MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-172G01
Chromosome	12 (Build37)
Map Location	114,092,420 - 114,312,258
singlet/doublet	doublet
Overlap gene	Gpr132, Jag2, Nudt14, Brf1, Btbd6, Pacs2
Upstream gene	Ppp1r13b, LOC100041886, 2010107E04Rik, BC048943, Tdrd9, A530050D06Rik, Kif26a, A730018C14Rik, A530016L24Rik, Tmem179, 2610204M08Rik, Adssl1, Siva1, Akt1, EG382639, AW555464, LOC382640, Pld4, AI450948, LOC100041194, BC022687, Cdca4
Downstream gene	Tex22, Mta1, Crip2, Crip1, 4930427A07Rik, LOC676349, Tmem121, Igh, Igh-2, Gm900, Igh-1b, Igh-3, Ighg1, AI324046, LOC668370, LOC668375, EG382645, Igh-5, Igh-6, Ighj4, Ighj3, Ighj2, Ighj1, Ighd4-1, Ighd3-2, Ighd5-6, Ighd2-8, Ighd5-5, Ighd2-7, Ighd5-8, Ighd5-4, Ighd2-6, Ighd5-7, Ighd5-3, Ighd2-5, Ighd5-2, Ighd2-4, Ighd6-2, Ighd2-3, Ighd6-1, Ighd1-1, 4930523C11Rik, Ighd3-1, Ighd5-1, Adam6, Ighv5-1, Ighv2-1, Ighv5-2, Ighv2-2, Ighv5-3, Ighv5-4, Ighv6-1, Ighv2-3, Ighv5-5, Ighv5-6, Ankrd12-like, Ighv5-7, EG668389, Ighv5-8, Ighv5-9, Ighv5-10, Ighv2-5, Ighv5-11, Ighv5-12, Ighv2-6, Ighv5-9-1, EG628098, Ighv2-9-1, Ighv5-13, Ighv2-6-8, EG629785, Ighv2-7, LOC668405, Ighv5-15, Ighv5-16, Ighv5-17, Ighv5-18, Ighv2-8, Ighv2-9, Ighv5-19, Ighv7-1, Ighv7-2, Ighv14-1, Ighv4-1, Ighv3-1, Ighv11-1, Ighv14-2, Ighv4-2, Ighv3-2, Ighv11-2, Ighv14-3, EG629812
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ppp1r13b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21981 MGI:1336199
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041886 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 6 Proteins pseudo : _no_value

name	2010107E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70257 MGI:1917507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048943 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217874 MGI:2675860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 1 Protein

name	Tdrd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74691 MGI:1921941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins

name	A530050D06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104816 MGI:2144822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif26a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668303 MGI:2447072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 89 ESTs, 3 Proteins

name	A730018C14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319590 MGI:2442339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530016L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319942 MGI:2443020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104885 MGI:2144891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610204M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70435 MGI:1917685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adssl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11565 MGI:87947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siva1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30954 MGI:1353606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11651 MGI:87986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382639 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382639 MGI:3644133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 21 ESTs, 4 Proteins

name	AW555464 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217882 MGI:2145043
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC382640 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Pld4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104759 MGI:2144765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI450948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382643 MGI:2144831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 3 Proteins

name	BC022687 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217887 MGI:2443738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdca4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71963 MGI:1919213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr132 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56696 MGI:1890220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jag2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16450 MGI:1098270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66174 MGI:1913424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72308 MGI:1919558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399566 MGI:3026623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pacs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217893 MGI:1924399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75671 MGI:1922921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mta1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116870 MGI:2150037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68337 MGI:1915587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12925 MGI:88501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930427A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104732 MGI:2144738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676349 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Tmem121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69195 MGI:1916445
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111507 MGI:96442
definition	gene_synonym : MGC118122; MGC118132; MGC19003; MGC25748; MGC6342; MGC68311; MGC91096 note : immunoglobulin heavy chain complex

name	Igh-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238447 IMGT/GENE-DB:IGHA MGI:96444
definition	gene_synonym : IgA; Igha note : immunoglobulin heavy chain 2 (serum IgA)

name	Gm900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380792 IMGT/GENE-DB:IGHE MGI:2685746
definition	gene_synonym : IGHE note : gene model 900, (NCBI)

name	Igh-1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404711 IMGT/GENE-DB:IGHG2C MGI:2686979
definition	gene_synonym : IGHG2C note : immunoglobulin heavy chain 1b (serum IgG2c)

name	Igh-3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16016 IMGT/GENE-DB:IGHG2B MGI:96445
definition	gene_synonym : gamma2b; IgG2b; IGHG2B note : immunoglobulin heavy chain 3 (serum IgG2b)

name	Ighg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16017 IMGT/GENE-DB:IGHG1 MGI:96446
definition	gene_synonym : IgG1; Igh-4; VH7183 note : immunoglobulin heavy constant gamma 1 (G1m marker)

name	AI324046 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380795 IMGT/GENE-DB:IGHG3 MGI:2144790
definition	gene_synonym : IgG3; IGHG3; MGC68300 note : expressed sequence AI324046

name	LOC668370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668370
definition	note : FUS interacting protein (serine-arginine rich) 1 pseudogene pseudo : _no_value

name	LOC668375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668375
definition	note : transducin-like enhancer of split 6 pseudogene pseudo : _no_value

name	EG382645 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382645 MGI:3647068
definition	note : predicted gene, EG382645 pseudo : _no_value

name	Igh-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380797 IMGT/GENE-DB:IGHD MGI:96447
definition	gene_synonym : IgD; IGHD note : immunoglobulin heavy chain 5 (delta-like heavy chain)

name	Igh-6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16019 IMGT/GENE-DB:IGHM MGI:96448
definition	gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH note : immunoglobulin heavy chain 6 (heavy chain of IgM)

name	Ighj4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777656 IMGT/GENE-DB:IGHJ4
definition	note : immunoglobulin heavy joining 4

name	Ighj3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777655 IMGT/GENE-DB:IGHJ3
definition	note : immunoglobulin heavy joining 3

name	Ighj2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777654 IMGT/GENE-DB:IGHJ2
definition	note : immunoglobulin heavy joining 2

name	Ighj1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777648 IMGT/GENE-DB:IGHJ1
definition	note : immunoglobulin heavy joining 1

name	Ighd4-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777661 IMGT/GENE-DB:IGHD4-1
definition	note : immunoglobulin heavy diversity 4-1

name	Ighd3-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777662 IMGT/GENE-DB:IGHD3-2
definition	note : immunoglobulin heavy diversity 3-2

name	Ighd5-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777663 IMGT/GENE-DB:IGHD5-6
definition	note : immunoglobulin heavy diversity 5-6 pseudo : _no_value

name	Ighd2-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777664 IMGT/GENE-DB:IGHD2-8
definition	note : immunoglobulin heavy diversity 2-8

name	Ighd5-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777665 IMGT/GENE-DB:IGHD5-5
definition	note : immunoglobulin heavy diversity 5-5 pseudo : _no_value

name	Ighd2-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777667 IMGT/GENE-DB:IGHD2-7
definition	note : immunoglobulin heavy diversity 2-7

name	Ighd5-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777669 IMGT/GENE-DB:IGHD5-8
definition	note : immunoglobulin heavy diversity 5-8 pseudo : _no_value

