MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-139I02
Chromosome	12 (Build37)
Map Location	23,957,460 - 23,958,314
singlet/doublet	singlet
Overlap gene	none
Upstream gene	2410018L13Rik, LOC77114, EG668669, EG668670, LOC668680, LOC100042895, LOC100043435, EG628081, LOC100042903
Downstream gene	LOC100043440, EG668518, LOC100043445, LOC668697, LOC100042923, LOC677338, EG668701, LOC668471, LOC668703, LOC546534, 9030624G23Rik, EG668710
Link	Open Mouse BAC browser

Click to get alignment info.

name	2410018L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69732 MGI:1916982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC77114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:77114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	EG668669 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668669 MGI:3648889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG668670 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668670 MGI:3645836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins

name	LOC668680 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668680
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC100042895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043435 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	EG628081 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628081 MGI:3649030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	LOC100042903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	EG668518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668518 MGI:3644931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein

name	LOC100043445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins pseudo : _no_value

name	LOC668697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100042923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC677338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	EG668701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668701 MGI:3647521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 18 Proteins pseudo : _no_value

name	LOC668471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC668703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC546534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins

name	9030624G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66808 MGI:1914058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	EG668710 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668710 MGI:3647775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 1 Protein

name	2410018L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575896 GeneID:69732 MGI:1916982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018L13 gene transcript_id : NM_028362.1

name	LOC77114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94392501 GeneID:77114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : similar to development and differentiation enhancing factor 2, transcript variant 2 transcript_id : XM_895036.2

name	EG668669 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392502 GeneID:668669 MGI:3648889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, EG668669 transcript_id : XM_001003013.1

name	EG668670 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262806 GeneID:668670 MGI:3645836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : predicted gene, EG668670 transcript_id : XM_001478977.1

name	EG668518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262900 GeneID:668518 MGI:3644931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein product : predicted gene, EG668518, transcript variant 1 transcript_id : XM_001004836.2

name	LOC100042923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262808 GeneID:100042923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001479080.1

name	LOC668471 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262901 GeneID:668471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical LOC668471 transcript_id : XM_001480611.1

name	LOC546534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262811 GeneID:546534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 transcript_id : XM_001479109.1

name	9030624G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392513 GeneID:66808 MGI:1914058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 9030624G23 gene transcript_id : XM_001003228.1

name	EG668710 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392515 GeneID:668710 MGI:3647775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 1 Protein product : predicted gene, EG668710 transcript_id : XM_001003237.1

name	2410018L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575897 GeneID:69732 MGI:1916982
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69732 protein_id : NP_082638.1

name	LOC77114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82941122 GeneID:77114
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_900129.1

name	EG668669 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392503 GeneID:668669 MGI:3648889
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003013.1

name	EG668670 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262807 GeneID:668670 MGI:3645836
definition	codon_start : 1 product : similar to neural visinin-like Ca2+-binding protein type 3 protein_id : XP_001479027.1

name	EG668518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392426 GeneID:668518 MGI:3644931
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_001004836.1

name	LOC100042923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262809 GeneID:100042923
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479130.1

name	LOC668471 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262902 GeneID:668471
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480661.1

name	LOC546534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262812 GeneID:546534
definition	codon_start : 1 product : similar to neural visinin-like Ca2+-binding protein type 3 protein_id : XP_001479159.1

name	9030624G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392514 GeneID:66808 MGI:1914058
definition	codon_start : 1 product : hypothetical protein LOC66808 protein_id : XP_001003228.1

name	EG668710 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392516 GeneID:668710 MGI:3647775
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003237.1

name	LOC668680 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668680
definition	number : 3 pseudo : _no_value

name	LOC668680 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668680
definition	number : 2 pseudo : _no_value

name	LOC668680 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668680
definition	number : 1 pseudo : _no_value

name	LOC100042895 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042895
definition	number : 1 pseudo : _no_value

name	LOC100042895 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042895
definition	number : 2 pseudo : _no_value

name	LOC100042895 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042895
definition	number : 3 pseudo : _no_value

