MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-209H15
Chromosome	12 (Build37)
Map Location	18,566,518 - 18,567,645
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100042522, LOC100042528, Hpcal1, EG668525, LOC673341, EG245297, LOC100042573, LOC668539, LOC100043324, LOC636282, EG632781, LOC668541, LOC673160, 5730507C01Rik
Downstream gene	EG668553, LOC668558, LOC100042641, LOC668568, LOC668570, EG668413, LOC671401, EG546524, EG668584, EG544848, EG627871, LOC100042698, LOC629055
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042522 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Hpcal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53602 MGI:1855689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668525 MGI:3647701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	LOC673341 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	EG245297 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245297 MGI:3646928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC668539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins pseudo : _no_value

name	LOC100043324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 230 ESTs, 7 Proteins

name	LOC636282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG632781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632781 MGI:3648655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC668541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 146 ESTs, 6 Proteins pseudo : _no_value

name	LOC673160 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	5730507C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236366 MGI:1917882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668553 MGI:3645302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 23 Proteins pseudo : _no_value

name	LOC668558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins pseudo : _no_value

name	LOC100042641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC668568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC668570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG668413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668413 MGI:3643721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC671401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	EG546524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG668584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668584 MGI:3648979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	EG544848 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG627871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC629055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	LOC100042522 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262789 GeneID:100042522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042522 transcript_id : XM_001478374.1

name	Hpcal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354525 GeneID:53602 MGI:1855689
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hippocalcin-like 1 transcript_id : NM_016677.2

name	EG668525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262791 GeneID:668525 MGI:3647701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : predicted gene, EG668525 transcript_id : XM_001004778.2

name	EG245297 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392588 GeneID:245297 MGI:3646928
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG245297 transcript_id : NM_001018086.2

name	LOC100042573 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262793 GeneID:100042573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478449.1

name	LOC100043324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262876 GeneID:100043324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 230 ESTs, 7 Proteins product : similar to BNIP3L protein transcript_id : XM_001480439.1

name	LOC673160 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262795 GeneID:673160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001478468.1

name	5730507C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367376 GeneID:236366 MGI:1917882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730507C01 gene transcript_id : NM_001033157.2

name	LOC100042641 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262799 GeneID:100042641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478565.1

name	EG546524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262879 GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG546524 transcript_id : XM_001480466.1

name	EG544848 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392392 GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG544848, transcript variant 1 transcript_id : XM_001004780.1

name	LOC100042522 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262790 GeneID:100042522
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478424.1

name	Hpcal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949055 CCDS:CCDS25830.1 GeneID:53602 MGI:1855689
definition	codon_start : 1 note : neural visinin-like protein 3; visinin like 3; neural visinin-like 3 product : hippocalcin-like 1 protein_id : NP_057886.1

name	EG668525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262792 GeneID:668525 MGI:3647701
definition	codon_start : 1 product : predicted gene, EG668383 protein_id : XP_001004778.2

name	EG245297 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66348040 GeneID:245297 MGI:3646928
definition	codon_start : 1 product : hypothetical protein LOC245297 protein_id : NP_001018096.1

name	LOC100042573 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262794 GeneID:100042573
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478499.1

name	LOC100043324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262877 GeneID:100043324
definition	codon_start : 1 product : similar to BNIP3L protein protein_id : XP_001480489.1

name	LOC673160 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262796 GeneID:673160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478518.1

name	5730507C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701598 GeneID:236366 MGI:1917882
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC236366 protein_id : NP_001028329.1

name	LOC100042641 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262800 GeneID:100042641
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478615.1

name	EG546524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262880 GeneID:546524 MGI:3647171
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480516.1

name	EG544848 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392393 GeneID:544848 MGI:3647969
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2, isoform 1 protein_id : XP_001004780.1

name	LOC100042528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042528
definition	number : 2 pseudo : _no_value

name	LOC100042528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042528
definition	number : 1 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 1 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 2 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 3 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 4 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 1 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 2 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 3 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 4 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 1 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 2 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 3 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 1 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 2 pseudo : _no_value

name	LOC668568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668568
definition	number : 3 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 1 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 2 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 3 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 1 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 2 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 3 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 1 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 2 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 1 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 2 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 4 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 1 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 2 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 3 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 4 pseudo : _no_value

name	LOC668539 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262875 GeneID:668539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034692.1