name	Ighd5-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777670 IMGT/GENE-DB:IGHD5-4
definition	note : immunoglobulin heavy diversity 5-4 pseudo : _no_value

name	Ighd2-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777672 IMGT/GENE-DB:IGHD2-6
definition	note : immunoglobulin heavy diversity 2-6

name	Ighd5-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777673 IMGT/GENE-DB:IGHD5-7
definition	note : immunoglobulin heavy diversity 5-7 pseudo : _no_value

name	Ighd5-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777674 IMGT/GENE-DB:IGHD5-3
definition	note : immunoglobulin heavy diversity 5-3 pseudo : _no_value

name	Ighd2-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777675 IMGT/GENE-DB:IGHD2-5
definition	note : immunoglobulin heavy diversity 2-5

name	Ighd5-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777676 IMGT/GENE-DB:IGHD5-2
definition	note : immunoglobulin heavy diversity 5-2 pseudo : _no_value

name	Ighd2-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777677 IMGT/GENE-DB:IGHD2-4
definition	note : immunoglobulin heavy diversity 2-4

name	Ighd6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777678 IMGT/GENE-DB:IGHD6-2
definition	note : immunoglobulin heavy diversity 6-2 pseudo : _no_value

name	Ighd2-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777679 IMGT/GENE-DB:IGHD2-3
definition	note : immunoglobulin heavy diversity 2-3

name	Ighd6-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777680 IMGT/GENE-DB:IGHD6-1
definition	note : immunoglobulin heavy diversity 6-1 pseudo : _no_value

name	Ighd1-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777657 IMGT/GENE-DB:IGHD1-1
definition	note : immunoglobulin heavy diversity 1-1

name	4930523C11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238405 MGI:2444636
definition	gene_synonym : ADAM6b note : RIKEN cDNA 4930523C11 gene

name	Ighd3-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777681 IMGT/GENE-DB:IGHD3-1
definition	note : immunoglobulin heavy diversity 3-1

name	Ighd5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777682 IMGT/GENE-DB:IGHD5-1
definition	note : immunoglobulin heavy diversity 5-1 pseudo : _no_value

name	Adam6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238406 MGI:2676316
definition	gene_synonym : tMDCIV note : a disintegrin and metallopeptidase domain 6

name	Ighv5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777683 IMGT/GENE-DB:IGHV5-1
definition	note : immunoglobulin heavy variable V5-1 pseudo : _no_value

name	Ighv2-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777684 IMGT/GENE-DB:IGKV2-1
definition	note : immunoglobulin heavy variable V2-1 pseudo : _no_value

name	Ighv5-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777685 IMGT/GENE-DB:IGHV5-2
definition	note : immunoglobulin heavy variable V5-2

name	Ighv2-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777686 IMGT/GENE-DB:IGHV2-2
definition	note : immunoglobulin heavy variable V2-2

name	Ighv5-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777687 IMGT/GENE-DB:IGHV5-3
definition	note : immunoglobulin heavy variable V5-3 pseudo : _no_value

name	Ighv5-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777688 IMGT/GENE-DB:IGHV5-4
definition	note : immunoglobulin heavy variable V5-4

name	Ighv6-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777689 IMGT/GENE-DB:IGHV6-1
definition	note : immunoglobulin heavy variable V6-1 pseudo : _no_value

name	Ighv2-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238412 IMGT/GENE-DB:IGHV2-3
definition	note : immunoglobulin heavy variable V2-3

name	Ighv5-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777779 IMGT/GENE-DB:IGHV5-5
definition	note : immunoglobulin heavy variable V5-5 pseudo : _no_value

name	Ighv5-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777780 IMGT/GENE-DB:IGHV5-6
definition	note : immunoglobulin heavy variable V5-6

name	Ankrd12-like (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:67107
definition	gene_synonym : Ankrd12 note : ankyrin repeat domain 12-like pseudo : _no_value

name	Ighv5-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777781 IMGT/GENE-DB:IGHV5-7
definition	note : immunoglobulin heavy variable V5-7 pseudo : _no_value

name	EG668389 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668389 IMGT/GENE-DB:IGHV2-4 MGI:3643263
definition	gene_synonym : IGHV2-4 note : predicted gene, EG668389

name	Ighv5-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777782 IMGT/GENE-DB:IGHV5-8
definition	note : immunoglobulin heavy variable V5-8 pseudo : _no_value

name	Ighv5-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544896 IMGT/GENE-DB:IGHV5-9
definition	note : immunoglobulin heavy variable V5-9

name	Ighv5-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777783 IMGT/GENE-DB:IGHV5-10
definition	note : immunoglobulin heavy variable V5-10 pseudo : _no_value

name	Ighv2-5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638605 IMGT/GENE-DB:IGHV2-5
definition	note : immunoglobulin heavy variable V2-5

name	Ighv5-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:777784 IMGT/GENE-DB:IGHV5-11
definition	note : immunoglobulin heavy variable V5-11 pseudo : _no_value

name	Ighv5-12 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668395 IMGT/GENE-DB:IGHV5-12
definition	note : immunoglobulin heavy variable V5-12

name	Ighv2-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630486 IMGT/GENE-DB:IGHV2-6
definition	note : immunoglobulin heavy variable V2-6

name	Ighv5-9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641178 IMGT/GENE-DB:IGHV5-9-1
definition	note : immunoglobulin heavy variable V5-9-1

name	EG628098 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628098 IMGT/GENE-DB:IGHV5-12-4 MGI:3645977
definition	gene_synonym : Ighv5-12-4 note : predicted gene, EG628098

name	Ighv2-9-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:791089 IMGT/GENE-DB:IGHV2-9-1
definition	note : immunoglobulin heavy variable V2-9-1

name	Ighv5-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:790900 IMGT/GENE-DB:IGHV5-13
definition	note : immunoglobulin heavy variable V5-13

name	Ighv2-6-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:791090 IMGT/GENE-DB:IGHV2-6-8
definition	note : immunoglobulin heavy variable V2-6-8

name	EG629785 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629785 IMGT/GENE-DB:IGHV(III)-4 MGI:3643089
definition	gene_synonym : IGHV(III)-4 note : predicted gene, EG629785

name	Ighv2-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780793 IMGT/GENE-DB:IGHV2-7
definition	note : immunoglobulin heavy variable V2-7

name	LOC668405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668405
definition	note : ribosomal protein L26 pseudogene pseudo : _no_value

name	Ighv5-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780792 IMGT/GENE-DB:IGHV5-15
definition	note : immunoglobulin heavy variable V5-15

name	Ighv5-16 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633568 IMGT/GENE-DB:IGHV5-16
definition	note : immunoglobulin heavy variable V5-16

name	Ighv5-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780794 IMGT/GENE-DB:IGHV5-17
definition	note : immunoglobulin heavy variable V5-17

name	Ighv5-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780796 IMGT/GENE-DB:IGHV5-18
definition	note : immunoglobulin heavy variable V5-18 pseudo : _no_value

name	Ighv2-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780797 IMGT/GENE-DB:IGHV2-8
definition	note : immunoglobulin heavy variable V2-8 pseudo : _no_value

name	Ighv2-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640046 IMGT/GENE-DB:IGHV2-9
definition	note : immunoglobulin heavy variable V2-9

