCCCTCTTCTGGTGTGTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCTCACAACTACCTATAATGAGATCTGACGCCCTCTTCTGGTGTGTC  750

seq1  TGAAGCTATAGTGTACTTATGTATAATAATAAATAAATATTTTAAAAAAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCTATAGTGTACTTATGTATAATAATAAATAAATATTTTAAAAAAA  800

seq1  AAAGAAAGAAAAGCTGTCCTCTGACCTCTGCATGGGCACCATGCACACAC  850
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAAG-AAAGCTGTCCTCTGACCTCTGCATGGGCACCATGCACACAC  849

seq1  GTATCCCCTCCCCCAACAGATTTTGAAGAAAAAAAAAAAAAAAAACCCTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATCCCCTCCCCCAACAGATTTTGAAGAAAAAAAAAAAAAAAAACCCTG  899

seq1  TTGCCTGGAGAGGTGACCTCATTAGTTAAGAGCCCTTGCTGTTCTTGCAG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTGGAGAGGTGACCTCATTAGTTAAGAGCCCTTGCTGTTCTTGCAG  949

seq1  AGGACCTGGGTTTAGTTATCAGCACTCACATGGTGACTCACAACTGTCTG  1000
      ||||||||||||||||||||||||||| ||||||||||||||  ||||||
seq2  AGGACCTGGGTTTAGTTATCAGCACTCCCATGGTGACTCACACTTGTCTG  999

seq1  TAA-CTCCA-GCTCTAGGGG-TCTGATGCCTTTTTCTGGTCTCTGAGGGC  1047
      ||| ||||| | |||||||| ||||||||  |||||||||||||||||||
seq2  TAACCTCCAGGTTCTAGGGGTTCTGATGC--TTTTCTGGTCTCTGAGGGC  1047

seq1  -TTGTGGCACACTTATATACATGAAGGCAAAATGCTCATACACACCAAAA  1096
       |||||||||||||| ||||||| |||  |||||||||||| |||| |||
seq2  TTTGTGGCACACTTA-ATACATGGAGGGCAAATGCTCATAC-CACC-AAA  1094

seq1  CTCCTAAAA  1105
      || ||||||
seq2  CT-CTAAAA  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information