MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-220O15
Chromosome	12 (Build37)
Map Location	71,439,713 - 71,525,513
singlet/doublet	doublet
Overlap gene	Trim9
Upstream gene	Sdccag1, Arf6, LOC100040856, LOC100040862, Gm71, Sos2, LOC100040879, L2hgdh, Atp5s, Cdkl1, Map4k5, Spg3a, EG622339, Sav1, LOC100040999, Nin, ENSMUSG00000056391, Gm804, Pygl
Downstream gene	Txndc1, LOC100040965, LOC100041061, Frmd6, Actr10, Psma3, 3110056K07Rik, Arid4a, Timm9, LOC100041035, 2700049A03Rik, LOC666162, Dact1, LOC100041190
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sdccag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66244 MGI:1918305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11845 MGI:99435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040862 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gm71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207965 MGI:2684917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sos2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20663 MGI:98355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 71 ESTs, 1 Protein

name	LOC100040879 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins pseudo : _no_value

name	L2hgdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217666 MGI:2384968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68055 MGI:1915305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdkl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71091 MGI:1918341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map4k5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399510 MGI:1925503
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spg3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73991 MGI:1921241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622339 MGI:3646088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sav1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64010 MGI:1927144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040999 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	Nin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18080 MGI:105108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	ENSMUSG00000056391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:791312 MGI:3641988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Gm804 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328121 MGI:2685650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Pygl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110095 MGI:97829
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94090 MGI:2137354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txndc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72736 MGI:1919986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040965 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100041061 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Frmd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319710 MGI:2442579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actr10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56444 MGI:1891654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psma3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19167 MGI:104883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110056K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73204 MGI:1920454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs

name	Arid4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238247 MGI:2444354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30056 MGI:1353436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100041035 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	2700049A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76967 MGI:1924217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 108 ESTs, 1 Protein

name	LOC666162 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Dact1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59036 MGI:1891740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Sdccag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32130520 GeneID:66244 MGI:1918305
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serologically defined colon cancer antigen 1 transcript_id : NM_025441.2

name	Arf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47106055 GeneID:11845 MGI:99435
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor 6 transcript_id : NM_007481.2

name	LOC100040856 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263270 GeneID:100040856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001475395.1

name	LOC100040862 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263272 GeneID:100040862
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100040862 transcript_id : XM_001475411.1

name	Gm71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:98986328 GeneID:207965 MGI:2684917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 71, (NCBI) transcript_id : NM_001033236.2

name	Sos2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263275 GeneID:20663 MGI:98355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 71 ESTs, 1 Protein product : Son of sevenless homolog 2 (Drosophila) transcript_id : XM_127051.8

name	L2hgdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703883 GeneID:217666 MGI:2384968
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : L-2-hydroxyglutarate dehydrogenase transcript_id : NM_145443.1

name	Atp5s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13386039 GeneID:68055 MGI:1915305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s transcript_id : NM_026536.1

name	Cdkl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366600 GeneID:71091 MGI:1918341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin-dependent kinase-like 1 (CDC2-related kinase) transcript_id : NM_183294.2

name	Map4k5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77736532 GeneID:399510 MGI:1925503
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : mitogen-activated protein kinase kinase kinase kinase 5 transcript_id : NM_024275.2

name	Spg3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348381 GeneID:73991 MGI:1921241
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spastic paraplegia 3A homolog (human) transcript_id : NM_178628.4

name	EG622339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486830 GeneID:622339 MGI:3646088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG622339 transcript_id : NM_001081297.1

name	Sav1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130409 GeneID:64010 MGI:1927144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : salvador homolog 1 (Drosophila) transcript_id : NM_022028.2

name	LOC100040999 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263281 GeneID:100040999
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : similar to Spg3a protein transcript_id : XM_001475450.1

name	Nin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346100 GeneID:18080 MGI:105108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ninein transcript_id : NM_001081453.1