name	Ighv5-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780798 IMGT/GENE-DB:IGHV5-19
definition	note : immunoglobulin heavy variable V5-19 pseudo : _no_value

name	Ighv7-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780799 IMGT/GENE-DB:IGHV7-1
definition	note : immunoglobulin heavy variable V7-1 pseudo : _no_value

name	Ighv7-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780800 IMGT/GENE-DB:IGHV7-2
definition	note : immunoglobulin heavy variable V7-2

name	Ighv14-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780801 IMGT/GENE-DB:IGHV14-1
definition	note : immunoglobulin heavy variable V14-1

name	Ighv4-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780802 IMGT/GENE-DB:IGHV4-1
definition	note : immunoglobulin heavy variable V4-1

name	Ighv3-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780803 IMGT/GENE-DB:IGHV3-1
definition	note : immunoglobulin heavy variable V3-1

name	Ighv11-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780804 IMGT/GENE-DB:IGHV11-1
definition	note : immunoglobulin heavy variable V11-1

name	Ighv14-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668421 IMGT/GENE-DB:IGHV14-2
definition	note : immunoglobulin heavy variable V14-2

name	Ighv4-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668423 IMGT/GENE-DB:IGHV4-2
definition	note : immunoglobulin heavy variable V4-2 pseudo : _no_value

name	Ighv3-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780817 IMGT/GENE-DB:IGHV3-2
definition	note : immunoglobulin heavy variable V3-2 pseudo : _no_value

name	Ighv11-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780818 IMGT/GENE-DB:IGHV11-2
definition	note : immunoglobulin heavy variable V11-2

name	Ighv14-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238418 IMGT/GENE-DB:IGHV14-3
definition	note : immunoglobulin heavy variable V14-3

name	EG629812 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629812 IMGT/GENE-DB:IGHV5-20 MGI:3643819
definition	gene_synonym : IGHV5-20 note : predicted gene, EG629812

name	Ppp1r13b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45592935 GeneID:21981 MGI:1336199
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 13B transcript_id : NM_011625.1

name	2010107E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387144 GeneID:70257 MGI:1917507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010107E04 gene transcript_id : NM_027360.2

name	BC048943 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393098 GeneID:217874 MGI:2675860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : cDNA sequence BC048943, transcript variant 1 transcript_id : XM_127170.7

name	BC048943 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393097 GeneID:217874 MGI:2675860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : cDNA sequence BC048943, transcript variant 2 transcript_id : XM_902085.2

name	Tdrd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263535 GeneID:74691 MGI:1921941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins product : tudor domain containing 9 transcript_id : XM_001475772.1

name	A530050D06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487182 GeneID:104816 MGI:2144822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530050D06 gene transcript_id : NM_001081169.1

name	Kif26a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263556 GeneID:668303 MGI:2447072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 89 ESTs, 3 Proteins product : kinesin family member 26A transcript_id : XM_001477732.1

name	A730018C14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342465 GeneID:319590 MGI:2442339
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A730018C14 gene transcript_id : NM_176956.2

name	A530016L24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383812 GeneID:319942 MGI:2443020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530016L24 gene transcript_id : NM_177039.3

name	Tmem179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125660459 GeneID:104885 MGI:2144891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 179 transcript_id : NM_178915.3

name	2610204M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052808 GeneID:70435 MGI:1917685
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610204M08 gene transcript_id : NM_198411.2

name	Adssl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671518 GeneID:11565 MGI:87947
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylosuccinate synthetase like 1 transcript_id : NM_007421.1

name	Siva1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305492 GeneID:30954 MGI:1353606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SIVA1, apoptosis-inducing factor transcript_id : NM_013929.1

name	Akt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891722 GeneID:11651 MGI:87986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymoma viral proto-oncogene 1 transcript_id : NM_009652.2

name	EG382639 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263560 GeneID:382639 MGI:3644133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 21 ESTs, 4 Proteins product : predicted gene, EG382639, transcript variant 2 transcript_id : XM_356600.6

name	EG382639 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263558 GeneID:382639 MGI:3644133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 19 ESTs, 4 Proteins product : predicted gene, EG382639, transcript variant 1 transcript_id : XM_001477883.1

name	AW555464 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352514 GeneID:217882 MGI:2145043
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW555464 transcript_id : NM_001024602.2

name	Pld4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801925 GeneID:104759 MGI:2144765
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D family, member 4 transcript_id : NM_178911.3

name	AI450948 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702000 GeneID:382643 MGI:2144831
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI450948 transcript_id : NM_001033476.1

name	LOC100041194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263537 GeneID:100041194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs, 3 Proteins product : similar to KIAA2019 protein transcript_id : XM_001475946.1

name	BC022687 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351874 GeneID:217887 MGI:2443738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC022687 transcript_id : NM_145450.3

name	Cdca4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328499 GeneID:71963 MGI:1919213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle associated 4 transcript_id : NM_028023.3

name	Gpr132 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803482 GeneID:56696 MGI:1890220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 132 transcript_id : NM_019925.4

name	Jag2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21553296 GeneID:16450 MGI:1098270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jagged 2 transcript_id : NM_010588.1

name	Nudt14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352246 GeneID:66174 MGI:1913424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 14 transcript_id : NM_025399.2

name	Brf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130445 GeneID:72308 MGI:1919558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) transcript_id : NM_028193.3

name	Btbd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42517137 GeneID:399566 MGI:3026623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 6 transcript_id : NM_201646.1

name	Pacs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487180 GeneID:217893 MGI:1924399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphofurin acidic cluster sorting protein 2 transcript_id : NM_001081170.1

name	Tex22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037426 GeneID:75671 MGI:1922921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 22 transcript_id : NM_029381.1

name	Mta1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598895 GeneID:116870 MGI:2150037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : metastasis associated 1 transcript_id : NM_054081.2

name	Crip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13195645 GeneID:68337 MGI:1915587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine rich protein 2 transcript_id : NM_024223.1

name	Crip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123701561 GeneID:12925 MGI:88501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich protein 1 (intestinal) transcript_id : NM_007763.3

name	4930427A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364664 GeneID:104732 MGI:2144738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930427A07 gene transcript_id : NM_134041.2

name	Tmem121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053940 GeneID:69195 MGI:1916445
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 121 transcript_id : NM_153776.2

name	4930523C11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222275 GeneID:238405 MGI:2444636
definition	gene_synonym : ADAM6b product : RIKEN cDNA 4930523C11 gene transcript_id : NM_001009545.1

name	Adam6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709838 GeneID:238406 MGI:2676316
definition	gene_synonym : tMDCIV product : a disintegrin and metallopeptidase domain 6 transcript_id : NM_174885.3

name	Ppp1r13b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592936 GeneID:21981 MGI:1336199
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0045786 - negative regulation of progression through cell cycle [Evidence ISS] codon_start : 1 note : tumor protein p53-binding protein, 2; tumor protein p53 binding protein, 2; transformation related protein 53 binding protein 2 product : apoptosis-stimulating protein of p53, 1 protein_id : NP_035755.1

name	2010107E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312554 GeneID:70257 MGI:1917507
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC70257 protein_id : NP_081636.1