name	LOC668541 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262878 GeneID:668541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 146 ESTs, 6 Proteins product : similar to protein phosphatase 1cgamma pseudo : _no_value transcript_id : XR_034696.1

name	EG668553 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262797 GeneID:668553 MGI:3645302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 23 Proteins product : predicted gene, EG668553 pseudo : _no_value transcript_id : XR_033730.1

name	LOC668558 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262798 GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_033734.1

name	EG627871 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94392463 GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627871 transcript_id : XR_002310.1

name	LOC629055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262881 GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034711.1

clone name	MSMg01-135C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366N01
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-141G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-209H15.b	B6Ng01-209H15.g
ACC	GA028084	GA028085
length	1,164	1,143
definition	B6Ng01-209H15.b	B6Ng01-209H15.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttgctcttgcagcaccatatctgcctgcatgctgccgtgtttcc cactataataatagtggaccgagactctgaaactgtaagctaaccccaat taaatgttttcctgtgggaagccattgcagagtggcagttgcagagtggc agttggctactgctggccaccacacatacatacttttgccaagatgaggt tttgagaattaaccaaagttaaccaatcagatgagagacaagttaaccaa tcagatgagagacaagttaaccaatcagatgagagagaacgcctctccta ggcctatataagcagcaccaattatgggcttggggtcacttcgcctctgc aatcaagctctcccaataaacgtgtacagaaggatcctgttgcagcgtca ttcttcctggccacttgggcgcgtgcaagaagtggtgccgaaaacccggg aaaagaaacatcttcaggcacaagcgaagaccccctgctacagggaggat tcagaactgcatcacagggaaggagcggttaatagagtgttcccgtaaaa cagactgctgagaaggatccagcatggattcagaactcttcagctgggga acggtggtaccggtaagtataaagaaattaatgtgagtctctgagaggca tgctttcctatgaaatagaaacgataattgtcgctggggttgtactgctt gctatctttcttgccttgatcttatgccatagccttaattgccaacgccc aaaatgtaaagatacaaaagatagtataaaaaataaaaagcagaaaatta agtcaatataccctcctctcgaggactctgagttgttagaattgtccagc tcagaggattcagaattatcagcaggagaggaagagatttgaaggagctg ctgctgagtatgagcagaaagatctggtccaatagggaggagtttcagtg ctcccccacctactccaccttatgcagatagaaagcattggcaatggtca ctctttttgcactctagagggttgcgtaaaatatgtcagctttctgtttt tcagatcagctcacagcgatatatggagccatatcgcataaccaagtgaa ggattagccagagtcagtaggactaagtcaatgctcttttactcagtccc caattggattgaga	gaattcagaggacaacttgtggaagctggttctcttttcctactatgtgg gtcttatggatcgaacccaggctgccaggcttggtagcaagtacctttac ccacagagtcagcccactggaccaaatacagagatggtttagagcatgga gcaggaaggatgcagggtgcacataagcatcgctcctgtgaagaactgac tgctgattcatcctttactgtgtcgttctgatttctataggaagccctat agacagctaatgtgtgtgtatgttatacatgtgtgtgcagatgaacaccc acccgtgcaaaggccaaacaggaataccggtgttcacaaggttccctttt ctctatcactgaacccggccggggcttaccattttagctaggctgcctgc tcagcaagcttctgggactcacttgtcccctagttctagggtttcgggca tgctcagccactcctggcttttccatgggtgttggtatcagaactcaggt tctcatgatgggtatcaagtgttcttcaacactgagccattttcccagtt cttgctttgacaattcttaatcacctatctgagcctcagatctcattaga ggttaaaaaaaaaagacccgttttatagaattgtgtgaataagcctgatg gatgagcacagctggggcctgatgtccagcaagcaatcgatagatgcttg gcttttatccttattctctgcaaagacaggcagtcctttagtacaccaag tagcaactgggcagaggaaatacctggtgcatggggccggggatgggggt cctggatgcctgcactccccatgcgccaggccctgtaaagtgcaaggtac ctgcactaactccaacatttcactgaagctgatgtagccattgctgttct taggttcagacatgctgaaggcccaacttcagcttctgttccagcttgcc cccgagaggtcaagcctcagagccattgatgattacctcggaagttgata gtgccgtcacctgtgggtgtcaaaccgtgtggagacaatgttcagtgacc ttgtagtgtctctgtaggggtggagttgccctagatcctaaacttgtcca cagtccaggtgaccagatggggacacagtcaatgagggcagtc