name	Nin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346155 GeneID:18080 MGI:105108
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ninein transcript_id : NM_008697.2

name	ENSMUSG00000056391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263277 GeneID:791312 MGI:3641988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, ENSMUSG00000056391 transcript_id : XM_001475522.1

name	Gm804 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263283 GeneID:328121 MGI:2685650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : gene model 804, (NCBI), transcript variant 1 transcript_id : XM_001475466.1

name	Gm804 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263285 GeneID:328121 MGI:2685650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : gene model 804, (NCBI), transcript variant 2 transcript_id : XM_001475489.1

name	Pygl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875341 GeneID:110095 MGI:97829
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : liver glycogen phosphorylase transcript_id : NM_133198.1

name	Trim9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374604 GeneID:94090 MGI:2137354
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif protein 9 transcript_id : NM_053167.2

name	Txndc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859721 GeneID:72736 MGI:1919986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin domain containing 1 transcript_id : NM_028339.1

name	LOC100040965 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263279 GeneID:100040965
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to Ubtf protein transcript_id : XM_001475577.1

name	LOC100041061 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263290 GeneID:100041061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041061 transcript_id : XM_001475657.1

name	Frmd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328509 GeneID:319710 MGI:2442579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FERM domain containing 6 transcript_id : NM_028127.3

name	Actr10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9789886 GeneID:56444 MGI:1891654
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ARP10 actin-related protein 10 homolog (S. cerevisiae) transcript_id : NM_019785.1

name	Psma3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385658 GeneID:19167 MGI:104883
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, alpha type 3 transcript_id : NM_011184.3

name	3110056K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263287 GeneID:73204 MGI:1920454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs product : RIKEN cDNA 3110056K07 gene transcript_id : XM_898262.3

name	Arid4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487104 GeneID:238247 MGI:2444354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AT rich interactive domain 4A (Rbp1 like) transcript_id : NM_001081195.1

name	Timm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846098 GeneID:30056 MGI:1353436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 9 homolog (yeast) transcript_id : NM_001024854.1

name	Timm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846097 GeneID:30056 MGI:1353436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 9 homolog (yeast) transcript_id : NM_013896.3

name	Timm9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67846108 GeneID:30056 MGI:1353436
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 9 homolog (yeast) transcript_id : NM_001024853.1

name	LOC100041035 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263288 GeneID:100041035
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100041035 transcript_id : XM_001475684.1

name	2700049A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392886 GeneID:76967 MGI:1924217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 108 ESTs product : RIKEN cDNA 2700049A03 gene transcript_id : XM_126944.6

name	Dact1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130441 GeneID:59036 MGI:1891740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dapper homolog 1, antagonist of beta-catenin (xenopus) transcript_id : NM_021532.3

name	LOC100041190 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263297 GeneID:100041190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041190 transcript_id : XM_001475955.1

name	Sdccag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32130521 CCDS:CCDS25951.1 GeneID:66244 MGI:1918305
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : serologically defined colon cancer antigen 1 protein_id : NP_079717.2

name	Arf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680724 CCDS:CCDS25952.1 GeneID:11845 MGI:99435
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005768 - endosome [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0015031 - protein transport [Evidence TAS]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ADP-ribosylation factor 6 protein_id : NP_031507.1

name	LOC100040856 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263271 GeneID:100040856
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475445.1

name	LOC100040862 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263273 GeneID:100040862
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475461.1

name	Gm71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:98986329 GeneID:207965 MGI:2684917
definition	codon_start : 1 product : hypothetical protein LOC207965 protein_id : NP_001028408.2

name	Sos2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263276 GeneID:20663 MGI:98355
definition	codon_start : 1 product : Son of sevenless homolog 2 protein_id : XP_127051.8