name	BC048943 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25071028 GeneID:217874 MGI:2675860
definition	codon_start : 1 product : similar to hCG1646947 isoform 1 protein_id : XP_127170.2

name	BC048943 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82942950 GeneID:217874 MGI:2675860
definition	codon_start : 1 product : similar to hCG1646947 isoform 2 protein_id : XP_907178.1

name	Tdrd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263536 GeneID:74691 MGI:1921941
definition	codon_start : 1 product : tudor domain containing 9 protein_id : XP_001475822.1

name	A530050D06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487183 GeneID:104816 MGI:2144822
definition	GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence ISS]; GO:0004067 - asparaginase activity [Evidence IEA] [Evidence ISS]; GO:0004622 - lysophospholipase activity [Evidence ISS] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC104816 protein_id : NP_001074638.1

name	Kif26a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263557 GeneID:668303 MGI:2447072
definition	codon_start : 1 product : similar to KIAA1236 protein protein_id : XP_001477782.1

name	A730018C14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892773 GeneID:319590 MGI:2442339
definition	codon_start : 1 product : hypothetical protein LOC319590 protein_id : NP_795930.1

name	A530016L24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892925 GeneID:319942 MGI:2443020
definition	codon_start : 1 product : hypothetical protein LOC319942 protein_id : NP_796013.1

name	Tmem179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125660460 GeneID:104885 MGI:2144891
definition	codon_start : 1 product : hypothetical protein LOC104885 protein_id : NP_849246.2

name	2610204M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052809 GeneID:70435 MGI:1917685
definition	codon_start : 1 product : formin, inverted protein_id : NP_940803.2

name	Adssl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671519 CCDS:CCDS26192.1 GeneID:11565 MGI:87947
definition	GO_function : GO:0004019 - adenylosuccinate synthase activity [Evidence IDA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006164 - purine nucleotide biosynthesis [Evidence IDA]; GO:0006163 - purine nucleotide metabolism [Evidence TAS] codon_start : 1 note : adenylosuccinate synthetase 1, muscle; adenylosuccinate synthetase, muscle product : adenylosuccinate synthetase 1 protein_id : NP_031447.1

name	Siva1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305493 CCDS:CCDS26193.1 GeneID:30954 MGI:1353606
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005175 - CD27 receptor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0043065 - positive regulation of apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Cd27 binding protein (Hindu God of destruction) protein_id : NP_038957.1

name	Akt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753034 CCDS:CCDS26194.1 GeneID:11651 MGI:87986
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0042640 - anagen [Evidence IMP]; GO:0006915 - apoptosis [Evidence IDA]; GO:0008637 - apoptotic mitochondrial changes [Evidence IDA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007281 - germ cell development [Evidence IDA]; GO:0006006 - glucose metabolism [Evidence IEA]; GO:0015758 - glucose transport [Evidence IMP]; GO:0005978 - glycogen biosynthesis [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IDA]; GO:0008286 - insulin receptor signaling pathway [Evidence ISS] [Evidence IMP]; GO:0048009 - insulin-like growth factor receptor signaling pathway [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence IMP] [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] [Evidence ISS]; GO:0030163 - protein catabolism [Evidence IDA]; GO:0016567 - protein ubiquitination [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0045884 - regulation of survival gene product activity [Evidence IDA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0009725 - response to hormone stimulus [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : thymoma viral proto-oncogene 1 protein_id : NP_033782.1

name	EG382639 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263559 GeneID:382639 MGI:3644133
definition	codon_start : 1 product : similar to hCG1802417, isoform 1 protein_id : XP_001477933.1

name	EG382639 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63635383 GeneID:382639 MGI:3644133
definition	codon_start : 1 product : similar to hCG1802417, isoform 2 protein_id : XP_356600.3

name	AW555464 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677549 GeneID:217882 MGI:2145043
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC217882 protein_id : NP_001019773.1

name	Pld4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725764 CCDS:CCDS26195.1 GeneID:104759 MGI:2144765
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : phospholipase D4 product : phospholipase D family, member 4 protein_id : NP_849242.1

name	AI450948 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702001 CCDS:CCDS26196.1 GeneID:382643 MGI:2144831
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC382643 protein_id : NP_001028648.1

name	LOC100041194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263538 GeneID:100041194
definition	codon_start : 1 product : similar to KIAA2019 protein protein_id : XP_001475996.1

name	BC022687 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32526898 GeneID:217887 MGI:2443738
definition	codon_start : 1 product : hypothetical protein LOC217887 protein_id : NP_663425.2

name	Cdca4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229143 CCDS:CCDS26198.1 GeneID:71963 MGI:1919213
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 product : cell division cycle associated 4 protein_id : NP_082299.1

name	Gpr132 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910232 CCDS:CCDS26199.1 GeneID:56696 MGI:1890220
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G2 accumulation; G protein-coupled receptor G2A product : G protein-coupled receptor 132 protein_id : NP_064309.1

name	Jag2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553297 CCDS:CCDS26200.1 GeneID:16450 MGI:1098270
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008083 - growth factor activity [Evidence ISS]; GO:0005112 - Notch binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0009912 - auditory receptor cell fate commitment [Evidence IMP]; GO:0007154 - cell communication [Evidence IEA]; GO:0007049 - cell cycle [Evidence ISS]; GO:0030154 - cell differentiation [Evidence NAS]; GO:0001709 - cell fate determination [Evidence NAS]; GO:0007267 - cell-cell signaling [Evidence NAS]; GO:0007275 - development [Evidence IEA]; GO:0030326 - embryonic limb morphogenesis [Evidence ISS]; GO:0042492 - gamma-delta T cell differentiation [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence ISS] [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0030155 - regulation of cell adhesion [Evidence IMP]; GO:0030334 - regulation of cell migration [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0007605 - sensory perception of sound [Evidence NAS]; GO:0001501 - skeletal development [Evidence IMP]; GO:0007283 - spermatogenesis [Evidence ISS]; GO:0045061 - thymic T cell selection [Evidence ISS] codon_start : 1 exception : mismatches in translation note : syndactylism product : jagged 2 protein_id : NP_034718.1

name	Nudt14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956126 CCDS:CCDS26201.1 GeneID:66174 MGI:1913424
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016818 - hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008768 - UDP-sugar diphosphatase activity [Evidence IEA] codon_start : 1 product : nudix (nucleoside diphosphate linked moiety X)-type motif 14 protein_id : NP_079675.1

name	Brf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608137 GeneID:72308 MGI:1919558
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0043488 - regulation of mRNA stability [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 product : transcription initiation factor IIIB protein_id : NP_082469.2

name	Btbd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42517138 GeneID:399566 MGI:3026623
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : BTB (POZ) domain containing 6 protein_id : NP_964008.1

name	Pacs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487181 GeneID:217893 MGI:1924399
definition	codon_start : 1 note : phosphofurin acidic cluster sorting protein 1-like product : phosphofurin acidic cluster sorting protein 2 protein_id : NP_001074639.1

name	Tex22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037427 CCDS:CCDS26203.1 GeneID:75671 MGI:1922921
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] codon_start : 1 product : testis expressed gene 22 protein_id : NP_083657.1

name	Mta1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598896 GeneID:116870 MGI:2150037
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0016581 - NuRD complex [Evidence IPI] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : metastasis associated 1 protein_id : NP_473422.2