name	LOC100043435 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043435
definition	number : 1 pseudo : _no_value

name	LOC100043435 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043435
definition	number : 2 pseudo : _no_value

name	LOC100043435 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043435
definition	number : 3 pseudo : _no_value

name	EG628081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628081
definition	number : 3 pseudo : _no_value

name	EG628081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628081
definition	number : 2 pseudo : _no_value

name	EG628081 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628081
definition	number : 1 pseudo : _no_value

name	LOC100042903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042903
definition	number : 3 pseudo : _no_value

name	LOC100042903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042903
definition	number : 2 pseudo : _no_value

name	LOC100042903 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042903
definition	number : 1 pseudo : _no_value

name	LOC100043440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043440
definition	number : 3 pseudo : _no_value

name	LOC100043440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043440
definition	number : 2 pseudo : _no_value

name	LOC100043440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043440
definition	number : 1 pseudo : _no_value

name	LOC100043445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043445
definition	number : 3 pseudo : _no_value

name	LOC100043445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043445
definition	number : 2 pseudo : _no_value

name	LOC100043445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043445
definition	number : 1 pseudo : _no_value

name	LOC668697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668697
definition	number : 3 pseudo : _no_value

name	LOC668697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668697
definition	number : 2 pseudo : _no_value

name	LOC668697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668697
definition	number : 1 pseudo : _no_value

name	LOC677338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677338
definition	number : 3 pseudo : _no_value

name	LOC677338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677338
definition	number : 2 pseudo : _no_value

name	LOC677338 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677338
definition	number : 1 pseudo : _no_value

name	LOC668703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668703
definition	number : 1 pseudo : _no_value

name	LOC668703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668703
definition	number : 2 pseudo : _no_value

name	LOC668703 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668703
definition	number : 3 pseudo : _no_value

name	EG668701 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262810 GeneID:668701 MGI:3647521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 18 Proteins product : predicted gene, EG668701 pseudo : _no_value transcript_id : XR_034054.1