name	L2hgdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703884 CCDS:CCDS25953.1 GeneID:217666 MGI:2384968
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0031305 - integral to mitochondrial inner membrane [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0047545 - 2-hydroxyglutarate dehydrogenase activity [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0044267 - cellular protein metabolism [Evidence ISS]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : L-2-hydroxyglutarate dehydrogenase protein_id : NP_663418.1

name	Atp5s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386040 CCDS:CCDS25954.1 GeneID:68055 MGI:1915305
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s protein_id : NP_080812.1

name	Cdkl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304105 CCDS:CCDS25955.1 GeneID:71091 MGI:1918341
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : cyclin-dependent kinase-like 1 (CDC2-related kinase) protein_id : NP_899117.1

name	Map4k5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77736533 GeneID:399510 MGI:1925503
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0005083 - small GTPase regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0006950 - response to stress [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : mitogen-activated protein kinase kinase kinase kinase 5 isoform 2 protein_id : NP_077237.2

name	Spg3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519971 GeneID:73991 MGI:1921241
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 product : atlastin protein_id : NP_848743.1

name	EG622339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486831 GeneID:622339 MGI:3646088
definition	GO_function : GO:0004365 - glyceraldehyde-3-phosphate dehydrogenase (phosphorylating) activity [Evidence IEA]; GO:0051287 - NAD binding [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : predicted gene, EG622339 protein_id : NP_001074766.1

name	Sav1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11528514 CCDS:CCDS25956.1 GeneID:64010 MGI:1927144
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : WW domain-containing protein 3; WW domain-containing protein 4 product : salvador homolog 1 protein_id : NP_071311.1

name	LOC100040999 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263282 GeneID:100040999
definition	codon_start : 1 product : similar to Spg3a protein protein_id : XP_001475500.1

name	Nin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346101 GeneID:18080 MGI:105108
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0051642 - centrosome localization [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : ninein isoform 1 protein_id : NP_001074922.1

name	Nin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346156 GeneID:18080 MGI:105108
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0051642 - centrosome localization [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ninein isoform 2 protein_id : NP_032723.2

name	ENSMUSG00000056391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263278 GeneID:791312 MGI:3641988
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475572.1

name	Gm804 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263284 GeneID:328121 MGI:2685650
definition	codon_start : 1 product : similar to C14ORF29 isoform 1 protein_id : XP_001475516.1

name	Gm804 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263286 GeneID:328121 MGI:2685650
definition	codon_start : 1 product : similar to C14ORF29 isoform 2 protein_id : XP_001475539.1

name	Pygl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875342 CCDS:CCDS25957.1 GeneID:110095 MGI:97829
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004645 - phosphorylase activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : liver glycogen phosphorylase protein_id : NP_573461.1

name	Trim9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930487 GeneID:94090 MGI:2137354
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0019717 - synaptosome [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0016079 - synaptic vesicle exocytosis [Evidence ISS] codon_start : 1 exception : mismatches in translation product : tripartite motif protein 9 protein_id : NP_444397.1

name	Txndc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859722 CCDS:CCDS25958.1 GeneID:72736 MGI:1919986
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : thioredoxin domain containing 1 protein_id : NP_082615.1

name	LOC100040965 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263280 GeneID:100040965
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475627.1

name	LOC100041061 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263291 GeneID:100041061
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475707.1

name	Frmd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328510 CCDS:CCDS25959.1 GeneID:319710 MGI:2442579
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : FERM domain containing 6 protein_id : NP_082403.2

name	Actr10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789887 CCDS:CCDS25960.1 GeneID:56444 MGI:1891654
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005869 - dynactin complex [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IDA] codon_start : 1 exception : mismatches in translation note : actin-related protein 11; actin-related protein 10 homolog; actin-related protein 11 homolog product : ARP10 actin-related protein 10 homolog protein_id : NP_062759.1

name	Psma3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981534 CCDS:CCDS25961.1 GeneID:19167 MGI:104883
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : proteasome (prosome, macropain) subunit, alpha type 3 protein_id : NP_035314.2