name	Crip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195646 CCDS:CCDS26204.1 GeneID:68337 MGI:1915587
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA] codon_start : 1 product : LIM only protein HLP protein_id : NP_077185.1

name	Crip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681015 CCDS:CCDS26205.1 GeneID:12925 MGI:88501
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence ISS] [Evidence IEA] codon_start : 1 note : cysteine rich intestinal protein; cysteine-rich intestinal protein product : cysteine-rich protein 1 (intestinal) protein_id : NP_031789.1

name	4930427A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789353 GeneID:104732 MGI:2144738
definition	codon_start : 1 product : hypothetical protein LOC104732 protein_id : NP_598802.1

name	Tmem121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053941 CCDS:CCDS26206.1 GeneID:69195 MGI:1916445
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hole protein protein_id : NP_722471.2

name	Igh-2 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:238447 IMGT/GENE-DB:IGHA MGI:96444
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgA; Igha

name	Gm900 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380792 IMGT/GENE-DB:IGHE MGI:2685746
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHE

name	Igh-1b (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:404711 IMGT/GENE-DB:IGHG2C MGI:2686979
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHG2C

name	Igh-3 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16016 IMGT/GENE-DB:IGHG2B MGI:96445
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : gamma2b; IgG2b; IGHG2B

name	Ighg1 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16017 IMGT/GENE-DB:IGHG1 MGI:96446
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgG1; Igh-4; VH7183

name	AI324046 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380795 IMGT/GENE-DB:IGHG3 MGI:2144790
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgG3; IGHG3; MGC68300

name	Igh-5 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380797 IMGT/GENE-DB:IGHD MGI:96447
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgD; IGHD

name	Igh-6 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:16019 IMGT/GENE-DB:IGHM MGI:96448
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH

name	Ighj4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777656 IMGT/GENE-DB:IGHJ4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777655 IMGT/GENE-DB:IGHJ3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777654 IMGT/GENE-DB:IGHJ2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighj1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777648 IMGT/GENE-DB:IGHJ1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd4-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777661 IMGT/GENE-DB:IGHD4-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd3-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777662 IMGT/GENE-DB:IGHD3-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777663 IMGT/GENE-DB:IGHD5-6
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777664 IMGT/GENE-DB:IGHD2-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777665 IMGT/GENE-DB:IGHD5-5
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777667 IMGT/GENE-DB:IGHD2-7
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777669 IMGT/GENE-DB:IGHD5-8
definition	codon_start : 1 pseudo : _no_value

name	Ighd5-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777670 IMGT/GENE-DB:IGHD5-4
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777672 IMGT/GENE-DB:IGHD2-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777673 IMGT/GENE-DB:IGHD5-7
definition	codon_start : 1 pseudo : _no_value

name	Ighd5-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777674 IMGT/GENE-DB:IGHD5-3
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777675 IMGT/GENE-DB:IGHD2-5
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777676 IMGT/GENE-DB:IGHD5-2
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777677 IMGT/GENE-DB:IGHD2-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777678 IMGT/GENE-DB:IGHD6-2
definition	codon_start : 1 pseudo : _no_value

name	Ighd2-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777679 IMGT/GENE-DB:IGHD2-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd6-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777680 IMGT/GENE-DB:IGHD6-1
definition	codon_start : 1 pseudo : _no_value

name	Ighd1-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777657 IMGT/GENE-DB:IGHD1-1
definition	codon_start : 1 exception : rearrangement required for product

name	4930523C11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222276 CCDS:CCDS26207.1 GeneID:238405 MGI:2444636
definition	codon_start : 1 gene_synonym : ADAM6b note : a disintegrin and metalloproteinase domain 6-like product : a disintegrin and metalloproteinase domain 6-like protein_id : NP_001009545.1

name	Ighd3-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777681 IMGT/GENE-DB:IGHD3-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighd5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777682 IMGT/GENE-DB:IGHD5-1
definition	codon_start : 1 pseudo : _no_value

name	Adam6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119709839 CCDS:CCDS26208.1 GeneID:238406 MGI:2676316
definition	codon_start : 1 gene_synonym : tMDCIV note : disintegrin and metalloproteinase domain 6; a disintegrin and metalloprotease domain 6 product : a disintegrin and metalloprotease domain 6 protein_id : NP_777479.2

name	Ighv5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777683 IMGT/GENE-DB:IGHV5-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777684 IMGT/GENE-DB:IGKV2-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777685 IMGT/GENE-DB:IGHV5-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777686 IMGT/GENE-DB:IGHV2-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777687 IMGT/GENE-DB:IGHV5-3
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777688 IMGT/GENE-DB:IGHV5-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv6-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777689 IMGT/GENE-DB:IGHV6-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238412 IMGT/GENE-DB:IGHV2-3
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777779 IMGT/GENE-DB:IGHV5-5
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777780 IMGT/GENE-DB:IGHV5-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777781 IMGT/GENE-DB:IGHV5-7
definition	codon_start : 1 pseudo : _no_value

name	EG668389 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668389 IMGT/GENE-DB:IGHV2-4 MGI:3643263
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV2-4

name	Ighv5-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777782 IMGT/GENE-DB:IGHV5-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:544896 IMGT/GENE-DB:IGHV5-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777783 IMGT/GENE-DB:IGHV5-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-5 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:638605 IMGT/GENE-DB:IGHV2-5
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:777784 IMGT/GENE-DB:IGHV5-11
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-12 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668395 IMGT/GENE-DB:IGHV5-12
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:630486 IMGT/GENE-DB:IGHV2-6
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:641178 IMGT/GENE-DB:IGHV5-9-1
definition	codon_start : 1 exception : rearrangement required for product

name	EG628098 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628098 IMGT/GENE-DB:IGHV5-12-4 MGI:3645977
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv5-12-4

name	Ighv2-9-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:791089 IMGT/GENE-DB:IGHV2-9-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:790900 IMGT/GENE-DB:IGHV5-13
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv2-6-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:791090 IMGT/GENE-DB:IGHV2-6-8
definition	codon_start : 1 exception : rearrangement required for product

name	EG629785 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629785 IMGT/GENE-DB:IGHV(III)-4 MGI:3643089
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV(III)-4

name	Ighv2-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780793 IMGT/GENE-DB:IGHV2-7
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780792 IMGT/GENE-DB:IGHV5-15
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-16 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:633568 IMGT/GENE-DB:IGHV5-16
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780794 IMGT/GENE-DB:IGHV5-17
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780796 IMGT/GENE-DB:IGHV5-18
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780797 IMGT/GENE-DB:IGHV2-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv2-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:640046 IMGT/GENE-DB:IGHV2-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv5-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780798 IMGT/GENE-DB:IGHV5-19
definition	codon_start : 1 pseudo : _no_value

name	Ighv7-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780799 IMGT/GENE-DB:IGHV7-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv7-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780800 IMGT/GENE-DB:IGHV7-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780801 IMGT/GENE-DB:IGHV14-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv4-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780802 IMGT/GENE-DB:IGHV4-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv3-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780803 IMGT/GENE-DB:IGHV3-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv11-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780804 IMGT/GENE-DB:IGHV11-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668421 IMGT/GENE-DB:IGHV14-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv4-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668423 IMGT/GENE-DB:IGHV4-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv3-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780817 IMGT/GENE-DB:IGHV3-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv11-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780818 IMGT/GENE-DB:IGHV11-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv14-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238418 IMGT/GENE-DB:IGHV14-3
definition	codon_start : 1 exception : rearrangement required for product