quality values	Open. Hide. 58 36 27 28 58 58 58 49 31 43 62 62 62 62 49 41 37 62 47 62 54 47 39 62 62 54 62 62 49 62 62 62 59 43 30 35 38 45 50 43 50 56 49 49 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 62 62 47 45 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 54 58 58 58 49 58 58 58 58 58 58 58 58 58 58 52 58 52 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 54 41 58 54 42 58 41 42 58 58 54 54 58 54 58 58 58 42 41 58 53 53 53 58 54 54 58 51 58 58 58 52 52 58 58 58 58 58 58 58 48 37 49 58 52 51 58 51 50 44 41 58 58 50 50 58 52 53 46 53 51 58 58 58 58 58 50 53 53 45 53 53 58 41 51 58 51 51 53 58 52 58 58 58 27 41 41 58 27 52 51 58 51 58 58 52 50 58 51 53 53 54 58 49 50 50 53 53 58 58 50 51 50 54 40 39 52 50 58 58 52 53 53 53 53 41 54 54 54 36 54 54 39 42 39 52 54 33 49 35 49 52 51 51 37 39 36 39 53 39 33 32 53 42 44 35 46 52 45 45 45 41 53 53 52 54 42 44 37 54 51 33 31 51 33 32 27 19 37 44 39 33 46 26 45 51 38 44 47 34 28 51 47 34 43 53 35 31 53 53 51 42 26 31 53 25 47 52 53 34 53 32 53 40 53 45 53 39 52 52 53 53 38 31 19 51 51 51 42 30 30 30 29 51 51 51 43 35 51 32 44 33 33 43 31 31 37 30 45 28 29 46 46 31 31 45 45 42 41 31 38 32 28 46 30 32 37 31 26 34 38 22 42 31 43 25 35 33 31 42 35 31 32 42 32 42 31 30 32 37 38 35 32 22 41 26 31 32 20 38 38 28 27 33 31 28 39 26 31 32 26 32 37 17 21 21 38 31 41 31 31 24 27 31 20 6 20 21 48 38 42 30 31 13 14 16 5 13 31 37 37 37 36 38 35 32 34 25 32 31 34 31 12 5 11 21 9 44 48 32 26 32 21 32 31 30 25 15 33 33 19 23 30 8 23 43 17 37 22 18 26 11 25 47 19 34 27 31 28 34 31 34 29 48 48 39 26 15 18 17 23 26 30 32 26 27 23 22 30 11 20 26 20 21 28 20 22 28 10 20 13 21 34 18 20 6 5 3 10 10 21 14 15 20 20 21 21 4 11 24 19 25 21 20 34 47 34 20 14 18 20 14 28 29 6 16 13 27 18 34 21 14 10 18 14 27 28 21 38 28 17 7 14 18 14 13 17 6 12 9 17 29 18 15 3 9 14 28 30 28 20 14 6 11 8 16 15 23 8 9 6 6 24 9 5 12 6 4 15 13 6 27 10 19 9 5 21 5 17 8 8 3 6 23 15 10 7 8 16 8 17 10 6 11 11 7 6 3 3 13 6 5 21 18 17 5 4 9 5 16 5 11 4 3 8 5 8 5 2 2 6 5 2 3 2 3 6 5 9 8 8 5 5 3 1 9 6 28 16 17 8 6 3 2 3 3 4 10 24 3 1 3 16 7 6 4 4 4 9 10 4 4 9 5	Open. Hide. 62 47 42 39 62 47 37 37 62 56 62 38 24 56 35 42 32 28 32 34 34 43 44 59 51 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 56 48 54 62 59 62 62 59 62 62 62 62 62 62 62 59 54 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 54 54 62 59 59 62 62 62 62 59 59 59 38 54 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 18 13 13 8 19 18 51 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 52 54 62 62 62 62 62 49 62 62 62 62 54 62 62 62 62 58 58 54 58 58 58 48 58 58 58 54 45 42 54 54 58 58 58 58 54 54 58 58 58 54 52 52 58 49 58 58 54 58 54 58 58 46 58 58 58 52 54 54 54 52 52 54 54 49 58 58 58 54 58 58 54 54 54 50 35 47 54 58 54 54 46 52 52 58 58 52 58 58 58 58 54 58 58 58 58 34 58 58 58 51 41 36 58 52 54 58 51 41 58 58 54 53 58 41 51 49 51 39 58 58 58 58 58 58 58 49 49 48 42 34 49 58 51 46 58 58 46 50 46 49 50 58 28 34 58 53 53 54 49 51 58 49 42 46 49 49 58 58 50 51 47 46 58 43 48 39 51 58 26 52 46 40 49 40 46 54 53 58 58 50 50 50 52 58 51 37 50 42 50 53 53 42 35 30 20 21 51 53 29 39 50 49 51 50 50 52 52 42 45 34 36 37 51 51 36 58 58 58 39 35 53 53 50 39 51 52 58 35 39 38 50 41 50 42 53 54 53 53 35 32 29 50 54 40 53 42 39 38 51 29 34 28 26 9 21 32 50 37 49 49 34 49 49 52 41 21 45 54 11 28 34 39 54 41 42 43 33 31 8 54 52 54 42 42 34 41 53 40 40 37 32 45 32 37 40 53 54 54 20 7 28 27 54 47 41 22 15 46 54 54 54 35 34 32 47 32 27 24 47 31 32 26 32 32 32 40 21 41 41 32 53 51 47 33 26 34 30 31 31 40 31 12 40 28 52 32 18 31 24 27 40 30 31 28 37 15 16 23 36 51 30 26 14 6 9 15 24 32 33 15 7 11 27 26 24 37 17 31 31 29 42 51 42 20 18 12 29 31 30 30 32 31 34 20 43 23 31 22 31 18 33 42 18 22 28 25 26 24 13 6 13 28 11 10 26 11 23 9 9 20 15 9 42 13 9 26 34 36 31 30 32 18 11 26 20 31 10 6 8 25 22 23 23 7 6 22 16 14 19 21 26 11 13 26 27 33 27 32 26 22 11 12 48 48 48 32 10 41 24 36 33 38 24 19 10 9 31 7 7 20 33 19 6 13 10 15 14 25 5 7 11 22 10 11 44 8 6 14 29 14 22 11 11 10 25 26 6 15 15 31 10 7 24 16 14 33 33 17 18 6 11 5 11 6 9 4 4 5 36 17 16 21 17 24 12 23 21 8 12 20 17 28 16 22 10 4 4 19 7 7 11 19 20 29 19 18 14 7 6 6 13 6 9 25 21 27 3 4 3 3 3 4 6 8 14 24 20 5 7 7 27 38 3 3 3 3 25 10 11 17 8 5 30 21 7 8 6 7 11 7 5 27 25 19 19 6 21 17 23 11 16 15 5 21 20 19 6 8 9 8 13 16 10 11 11 17 23 8 6 6 6 18 21 19 12 7 8 11 5 5 6 4 8 6 10 10 4 4 1 3 7 3 5 3 2 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_18566518_18567645
seq2: B6Ng01-209H15.g_63_1205 (reverse)