name	3110056K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392923 GeneID:73204 MGI:1920454
definition	codon_start : 1 product : hypothetical protein LOC73204 protein_id : XP_903355.2

name	Arid4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487105 GeneID:238247 MGI:2444354
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000785 - chromatin [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006333 - chromatin assembly or disassembly [Evidence IEA] codon_start : 1 note : retinoblastoma binding protein 1 product : retinoblastoma-binding protein 1 protein_id : NP_001074664.1

name	Timm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846109 CCDS:CCDS25962.1 GeneID:30056 MGI:1353436
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : translocase of inner mitochondrial membrane 10 homolog protein_id : NP_001020024.1

name	Timm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67846099 CCDS:CCDS25962.1 GeneID:30056 MGI:1353436
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : translocase of inner mitochondrial membrane 10 homolog protein_id : NP_001020025.1

name	Timm9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305573 CCDS:CCDS25962.1 GeneID:30056 MGI:1353436
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : translocase of inner mitochondrial membrane 10 homolog protein_id : NP_038924.1

name	LOC100041035 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263289 GeneID:100041035
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475734.1

name	2700049A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82942749 GeneID:76967 MGI:1924217
definition	codon_start : 1 product : hypothetical protein LOC76967 protein_id : XP_126944.5

name	Dact1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24158474 CCDS:CCDS25963.1 GeneID:59036 MGI:1891740
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007275 - development [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : thymus expressed gene 3 product : dapper 1 protein_id : NP_067507.2

name	LOC100041190 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263298 GeneID:100041190
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476005.1

name	LOC666162 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666162
definition	number : 4 pseudo : _no_value

name	LOC666162 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666162
definition	number : 3 pseudo : _no_value

name	LOC666162 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666162
definition	number : 2 pseudo : _no_value

name	LOC666162 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666162
definition	number : 1 pseudo : _no_value

name	LOC100040879 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263274 GeneID:100040879
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : similar to Chloride intracellular channel 4 pseudo : _no_value transcript_id : XR_032101.1