name	EG629812 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629812 IMGT/GENE-DB:IGHV5-20 MGI:3643819
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV5-20

name	LOC382640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382640
definition	number : 2 pseudo : _no_value

name	LOC382640 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382640
definition	number : 1 pseudo : _no_value

name	LOC676349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676349
definition	number : 3 pseudo : _no_value

name	LOC676349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676349
definition	number : 2 pseudo : _no_value

name	LOC676349 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676349
definition	number : 1 pseudo : _no_value

name	Ighv5-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777683
definition	pseudo : _no_value standard_name : IGHV5-1

name	Ighv2-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777684
definition	pseudo : _no_value standard_name : IGHV2-1

name	Ighv5-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777685
definition	standard_name : IGHV5-2

name	Ighv2-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777686
definition	standard_name : IGHV2-2

name	Ighv5-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777687
definition	pseudo : _no_value standard_name : IGHV5-3

name	Ighv5-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777688
definition	standard_name : IGHV5-4

name	Ighv6-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777689
definition	pseudo : _no_value standard_name : IGHV6-1

name	Ighv2-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238412
definition	standard_name : IGHV2-3

name	Ighv5-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777779
definition	pseudo : _no_value standard_name : IGHV5-5

name	Ighv5-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777780
definition	standard_name : IGHV5-6

name	Ighv5-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777781
definition	pseudo : _no_value standard_name : IGHV5-7

name	EG668389 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668389
definition	gene_synonym : IGHV2-4 standard_name : IGHV2-4

name	Ighv5-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777782
definition	pseudo : _no_value standard_name : IGHV5-8

name	Ighv5-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:544896
definition	standard_name : IGHV5-9

name	Ighv5-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777783
definition	pseudo : _no_value standard_name : IGHV5-10

name	Ighv2-5 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:638605
definition	standard_name : IGHV2-5

name	Ighv5-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:777784
definition	pseudo : _no_value standard_name : IGHV5-11

name	Ighv5-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668395
definition	standard_name : IGHV5-12

name	Ighv2-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:630486
definition	standard_name : IGHV2-6

name	Ighv5-9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:641178
definition	standard_name : IGHV5-9-1

name	EG628098 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628098
definition	gene_synonym : Ighv5-12-4 standard_name : IGHV5-12-4

name	Ighv2-9-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:791089
definition	standard_name : IGHV2-9-1

name	Ighv5-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:790900
definition	standard_name : IGHV5-13

name	Ighv2-6-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:791090
definition	standard_name : Ighv2-6-8

name	EG629785 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629785
definition	gene_synonym : IGHV(III)-4 standard_name : IGHV(III)-4

name	Ighv2-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780793
definition	standard_name : IGHV2-7

name	Ighv5-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780792
definition	standard_name : IGHV5-15

name	Ighv5-16 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633568
definition	standard_name : IGHV5-16

name	Ighv5-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780794
definition	standard_name : IGHV5-17

name	Ighv5-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780796
definition	pseudo : _no_value standard_name : IGHV5-18

name	Ighv2-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780797
definition	pseudo : _no_value standard_name : IGHV2-8

name	Ighv2-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640046
definition	standard_name : IGHV2-9

name	Ighv5-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780798
definition	pseudo : _no_value standard_name : IGHV5-19

name	Ighv7-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780799
definition	pseudo : _no_value standard_name : IGHV7-1

name	Ighv7-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780800
definition	standard_name : IGHV7-2

name	Ighv14-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780801
definition	standard_name : IGHV14-1

name	Ighv4-1 (CDS detail)
type	V_segment
link	vega ensembl
xref
definition	standard_name : IGHV4-1

name	Ighv3-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780803
definition	standard_name : IGHV3-1

name	Ighv11-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780804
definition	standard_name : IGHV11-1

name	Ighv14-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668421
definition	standard_name : IGHV14-2

name	Ighv4-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668423
definition	pseudo : _no_value standard_name : IGHV4-2

name	Ighv3-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780817
definition	pseudo : _no_value standard_name : IGHV3-2

name	Ighv11-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780818
definition	standard_name : IGHV11-2

name	Ighv14-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238418
definition	standard_name : IGHV14-3

name	EG629812 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629812
definition	gene_synonym : IGHV5-20 standard_name : IGHV5-20

name	Ighj4 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777656
definition	standard_name : IGHJ4

name	Ighj3 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777655
definition	standard_name : IGHJ3

name	Ighj2 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777654
definition	standard_name : IGHJ2

name	Ighj1 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:777648
definition	standard_name : IGHJ1

name	Ighd4-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777661
definition	standard_name : IGHD4-1

name	Ighd3-2 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777662
definition	standard_name : IGHD3-2

name	Ighd5-6 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777663
definition	pseudo : _no_value standard_name : IGHD5-6

name	Ighd2-8 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777664
definition	standard_name : IGHD2-8

name	Ighd5-5 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777665
definition	pseudo : _no_value standard_name : IGHD5-5

name	Ighd2-7 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777667
definition	standard_name : IGHD2-7

name	Ighd5-8 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777669
definition	pseudo : _no_value standard_name : IGHV5-8

name	Ighd5-4 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777670
definition	pseudo : _no_value standard_name : IGHD5-4

name	Ighd2-6 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777672
definition	standard_name : IGHD2-6

name	Ighd5-7 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777673
definition	pseudo : _no_value standard_name : IGHD5-7

name	Ighd5-3 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777674
definition	pseudo : _no_value standard_name : IGHD5-3

name	Ighd2-5 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777675
definition	standard_name : IGHD2-5

name	Ighd2-4 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777677
definition	standard_name : IGHD2-4

name	Ighd6-2 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777678
definition	pseudo : _no_value standard_name : IGHD6-2

name	Ighd2-3 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777679
definition	standard_name : IGHD2-3

name	Ighd6-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777680
definition	pseudo : _no_value standard_name : IGHD6-1

name	Ighd1-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777657
definition	standard_name : IGHD1-1

name	Ighd3-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777681
definition	standard_name : IGHD3-1

name	Ighd5-1 (CDS detail)
type	D_segment
link	vega ensembl
xref	GeneID:777682
definition	pseudo : _no_value standard_name : IGHD5-1

name	Igh-2 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:238447
definition	gene_synonym : IgA; Igha standard_name : IGHA

name	Gm900 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380792
definition	gene_synonym : IGHE standard_name : IGHE

name	Igh-1b (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:404711
definition	gene_synonym : IGHG2C standard_name : IGHG2C

name	Igh-3 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16016
definition	gene_synonym : gamma2b; IgG2b; IGHG2B standard_name : IGHG2B

name	Ighg1 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16017
definition	gene_synonym : IgG1; Igh-4; VH7183 standard_name : IGHG`

name	AI324046 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380795
definition	gene_synonym : IgG3; IGHG3; MGC68300 standard_name : IGHG3

name	Igh-5 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:380797
definition	gene_synonym : IgD; IGHD standard_name : IGHD