clone name	B6Ng01-164H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-139I02.b	B6Ng01-139I02.g
ACC	DH938470	DH938471
length	1,249	857
definition	DH938470\|Mus musculus domesticus DNA, BAC clone: B6Ng01-139I02, 5' end.	DH938471\|Mus musculus domesticus DNA, BAC clone: B6Ng01-139I02, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcctctccaaagtctttaccctatttatttaaaatgttcataagca acacaggtgaaccttcaactcaatttcctttaaaatgttatggtacttag attataacttctgtgtcaggaaatcagtggaggaagcaccaaaattgcat gaatatatggtgaaggaagcatacgtttactttacagtgatgtcagtacc atgttttgtgatttacacatgtatgggatattttaggatgcagtgactta tgatgatgtgcatgtgaacttcactggggaagagtggaatttgctggatc cttcccagaagagtctctacaaagatgtgatgctggagacctactggaac ctcactgttataggtatgactgtaaattttctttgcttttcaaaatagta ggaaaacatgtctcttgtttagtgatggtgctctgttattacaactgaga acaaggaagactgagctgaataaatagtgtccagtgatgtgaaaattcac agtaccttgaattttgcctatttccaatactggatcattcatttttctcg tactgtcttttaggctacacttgggaaaaccatcatattgaaagacattg tcaaagttcaagaagaaatgaaaggtaattttcatgtgcaagctgctgcg attatgcctctaaggaaattttactatgatatggaagctctaaagaaaag caggagtgtaaaatgtcaatacttgaagtgtaactaaaattacaatattt ttttaagatttatttatttattatatgtaaatatactgtagctgtcctca gatactccagaagagggcatcagatttcgttatggatgattgtgagccac catatggttgttgggatttgaactcaggacctcggaagagcagtctgtgc tcttaaacactgagccatcttgccggccctaataatactattcttaaaaa aatatactgccctcgatgtagttatctgattatccatcaaaagcattctt cttttttaaaaaagatgaggaaacattgccttagaggataacctttattc attggaactctattagagcttatactgaactgacatggtgatagactaac agacttaaaatgcacatcgatatggaaatatatattcaaaacctccatta gcattagccttggaagtggtgtcactaattccttagcgactgaatcttgt ttaggtaccgtttataggtctagagtggttctctaagggataaacccta	gaattccaggatagccagagctatacagagaaaccctgtctcaaaaacaa acaaacaaacaaacaaacaaacaaaaaaacaaaaaaaccaaaccaaacca aacaaaaaaaaaaagatcacagatgtcttcttggagtctgtagacgccag aagggtttgcacacatgtgctgcaaaaacaacagatgcctggattttaat atgtaaaaaaaggactacaccgttaatggaaaaaattaagatagtccatg ataaactcaaatttaaacaacctctctctaaacatactgaccaacacaaa gagatagaggtagaatctaaccgaggaagttaaggatacacatgaaaaca caggtagtaaataatctcttactgtctacaaaagaagggaaggcacacac acagcccaacaccaacaccacccgcagctgcaacaacaacaaaatacaag gagttagcaatcaccatttattgactcattcaataaaaataagttttgat ttgggagaaaatgtagctgtaagttggcccaggactttgaggtttttgtg tttgaaagctatacaactttctgtctcaggttgggtgtgggcggtggggt tttgaagataaacttctgagtatgcttttgtgtctctcactgataagtag tgacttaattctaataagttcttttccccccctcccgcccccccagacag ggtttctctgtgtagccctgggttgtcctggaacacactctagacttgtt gggcctctaactcagaaatctgcctgcatctgcctcccgagtgctaggat tatagggagtgcaccaccaccacccagcccaataaattcttatcattgca gtgtctt
quality values	Open. Hide. 57 42 34 38 61 61 61 61 61 61 61 27 8 47 61 47 61 61 61 61 61 61 61 50 19 15 11 21 21 26 17 22 20 15 52 50 55 61 47 40 49 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 45 52 59 44 59 28 28 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 37 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 59 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 40 61 61 61 61 61 61 61 61 61 47 53 61 53 61 61 45 61 61 61 61 61 61 61 61 53 52 50 45 61 61 61 53 47 43 47 57 53 53 57 53 45 53 50 57 53 50 57 57 53 32 53 47 46 57 53 42 19 53 39 40 57 57 53 53 39 53 57 52 53 53 40 53 45 53 53 57 48 53 53 47 47 47 36 30 50 38 43 50 57 52 52 50 30 53 47 57 42 42 40 22 53 57 52 53 53 39 53 50 52 35 38 50 50 37 31 