clone name	MSMg01-479G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-271K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249F19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-220O15.b	B6Ng01-220O15.g
ACC	GA036353	GA036354
length	1,164	696
definition	B6Ng01-220O15.b	B6Ng01-220O15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(71,524,349 - 71,525,513)	(71,439,713 - 71,440,403)
sequence	gaattcacattgctattctctgcatctgagagtattcaacaggatcctgc atatggaagttgattggcatgcagcctcccacgggcacacagaatgggag cagcatccccttgatccttgggctttccctctaaccagctcctgtacgtt atcgaatcagccgttccttcctaaattagacctttaccttgagggatcta ttaaaagagttccggccatatcagtaattagactgcaaatggagataaaa tagttgctagggactgttctgagtttgtatgtttccatcaacaaagcaga aaaagctttagagtctaaaactcagaaaagtttagtctgcatttgttatc ccagctcagctgcacaattatagaatagtatgcgattttctgaactctgt tatttagttttctcttaatgtaaagtgtagataataacagctcttattac ataggcattgacttagggcttaatttatcatatttataaaagttcttgct gaattttcaggattttcaagttattgttaaacataattcctattagaaat taagcaattaataaacaaattatatgaagtaaaaaataaatgctcaaaca ctcactttaaaaatatttaactattttaataatctctatgttttcaaggt tgcttacatcttttgaacacatatgtaccaataacacgtaatggtggggt actggctgcaaagctctagttagctactgtgttcagtagcatctcagctt ggtgattagaagaaatcagtgaacatagtaactcagacttctgtttgttt tgaaagctattgttgggctggagagatggcccagcagttaagatcctgag ttcaaatcccagcaaccacatggtggctcacaaccatctgtaatgggacc taatgccctctcctggtgcgtccgacagcgacagtgtactcatatacaca aaataaataaatcttttataaaagactttaaccagtattttttaggattt accattcttaaaatatatttagatacatttattttattagcatatttaat aaacacaacaatatattatttctgattgtgtattttttaaggtttgtttt taattttgtatgtatcagaaattagaggtactgaaattgatgcagtcggc tacttgcctatggc	gaattctctgcctatatgtttctttctgtttgtttttagagttcagcagc taaagccatcatagttgtagagactgaaggtgcagagaaacctttgcagg ggtggtgaagtgtgcagttctgagtgagagcatggacctggggcagggat gcagagccagttcattcaagctgcatttagttgggatgttgaagtctggc ctaagaaggtgggggaggtaaacccaatgggtaggacatagccggaaggt cagaaggtcagatggagtggggaggaggaagctaagaggcagataggact gtgactagttctagcctaacacactgcactttcatccagaagggtaaaag atggcaaacccagagccgaacaaaaatacagtgctcacgtccctgatgca actgcagaagaaagggacgacctgccagcaactacaagttggctcgagca gctgtgataaatgtggtgtgtgtgtgtgtgtgcgtgtgtgtgcgtgtgtg caagcgcgcgcgcagacacccttggaggtcagaagaaagcatcagactcc ctgagaacagcggttctcaatccttcctaatgtttgtgaccctttgaata tagttcctcatggtttgtggttatggtgataaaataaaaattttattggt tgcttcataactgtaattgtaatgctgttatgaatcatataatcaa
quality values	Open. Hide. 47 33 35 26 58 38 26 50 42 54 58 49 58 54 54 54 58 62 62 62 62 62 54 49 62 62 62 62 54 54 49 62 51 42 26 41 38 32 32 43 47 62 62 41 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 54 41 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 49 49 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 54 58 54 54 58 58 58 58 58 58 54 58 54 58 58 58 54 58 58 58 58 58 54 54 54 58 58 58 58 48 50 53 58 48 58 58 54 58 53 50 49 49 58 49 58 58 54 51 58 58 58 58 51 58 58 58 38 46 54 47 58 51 58 53 53 53 58 53 58 58 41 50 58 52 58 58 58 58 51 58 53 53 49 58 50 58 58 58 50 50 42 58 58 40 51 58 47 58 50 46 50 50 54 52 51 58 58 58 48 49 51 46 40 51 46 54 52 51 58 50 40 49 41 34 54 47 40 54 50 50 51 50 52 51 51 41 58 52 39 58 58 58 58 39 37 50 41 58 51 36 51 51 52 42 58 58 37 51 53 53 52 51 42 54 42 42 39 51 33 32 41 44 54 52 54 35 44 41 32 42 45 53 28 49 39 49 52 49 45 34 35 53 33 33 54 19 35 45 39 34 40 42 37 45 51 26 54 54 51 40 42 33 32 40 53 53 51 32 32 41 44 27 37 53 46 45 53 42 40 21 41 28 38 53 42 31 51 31 49 32 52 26 49 49 40 33 41 52 33 27 32 35 31 29 45 53 22 39 32 49 31 29 37 33 33 37 18 42 26 39 26 43 45 30 41 30 31 18 31 31 29 31 45 29 38 23 32 22 24 26 30 30 42 23 33 41 36 35 47 25 31 31 51 31 31 31 42 30 32 31 31 28 26 18 36 42 42 31 46 33 32 35 31 23 31 25 30 27 38 24 43 38 31 42 31 30 19 22 43 46 28 30 24 33 32 25 27 31 31 24 38 25 25 31 31 25 28 32 31 33 26 30 27 24 30 25 32 16 31 15 14 20 31 13 29 29 22 32 31 32 22 33 33 38 30 24 35 24 22 22 32 26 31 21 47 41 26 26 25 44 29 17 21 38 25 18 20 16 48 48 32 19 17 32 48 44 31 8 33 28 22 47 28 10 21 22 25 24 27 24 8 5 39 48 48 48 22 21 26 16 32 13 31 30 12 20 27 21 17 24 29 15 13 30 36 37 16 11 8 8 9 16 48 33 19 14 30 22 22 32 8 18 26 12 6 3 29 34 11 24 13 15 11 16 27 10 6 6 13 47 14 22 25 8 19 27 15 19 8 12 10 19 6 5 6 7 16 10 7 7 12 20 11 47 25 10 6 10 6 10 3 5 8 8 5 12 12 34 31 40 40 11 6 9 10 3 3 16 12 21 6 26 22 24 13 4 7 7 21 22 14 3 1 7 10 13 5 8 22 7 7 5 7 24 4 4 5 8 7 18 4 5 8 13 15 10 21 9 26 7 8 13 12 15 12 19 21 16 3 2 3 7 8 15 12 7 5 1 4 6 9 11 5 6 10 26 20 8	Open. Hide. 62 49 42 41 62 62 62 62 62 62 56 56 43 27 34 32 44 43 56 51 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 59 54 54 54 54 62 62 59 54 54 62 62 62 62 62 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 56 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 49 56 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 56 62 56 62 56 62 62 62 62 62 39 39 37 43 39 42 52 54 62 52 62 52 52 52 52 52 48 52 27 41 31 35 52 47 62 62 62 62 54 62 33 42 34 34 31 13 31 21 22 54 52 52 47 52 34 42 41 39 27 38 52 54 52 54 58 48 54 54 46 39 39 30 36 33 34 42 50 47 54 54 54 54 46 29 39 54 54 52 54 54 52 20 31 38 47 58 9 52 14 37 35 58 28 22 52 28 8 52 26 54 54 58 50 53 46 50 37 31 40 40 52 33 42 35 27 40 39 23 48 34 49 37 48 38 45 50 15 19 47 42 20 35 35 27 21 23 32 18 31 23 10 9 6 5 4 9 11 10 24 16 48 16 34 18 34 42 33 15 19 13 9 9 13 22 32 37 47 29 13 22 9 9 22 13 12 37 13 30 25 31 23 10 16 16 9 12 22 16 15 26 13 29 23 13 12 9 14 9 6 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_71524349_71525513
seq2: B6Ng01-220O15.b_45_1208 (reverse)