name	Igh-6 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:16019
definition	gene_synonym : AI326478; Igh-M; Igh6; IGHM; Igm; MGC107036; MGC107507; muH standard_name : IGHM

name	LOC100041886 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263555 GeneID:100041886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 ESTs, 6 Proteins product : similar to Ac2-008 pseudo : _no_value transcript_id : XR_033328.1

clone name	MSMg01-345M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-456H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-057O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417M23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-084B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-262K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176D11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-273E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538B23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-338P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311O11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-172G01.b	B6Ng01-172G01.g
ACC	GA001008	GA001009
length	1,078	512
definition	B6Ng01-172G01.b	B6Ng01-172G01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,092,420 - 114,093,480)	(114,311,741 - 114,312,258)
sequence	gaattcactctgtagaccaggctggcaatgaactcagaaatccacctgac tctgcctcccaagtgctgggattaaaggcgtgcaccaccatgctcggctc caggcctcctttttaatctctatggaacacacatagcacagaacgttctc tccgagtccttcattcccctgcatgcagctgaccgtcactaactaactgg ctgctgtgtggagtggagccagttcccacctctagaatcttctcagcctg cagaccaaagctcttctagaaatacacacacacacacacacacatacaca cacacatacatatacatacacatatacatgtacaaacacacacatacaca ctcatacaaacacatatacacacatacacatacatacacatacacacata tacacacatacacacatatgcacacatgcacacacacatatacacacatg cacatacacacacacacacacacacacacacacacacacacacacacaca cacactttcctcccttgcattctccctgcctctgtagagcagcctcaccc aaacggattcatcatcggtgcagatttagtctactgagcatagcatcttc cgggttcatccacatcatagggtgtgtcagaacatgtcttctttttgaga caggctagcatcccatcaagacactccatgcacaggaacactccccagtg aacacagagacactctgacacttgtcacgtgtgcatggaacctaggctgc ttgccacatgaacaatatgagcattggtgtccctgacttctgtccctgct gtctcctttttgggtacacctaaaaagtgagcttgctgggtcacgtggcc actgtgttttactctgaggaaagcctgtgctacttttcaagtgtctgctc tgctttgcagccctatctgcagagatcagagctcaggcatagccagccag cttctgctttatgttttttcctttttaacagtgtgttgtgaggcaccctt ccctcccacaatctgggtgccctggggtcatccgcctcagaaggccatcc tattatcacatctgaataagagaaagtg	atttgagatggaggctagaggaagaagtgaggcttgcaggataaggctag ggcaagccattgcttcagggctgagcctcccgcctccccacgcctcccca cccccacctcccagcactggtacctttacagtgatactgagctgcgtact cagagggtggtggcaggaaccaacttgaaggtagaggcagggcccccaac tgacagcaatgagcaatggcaactggtgttgcttgacagggacctctaag actggcaggctctgagggtgatgcctcagagcttcggatgcaaacacact ctgcggttcgtaccactgcactgcctgtcaggggggctttggtgtcatcc ttcaaagggacaaagtgcttctccatgacttctcattacagctccatgag gtaggcaaggaaaatggaccatctctctaaccactgggggagtgaggcac agggaggaaggactgctgtctaggtctgcacctagcactgccatggtggg ggttggggggaa
quality values	Open. Hide. 62 31 31 32 62 31 30 54 62 62 62 62 49 62 62 49 51 39 37 62 62 62 62 62 62 59 59 62 62 62 62 62 62 39 39 20 18 28 28 36 40 28 27 33 48 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 59 62 62 62 62 62 51 56 56 62 56 56 54 62 62 59 54 54 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 62 62 62 56 62 56 62 56 62 56 62 62 62 36 47 62 62 62 56 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 62 56 52 42 48 62 51 62 39 47 62 62 62 62 62 62 52 62 62 62 62 62 42 62 62 62 62 62 62 62 53 62 54 62 52 49 42 62 62 52 52 62 54 54 54 54 52 45 54 48 52 52 46 58 54 48 58 54 58 58 58 58 54 54 58 58 54 58 42 52 52 54 54 52 54 42 54 54 54 52 58 40 58 58 50 58 54 58 52 52 54 26 58 54 50 42 54 54 54 54 42 44 52 54 54 54 54 54 52 54 37 58 50 49 48 58 42 58 54 52 52 52 52 42 45 44 46 40 50 49 58 50 45 32 50 40 52 46 40 42 46 41 46 46 49 43 35 50 45 50 50 50 43 47 41 50 50 48 46 51 46 50 51 58 33 53 42 50 42 58 29 39 41 29 30 29 31 37 51 58 50 32 50 50 46 52 41 37 29 29 43 22 53 52 49 50 50 29 46 46 46 51 21 49 15 29 7 38 37 49 37 50 51 50 37 18 43 40 31 39 40 37 28 50 30 36 32 25 41 37 40 58 12 32 37 29 14 46 54 23 58 39 35 49 44 32 25 13 13 17 13 18 26 51 23 23 51 49 32 41 37 49 47 25 34 22 40 54 30 51 52 51 44 35 50 39 14 19 29 28 21 18 9 19 51 46 45 12 18 32 36 42 12 25 32 30 45 21 32 54 54 35 31 23 40 23 27 24 30 31 17 19 20 33 31 38 13 27 21 32 45 13 18 29 32 28 31 17 41 10 21 12 47 26 16 22 11 17 39 18 30 23 14 12 17 7 51 51 43 31 30 14 34 30 43 16 24 32 37 27 31 43 29 42 30 30 46 32 31 28 21 29 42 51 51 37 31 42 31 31 42 29 32 23 46 18 38 32 31 31 18 33 7 21 42 30 21 5 9 13 32 26 29 13 13 19 21 21 11 46 32 32 31 38 31 29 29 31 24 32 21 7 21 21 25 29 46 46 30 31 17 9 29 9 47 46 36 17 6 31 11 17 29 17 25 6 8 5 6 10 16 18 38 11 22 21 26 32 42 8 8 36 21 31 8 16 9 28 20 13 13 25 31 21 21 21 29 26 22 13 22 21 36 25 7 22 37 39 33 31 24 33 10 5 6 21 10 15 15 4 4 6 11 12 7 29 10 12 8 14 9 11 14 24 19 37 20 5 10 9 10 10 25 23 10 8 25 28 15 10 20 7 5 5 7 17 27 16 8 27	Open. Hide. 39 59 62 62 62 62 62 39 23 28 25 27 17 30 28 28 28 36 62 59 62 59 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 43 49 50 32 50 49 40 59 59 62 49 49 62 59 59 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 43 47 62 62 62 62 54 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 54 50 52 52 54 54 58 58 38 52 58 58 54 52 58 58 43 46 46 46 52 58 47 46 26 24 20 40 20