52 53 38 41 40 52 50 38 41 38 37 53 57 57 57 35 37 52 32 47 46 24 37 41 30 23 53 53 53 40 53 39 33 19 31 52 34 45 35 47 31 33 32 42 42 50 28 32 37 37 29 22 52 41 40 33 53 42 45 26 52 38 52 42 57 57 57 57 57 29 21 52 24 39 19 53 37 37 34 57 39 42 50 51 37 36 34 53 52 30 37 32 38 27 41 57 47 42 38 50 23 52 24 38 10 14 13 34 35 57 29 40 41 28 40 23 27 37 26 35 39 37 48 52 26 24 53 46 28 34 7 57 24 24 28 29 27 16 20 52 29 57 33 37 28 40 53 29 33 37 40 30 17 23 25 8 9 40 16 33 32 18 40 31 11 37 10 9 30 23 19 10 43 13 29 41 15 33 30 47 30 32 19 48 38 21 32 13 14 27 29 29 28 30 32 20 25 44 13 17 44 29 33 13 38 15 29 13 12 8 27 25 27 10 9 13 11 10 9 29 32 47 12 17 12 28 31 28 33 33 32 24 14 28 28 13 31 26 18 18 7 7 10 20 14 29 29 14 14 20 26 18 30 14 7 13 39 11 25 17 14 8 30 41 46 41 41 29 16 15 25 22 28 31 41 12 43 12 17 28 13 10 13 16 12 20 28 46 9 14 18 18 27 29 19 9 17 10 11 6 5 10 9 12 5 36 46 9 7 11 10 16 17 29 9 10 8 23 28 51 41 38 17 23 36 30 41 36 27 14 29 7 7 14 13 16 31 51 7 17 19 27 15 14 20 25 16 18 51 10 15 5 5 9 10 8 7 6 6 5 38 21 8 6 28 20 27 32 28 6 7 8 5 10 8 15 26 22 19 27 7 5 6 9 27 19 8 11 9 6 30 19 34 11 12 5 5 6 7 11 19 7 19 13 5 5 5 4 6 7 17 18 30 11 6 4 6 10 12 6 7 20 15 6 3 4 3 9 6 8 14 24 29 14 11 28 5 7 5 8 5 4 3 7 7 10 4 3 4 5 5 6 13 5 34 15 5 9 12 11 3 8 11 9 5 16 5 8 11 5 5 18 6 18 23 6 7 23 5 4 7 4 3 5 8 8 6 4 2 1 3 4 4 5 13 15 5 5 7 7 5 2 1 4 6 3 8 3 2 5 6 7 18 4 3 9 3 4 3 10 18 3 5 4 4 15 13 13 5 5 12 6 3 13 8 15 8 7 3 11 3 4 8 4 6 3 3 10 7 3 9 15 4 23 5 9 7 18 14 3 3 19 3 7 7	Open. Hide. 55 47 61 47 28 28 36 11 17 20 14 21 27 55 55 49 49 55 55 59 59 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 44 43 59 43 37 30 36 36 35 45 61 61 61 59 61 61 61 55 44 59 61 59 59 59 55 55 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 59 59 61 61 59 55 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 49 61 59 52 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 55 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 61 61 59 61 61 61 61 61 61 59 59 61 59 61 59 59 59 61 59 59 59 61 55 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 43 55 61 61 55 61 61 61 55 55 61 55 61 61 61 61 47 61 61 43 49 61 61 49 61 61 61 61 61 47 61 55 61 61 61 61 61 53 53 61 61 61 50 61 61 61 53 61 53 61 61 53 53 53 61 61 61 61 61 61 61 61 61 61 61 52 61 39 61 50 50 61 61 61 50 61 50 61 61 61 52 61 61 39 61 61 61 61 45 61 61 61 30 37 47 27 33 34 43 53 50 47 61 53 45 50 45 53 43 39 31 42 61 38 61 53 30 61 57 45 50 45 50 45 53 53 52 23 30 36 53 53 43 46 46 47 24 47 42 33 38 32 27 32 30 39 43 38 38 30 12 12 32 29 40 36 45 53 52 38 31 38 47 9 52 45 34 42 42 42 42 12 10 10 6 6 8 14 11 27 26 15 24 24 28 36 16 32 32 38 20 17 24 32 39 28 35 23 42 38 53 22 39 12 38 37 50 24 12 12 10 7 14 22 9 23 23 14 28 10 14 30 21 30 30 25 28 31 34 31 39 13 37 15 37 24 29 19 19 33 53 32 18 31 23 17 21 22 17 17 38 24 30 18 35 36 47 30 30 6 21 29 20 11 24 17 14 23 28 29 26 27 33 38 30 30 20 19 33 23 17 33 17 20 21 23 26 17 8 39 15 10 15 9 37 26 52 30 23 31 35 21 33 38 15 9 37 20 27 33 8 29 27 31 16 20 23 16 10 14 20 16 13 17 14 29 12 17 13 12 30 21 25 17 23 53 20 23 16 5 23 18 6 7 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_23957460_23958314
seq2: B6Ng01-139I02.g_70_926