seq1  GCCATAGGCATGTAGCCGAACTGCATCAA-TTCAGTACTTCT-ATATCTG  48
      |||||||||| ||||||| |||||||||| |||||||| ||| || ||||
seq2  GCCATAGGCAAGTAGCCG-ACTGCATCAATTTCAGTACCTCTAATTTCTG  49

seq1  AATACATACAAAATAAAAACAAAACCTTAAAAAATACACAAATCAGAAAT  98
       ||||||||||||| ||||  |||||||||||||||||| ||||||||||
seq2  -ATACATACAAAATTAAAAACAAACCTTAAAAAATACAC-AATCAGAAAT  97

seq1  AATATA-TGTTGTGTTTATTAAATATGCTAATAAAATTAAATGTATCTAA  147
      |||||| ||||||||||||||||||||||||||||| |||||||||||||
seq2  AATATATTGTTGTGTTTATTAAATATGCTAATAAAA-TAAATGTATCTAA  146

seq1  ATATATTTTAAGAATGGTAAATCCT-AAAAATACTGGTTAAAGTCTTTTT  196
      ||||||||||||||||||||||||| ||||||||||||||||||| ||||
seq2  ATATATTTTAAGAATGGTAAATCCTAAAAAATACTGGTTAAAGTC-TTTT  195

seq1  ATAAAAGATTTATTTATTTTGTGTATATGAGTACACTGTCGCTGTCGGAC  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAGATTTATTTATTTTGTGTATATGAGTACACTGTCGCTGTCGGAC  245

seq1  GCACCAGGAGAGGGCATTAGGTCCCATTACAGATGGTTGTGAGCCACCAT  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACCAGGAGAGGGCATTAGGTCCCATTACAGATGGTTGTGAGCCACCAT  295