seq1  GACT-CCCTCAATGACTGT---CCCA-CTGGTCACCT-GACTGTGGACAA  44
      |||| |||||| |||||||   |||| |||||||||| ||||||||||||
seq2  GACTGCCCTCATTGACTGTGTCCCCATCTGGTCACCTGGACTGTGGACAA  50

seq1  TTTTAAGATCTAGGCCAACTTCTTCCCCTACAGAGACACCTCCAAGTTCA  94
       |||| |||||||| |||| ||  |||||||||||||| || |||| |||
seq2  GTTTAGGATCTAGGGCAAC-TCCACCCCTACAGAGACA-CTACAAGGTCA  98

seq1  CTGAACA-TGTCTTCCACAC-GTTTGACACCAACA-GTGACGGCACTATC  141
      ||||||| |||| ||||||| |||||||||| ||| ||||||||||||||
seq2  CTGAACATTGTC-TCCACACGGTTTGACACCCACAGGTGACGGCACTATC  147

seq1  AACTTCCGA-GTATTCATC-ATTGCTCTGA-GCCTGACCTCTC-GGGGCA  187
      ||||||||| ||| ||||| || ||||||| || ||||||||| ||||||
seq2  AACTTCCGAGGTAATCATCAATGGCTCTGAGGCTTGACCTCTCGGGGGCA  197

seq1  AGCTGGAACAGAAGCTGAAG-TGGGCCTTCAGCATGTCTG-ACCTA--GA  233
      |||||||||||||||||||| ||||||||||||||||||| |||||   |
seq2  AGCTGGAACAGAAGCTGAAGTTGGGCCTTCAGCATGTCTGAACCTAAGAA  247