seq1  GAATTCCAGGATAGCCAGAGCTATACAGAGAAACCCTGTCTCAAAAACAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGATAGCCAGAGCTATACAGAGAAACCCTGTCTCAAAAACAA  50

seq1  ACAAACAAACAAACAAACCAACAACAAA--AAAAAAACCAAACCAAACCA  98
      |||||||||||||||||| ||||| |||  ||||||||||||||||||||
seq2  ACAAACAAACAAACAAACAAACAAAAAAACAAAAAAACCAAACCAAACCA  100

seq1  AACAAAAAAAAAAAAGATCACAGATGTCTTCTTGGAGTCTGTAGACGCCA  148
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAC-AAAAAAAAAAAGATCACAGATGTCTTCTTGGAGTCTGTAGACGCCA  149

seq1  GAAGGGTTTGCACACATGTGCTGCAAAAACAACAGATGCCTGGATTTTAA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGTTTGCACACATGTGCTGCAAAAACAACAGATGCCTGGATTTTAA  199

seq1  TATGTAAAAAAAGGACTACACCGTTAATGGAAAAAATTAAGATAGTCCAC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TATGTAAAAAAAGGACTACACCGTTAATGGAAAAAATTAAGATAGTCCAT  249

seq1  GATAAACTCAAATTTAAACAACCTCTCTCTAAACATACTGACCAACACAA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAAACTCAAATTTAAACAACCTCTCTCTAAACATACTGACCAACACAA  299

seq1  AGAGATAGAGGTAGAATCTAACCGAGGAAGTTAAGGATACACGTGAAAAC  348
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AGAGATAGAGGTAGAATCTAACCGAGGAAGTTAAGGATACACATGAAAAC  349

seq1  ACAGGTAGTAAATAATCTCTTACTGTCTACAAAAGAAGGGAAGGCACACA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGTAGTAAATAATCTCTTACTGTCTACAAAAGAAGGGAAGGCACACA  399

seq1  CACAGCCCAACACCAACACCACCCGCAGCTGCAACAACAACAAAATACAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGCCCAACACCAACACCACCCGCAGCTGCAACAACAACAAAATACAA  449

seq1  GGAGTTAGCAATCACCATTTATTGACTCATTCAATAAAAATAAGTTTTGA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGTTAGCAATCACCATTTATTGACTCATTCAATAAAAATAAGTTTTGA  499

seq1  TTTGGGAGAAAATGTAGCTGTAAGTTGGCCCAGGACTTTGAGGTTTTTGT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGGAGAAAATGTAGCTGTAAGTTGGCCCAGGACTTTGAGGTTTTTGT  549

seq1  GTTTGAAAGCTATACAACTTTCTGTCTCAGGTTGGGTGTGGGCGGTGGGG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGAAAGCTATACAACTTTCTGTCTCAGGTTGGGTGTGGGCGGTGGGG  599

seq1  TTTTGAAGATAAACTTCTGAGTATGCTTTTGTGTCTCTCACTGATAAGTA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGAAGATAAACTTCTGAGTATGCTTTTGTGTCTCTCACTGATAAGTA  649

seq1  GTGACTTAATTCTAATAAGTTCTTTCCCCCCCTCCCCCCCCCCCCAGACA  698
      ||||||||||||||||||||||||| ||||||  ||| ||||||||||||
seq2  GTGACTTAATTCTAATAAGTTCTTTTCCCCCCCTCCCGCCCCCCCAGACA  699

seq1  GGGTTTCTCTGTGTAGACCT-GGCTGTCCTGGAACACACTCTAGACTTGT  747
      |||||||||||||||| ||| || ||||||||||||||||||||||||||
seq2  GGGTTTCTCTGTGTAGCCCTGGGTTGTCCTGGAACACACTCTAGACTTGT  749

seq1  TGGGCCTCTAACTCAGAAATCTGCCTGCATCTGCCTCCCGAGTGCTAGGA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCCTCTAACTCAGAAATCTGCCTGCATCTGCCTCCCGAGTGCTAGGA  799

seq1  TTA-AAGGAGTGCACCACCACCACCCAGCCCAATAAATTCTTATCCTTTG  846
      ||| | |||||||||||||||||||||||||||||||||||||| | |||
seq2  TTATAGGGAGTGCACCACCACCACCCAGCCCAATAAATTCTTAT-CATTG  848

seq1  CATTGTCCT  855
      || |||| |
seq2  CAGTGTCTT  857

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information