seq1  GTGGTTGCTGGGATTTGAACTCAGGATCTTAACTGCTGGGCCATCTCTCC  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTTGCTGGGATTTGAACTCAGGATCTTAACTGCTGGGCCATCTCTCC  345

seq1  AGCCCAACAATAGCTTTCAAAACAAACAGAAGTCTGAGTTACTATGTTCA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCAACAATAGCTTTCAAAACAAACAGAAGTCTGAGTTACTATGTTCA  395

seq1  CTGATTTCTTCTAATCACCAAGCTGAGATGCTACTGAACACAGTAGCTAA  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATTTCTTCTAATCACCAAGCTGAGATGCTACTGAACACAGTAGCTAA  445

seq1  CTAGAGCTTTGCAGCCAGTACCCCACCATTACGTGTTATTGGTACATATG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGAGCTTTGCAGCCAGTACCCCACCATTACGTGTTATTGGTACATATG  495

seq1  TGTTCAAAAGATGTAAGCAACCTTGAAAACATAGAGATTATTAAAATAGT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCAAAAGATGTAAGCAACCTTGAAAACATAGAGATTATTAAAATAGT  545

seq1  TAAATATTTTTAAAGTGAGTGTTTGAGCATTTATTTTTTACTTCATATAA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATATTTTTAAAGTGAGTGTTTGAGCATTTATTTTTTACTTCATATAA  595

seq1  TTTGTTTATTAATTGCTTAATTTCTAATAGGAATTATGTTTAACAATAAC  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTATTAATTGCTTAATTTCTAATAGGAATTATGTTTAACAATAAC  645

seq1  TTGAAAATCCTGAAAATTCAGCAAGAACTTTTATAAATATGATAAATTAA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAATCCTGAAAATTCAGCAAGAACTTTTATAAATATGATAAATTAA  695

seq1  GCCCTAAGTCAATGCCTATGTAATAAGAGCTGTTATTATCTACACTTTAC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTAAGTCAATGCCTATGTAATAAGAGCTGTTATTATCTACACTTTAC  745

seq1  ATTAAGAGAAAACTAAATAACAGAGTTCAGAAAATCGCATACTATTCTAT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAGAGAAAACTAAATAACAGAGTTCAGAAAATCGCATACTATTCTAT  795

seq1  AATTGTGCAGCTGAGCTGGGATAACAAATGCAGACTAAACTTTTCTGAGT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGTGCAGCTGAGCTGGGATAACAAATGCAGACTAAACTTTTCTGAGT  845

seq1  TTTAGACTCTAAAGCTTTTTCTGCTTTGTTGATGGAAACATACAAACTCA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGACTCTAAAGCTTTTTCTGCTTTGTTGATGGAAACATACAAACTCA  895

seq1  GAACAGTCCCTAGCAACTATTTTATCTCCATTTGCAGTCTAATTACTGAT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAGTCCCTAGCAACTATTTTATCTCCATTTGCAGTCTAATTACTGAT  945

seq1  ATGGCCGGAACTCTTTTAATAGATCCCTCAAGGTAAAGGTCTAATTTAGG  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCGGAACTCTTTTAATAGATCCCTCAAGGTAAAGGTCTAATTTAGG  995

seq1  AAGGAACGGCTGATTCGATAACGTACAGGAGCTGGTTAGAGGGAAAGCCC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAACGGCTGATTCGATAACGTACAGGAGCTGGTTAGAGGGAAAGCCC  1045

seq1  AAGGATCAAGGGGATGCTGCTCCCATTCTGTGTGCCCGTGGGAGGCTGCA  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGATCAAGGGGATGCTGCTCCCATTCTGTGTGCCCGTGGGAGGCTGCA  1095