seq1  CAGCAATGGCTACATCAGCTTCAGTGAAATGTTGGAGTTAGTGCAGGTAC  283
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAATGGCTACATCAGCTTCAGTGAAATGTTGGAGTTAGTGCAGGTAC  297

seq1  C-TGCACTTTACAGGGCCTGGCGCATGGGGAGTGCAGGCATCCAGGACCC  332
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCACTTTACAGGGCCTGGCGCATGGGGAGTGCAGGCATCCAGGACCC  347

seq1  CCATCCCCGGCCCCATGCACCAGGTATTTCCTCTGCCCAGTTGCTACTTG  382
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCCCCGGCCCCATGCACCAGGTATTTCCTCTGCCCAGTTGCTACTTG  397

seq1  GTGTACTAAAGGACTGCCTGTCTTTGCAGAGAATAAGGATAAAAGCCAAG  432
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTACTAAAGGACTGCCTGTCTTTGCAGAGAATAAGGATAAAAGCCAAG  447

seq1  CATCTATCGATTGCTTGCTGGACATCAGGCCCCAGCTGTGCTCATCCATC  482
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTATCGATTGCTTGCTGGACATCAGGCCCCAGCTGTGCTCATCCATC  497

seq1  AGGCTTATTCACACAATTCTATAAAACGGGTCTTTTTTTTTTAACCTCTA  532
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTTATTCACACAATTCTATAAAACGGGTCTTTTTTTTTTAACCTCTA  547

seq1  ATGAGATCTGAGGCTCAGATAGGTGATTAAGAATTGTCAAAGCAAGAACT  582
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGATCTGAGGCTCAGATAGGTGATTAAGAATTGTCAAAGCAAGAACT  597

seq1  GGGAAAATGGCTCAGTGTTGAAGAACACTTGATACCCATCATGAGAACCT  632
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAAATGGCTCAGTGTTGAAGAACACTTGATACCCATCATGAGAACCT  647

seq1  GAGTTCTGATACCAACACCCATGGAAAAGCCAGGAGTGGCTGAGCATGCC  682
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCTGATACCAACACCCATGGAAAAGCCAGGAGTGGCTGAGCATGCC  697

seq1  CGAAACCCTAGAACTAGGGGACAAGTGAGTCCCAGAAGCTTGCTGAGCAG  732
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAAACCCTAGAACTAGGGGACAAGTGAGTCCCAGAAGCTTGCTGAGCAG  747

seq1  GCAGCCTAGCTAAAATGGTAAGCCCCGGCCGGGTTCAGTGATAGAGAAAA  782
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCCTAGCTAAAATGGTAAGCCCCGGCCGGGTTCAGTGATAGAGAAAA  797

seq1  GGGAACCTTGTGAACACCGGTATTCCTGTTTGGCCTTTGCACGGGTGGGT  832
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAACCTTGTGAACACCGGTATTCCTGTTTGGCCTTTGCACGGGTGGGT  847

seq1  GTTCATCTGCACACACATGTATAACATACACACACATTAGCTGTCTATAG  882
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCATCTGCACACACATGTATAACATACACACACATTAGCTGTCTATAG  897

seq1  GGCTTCCTATAGAAATCAGAACGACACAGTAAAGGATGAATCAGCAGTCA  932
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTCCTATAGAAATCAGAACGACACAGTAAAGGATGAATCAGCAGTCA  947

seq1  GTTCTTCACAGGAGCGATGCTTATGTGCACCCTGCATCCTTCCTGCTCCA  982
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTTCACAGGAGCGATGCTTATGTGCACCCTGCATCCTTCCTGCTCCA  997

seq1  TGCTCTAAACCATCTCTGTATTTGGTCCAGTGGGCTGACTCTGTGGGTAA  1032
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCTAAACCATCTCTGTATTTGGTCCAGTGGGCTGACTCTGTGGGTAA  1047

seq1  AGGTACTTGCTACCAAGCCTGGCAGCCTGGGTTCGATCCATAAGACCCAC  1082
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTACTTGCTACCAAGCCTGGCAGCCTGGGTTCGATCCATAAGACCCAC  1097

seq1  ATAGTAGGAAAAGAGAACCAGCTTCCACAAGTTGTCCTCTGAATTC  1128
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTAGGAAAAGAGAACCAGCTTCCACAAGTTGTCCTCTGAATTC  1143

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information