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_114092420_114093480
seq2: B6Ng01-172G01.b_43_1120

seq1  GAATTCACTCTGTAGACCAGGCTGGCAATGAACTCAGAAATCCACCTGAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTCTGTAGACCAGGCTGGCAATGAACTCAGAAATCCACCTGAC  50

seq1  TCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCACCACCATGCTCGGCTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCTCCCAAGTGCTGGGATTAAAGGCGTGCACCACCATGCTCGGCTC  100

seq1  CAGGCCTCCTTTTTAATCTCTATGGAACACACATAGCACAGAACGTTCTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCCTCCTTTTTAATCTCTATGGAACACACATAGCACAGAACGTTCTC  150

seq1  TCCGAGTCCTTCATTCCCCTGCATGCAGCTGACCGTCACTAACTAACTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGAGTCCTTCATTCCCCTGCATGCAGCTGACCGTCACTAACTAACTGG  200

seq1  CTGCTGTGTGGAGTGGAGCCAGTTCCCACCTCTAGAATCTTCTCAGCCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGTGTGGAGTGGAGCCAGTTCCCACCTCTAGAATCTTCTCAGCCTG  250

seq1  CAGACCAAAGCTCTTCTAGAAATACACACACACACACACACACATACACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACCAAAGCTCTTCTAGAAATACACACACACACACACACACATACACA  300

seq1  CACACATACATATACATACACATATACATGTACAAACACACACATACACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACATACATATACATACACATATACATGTACAAACACACACATACACA  350

seq1  CTCATACAAACACATATACACACATACACATACATACACATACACACATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATACAAACACATATACACACATACACATACATACACATACACACATA  400

seq1  TACACACATACACACATATGCACACATGCACACACACATATACACACATG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACACATACACACATATGCACACATGCACACACACATATACACACATG  450

seq1  CACAT----ACACACACACACACACACACACACACACACACACACACACA  496
      |||||    |||||||||||||||||||||||||||||||||||||||||
seq2  CACATACACACACACACACACACACACACACACACACACACACACACACA  500

seq1  CACACTTTCCTCCCTTGCATTCTCCCTGCCTCTGTAGAGCAGCCTCACCC  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACTTTCCTCCCTTGCATTCTCCCTGCCTCTGTAGAGCAGCCTCACCC  550

seq1  AAACGGATTCATCATCGGTGCAGATTTAGTCTACTGAGCATAGCATCTTC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGGATTCATCATCGGTGCAGATTTAGTCTACTGAGCATAGCATCTTC  600

seq1  CGGGTTCATCCACATCATAGGGTGTGTCAGAACATGTCTTCTTTTTGAGA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGTTCATCCACATCATAGGGTGTGTCAGAACATGTCTTCTTTTTGAGA  650

seq1  CAGGCTAGCATCCCATCAAGACACTCCATGCACAGGAACACTCCCCAGTG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTAGCATCCCATCAAGACACTCCATGCACAGGAACACTCCCCAGTG  700

seq1  AACACAGAGACACTCTGACACTTGTCACGTGTGCATGGAACCTAGGCTGC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACAGAGACACTCTGACACTTGTCACGTGTGCATGGAACCTAGGCTGC  750

seq1  TTGCCACATGAACAATATGAGCATTGGTGTCCCTGACTTCTGTCCCTGCT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCACATGAACAATATGAGCATTGGTGTCCCTGACTTCTGTCCCTGCT  800

seq1  GTCTCCTTTTTGGGTACACCT-AAAAGTGAGCTTGCTGGGTCACGTGGCC  845
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GTCTCCTTTTTGGGTACACCTAAAAAGTGAGCTTGCTGGGTCACGTGGCC  850

seq1  ACTGTG-TTTACTCTGAGG-AAGCCTGTGCTAC-TTTCAAGTGTCTGCTC  892
      |||||| |||||||||||| ||||||||||||| ||||||||||||||||
seq2  ACTGTGTTTTACTCTGAGGAAAGCCTGTGCTACTTTTCAAGTGTCTGCTC  900

seq1  TGCTTTGCAGCCCTATCTGCAGAGATCAGAGCTCAGGCATAGCCAGCCAG  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTTGCAGCCCTATCTGCAGAGATCAGAGCTCAGGCATAGCCAGCCAG  950

seq1  CTTCTGCTTTTATGTTTTTTCCTTTTTAACAGTGTG-TGTGAGGCACC--  989
      ||||||| |||||||||||||||||||||||||||| |||||||||||  
seq2  CTTCTGC-TTTATGTTTTTTCCTTTTTAACAGTGTGTTGTGAGGCACCCT  999

seq1  TTCCTCCCACAATCTGGGTGCCCT-GGGTCATC--GCTCAGA--GGCAT-  1033
      | |||||||||||||||||||||| ||||||||   ||||||  | ||| 
seq2  TCCCTCCCACAATCTGGGTGCCCTGGGGTCATCCGCCTCAGAAGGCCATC  1049

seq1  CTATTACCACATCTGAAT-AGAGAAAGTG  1061
      |||||| ||||||||||| ||||||||||
seq2  CTATTATCACATCTGAATAAGAGAAAGTG  1078

seq1: chr12_114311741_114312258
seq2: B6Ng01-172G01.g_64_581 (reverse)

seq1  TTCCCCCCAACCCCCACCATGGCAGTGCTAGGTGCAGACCTAGACAGCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCCCAACCCCCACCATGGCAGTGCTAGGTGCAGACCTAGACAGCAG  50

seq1  TCCTTCCTCCCTGTGCCTCACTCCCCCAGTGGTTAGAGAGATGGTCCATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCCTCCCTGTGCCTCACTCCCCCAGTGGTTAGAGAGATGGTCCATT  100

seq1  TTCCTTGCCTACCTCATGGAGCTGTAATGAGAAGTCATGGAGAAGCACTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTGCCTACCTCATGGAGCTGTAATGAGAAGTCATGGAGAAGCACTT  150

seq1  TGTCCCTTTGAAGGATGACACCAAAGCCCCCCTGACAGGCAGTGCAGTGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCCTTTGAAGGATGACACCAAAGCCCCCCTGACAGGCAGTGCAGTGG  200

seq1  TACGAACCGCAGAGTGTGTTTGCATCCGAAGCTCTGAGGCATCACCCTCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACGAACCGCAGAGTGTGTTTGCATCCGAAGCTCTGAGGCATCACCCTCA  250

seq1  GAGCCTGCCAGTCTTAGAGGTCCCTGTCAAGCAACACCAGTTGCCATTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTGCCAGTCTTAGAGGTCCCTGTCAAGCAACACCAGTTGCCATTGC  300

seq1  TCATTGCTGTCAGTTGGGGGCCCTGCCTCTACCTTCAAGTTGGTTCCTGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTGCTGTCAGTTGGGGGCCCTGCCTCTACCTTCAAGTTGGTTCCTGC  350

seq1  CACCACCCTCTGAGTACGCAGCTCAGTATCACTGTAAAGGTACCAGTGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACCCTCTGAGTACGCAGCTCAGTATCACTGTAAAGGTACCAGTGCT  400

seq1  GGGAGGTGGGGGTGGGGAGGCGTGGGGAGGCGGGAGGCTCAGCCCTGAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAGGTGGGGGTGGGGAGGCGTGGGGAGGCGGGAGGCTCAGCCCTGAAG  450

seq1  CAATGGCTTGCCCTAGCCTTATCCTGCAAGCCTCACTTCTTCCTCTAGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGGCTTGCCCTAGCCTTATCCTGCAAGCCTCACTTCTTCCTCTAGCC  500

seq1  TCCATCTCAAATGAATTC  518
      ||||||||||||||||||
seq2  TCCATCTCAAATGAATTC  518

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information