seq1  TGCCAATCAACTTCCATATGCAGGATCCTGTTGAATACTCTCAGATGCAG  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAATCAACTTCCATATGCAGGATCCTGTTGAATACTCTCAGATGCAG  1145

seq1  AGAATAGCAATGTGAATTC  1165
      |||||||||||||||||||
seq2  AGAATAGCAATGTGAATTC  1164

seq1: chr12_71439713_71440403
seq2: B6Ng01-220O15.g_67_762

seq1  GAATTCTCTGCCTATATGTTTCTTTCTGTTTGTTTTTAGAGTTCAGCAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTGCCTATATGTTTCTTTCTGTTTGTTTTTAGAGTTCAGCAGC  50

seq1  TAAAGCCATCATAGTTGTAGAGACTGAAGGTGCAGAGAAACCTTTGCAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGCCATCATAGTTGTAGAGACTGAAGGTGCAGAGAAACCTTTGCAGG  100

seq1  GGTGGTGAAGTGTGCAGTTCTGAGTGAGAGCATGGACCTGGGGCAGGGAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGTGAAGTGTGCAGTTCTGAGTGAGAGCATGGACCTGGGGCAGGGAT  150

seq1  GCAGAGCCAGTTCATTCAAGCTGCATTTAGTTGGGATGTTGAAGTCTGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAGCCAGTTCATTCAAGCTGCATTTAGTTGGGATGTTGAAGTCTGGC  200

seq1  CTAAGAAGGTGGGGGAGGTAAACCCAATGGGTAGGACATAGCCGGAAGGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAGAAGGTGGGGGAGGTAAACCCAATGGGTAGGACATAGCCGGAAGGT  250

seq1  CAGAAGGTCAGATGGAGTGGGGAGGAGGAAGCTAAGAGGCAGATAGGACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGGTCAGATGGAGTGGGGAGGAGGAAGCTAAGAGGCAGATAGGACT  300

seq1  GTGACTAGTTCTAGCCTAACACACTGCACTTTCATCCAGAAGGGTAAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGACTAGTTCTAGCCTAACACACTGCACTTTCATCCAGAAGGGTAAAAG  350

seq1  ATGGCAAACCCAGAGCCGAACAAAAATACAGTGCTCACGTCCCTGATGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCAAACCCAGAGCCGAACAAAAATACAGTGCTCACGTCCCTGATGCA  400

seq1  ACTGCAGAAGAAAGGGACGACCTGCCAGCAACTACAAGTTGGCTCGAGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCAGAAGAAAGGGACGACCTGCCAGCAACTACAAGTTGGCTCGAGCA  450

seq1  GCTGTGATAAATGTGGTGTGTGTGTGTGTGTGCGTGTGTGTGCGTGTGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTGATAAATGTGGTGTGTGTGTGTGTGTGCGTGTGTGTGCGTGTGTG  500

seq1  CAAGCGCGCGCGCAGACACCCTTGGAGGTCAGAAGAAAGCATCAGACTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCGCGCGCGCAGACACCCTTGGAGGTCAGAAGAAAGCATCAGACTCC  550

seq1  CTGAGAACAGCGGTTCTCAATCCTTCCTAATG-TTGTGACCC-TTGAATA  598
      |||||||||||||||||||||||||||||||| ||||||||| |||||||
seq2  CTGAGAACAGCGGTTCTCAATCCTTCCTAATGTTTGTGACCCTTTGAATA  600

seq1  TAGTTCCTCATGGTTTGTGGTTATGGTGATAAA--TAAAATTTTATT-GT  645
      |||||||||||||||||||||||||||||||||   ||||||||||| ||
seq2  TAGTTCCTCATGGTTTGTGGTTATGGTGATAAAATAAAAATTTTATTGGT  650

seq1  TGCTTCATAACTGTAATTGTAATGCTGTTATGAATCATATAATCAA  691
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTCATAACTGTAATTGTAATGCTGTTATGAATCATATAATCAA  696

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information