MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-231G02
Chromosome	12 (Build37)
Map Location	116,385,827 - 116,386,947
singlet/doublet	singlet
Overlap gene	Igh
Upstream gene	Ighv7-3, Ighv15-1, Ighv14-4, EG668438, Ighv7-4, EG629833, EG633457, Ighv13-1, Ighv3-6, EG636260, Ighv3-7, Ighv5-21, Ighv3-8, Ighv8-1, Ighv1-1, Ighv13-2, EG435321, Ighv6-3, EG628398, EG639510, Ighv6-6, EG432701, EG629849, Ighv1-2, Ighv10-1, Ighv1-3, Ighv1-4, Ighv10-2, EG668469, EG380809, Ighv1-6, EG668474, Ighv10-4, Ighv1-8, Ighv15-2, Ighv1-9, Ighv1-10, Ighv1-11, EG629860, Ighv1-13, Ighv1-14, Ighv1-15, EG629866, Ighv1-17-1, Ighv1-17, Ighv1-18, EG668493, Ighv1-19, EG668497, Ighv1-21-1, Ighv1-21, Ighv1-22, Ighv1-23, Ighv1-24, Ighv1-25, Ighv1-26, Ighv1-27, Ighv1-28, Ighv1-29, Ighv1-30, Ighv1-31, Ighv1-32, Ighv1-33, Ighv1-34, EG668515, Ighv1-36, Ighv1-37, Ighv1-38, Ighv1-39, Ighv1-40, Ighv1-41, EG629906, EG629908, Ighv1-44, Ighv1-45, Ighv1-46, Ighv1-47, Ighv8-3, EG629919, Ighv1-48, Ighv1-49, EG640506, Ighv1-50, Ighv1-51, Ighv1-52
Downstream gene	Ighv1-53, EG629930, EG668534, EG211331, Ighv1-55, EG634662, Ighv1-56, EG629936, Ighv8-7, Ighv1-57, Ighv8-8, Ighv1-58, EG432708, Ighv1-60, Ighv1-61, Ighv1-62, EG668544, EG238448, EG668549, EG432709, EG668552, Ighv1-63, Ighv1-64, Ighv8-10, Ighv1-65, EG668554, EG636462, LOC217924, Ighv1-66, EG435328, Ighv1-68, LOC435329, EG668563, Ighv1-69, Ighv8-12, LOC619863, EG638634, EG619886, Ighv1-72, EG668575, EG668577, EG668582, Ighv1-75, Ighv1-77, Ighv1-78, GA_x5J8B7W27DS-1519-2216, Ighv1-79, LOC668586, Ighv1-80, Ighv1-81, Olfr241-ps1, Ighv1-83, EG434609, LOC668595, EG668597, EG668599, Zfp386, Vipr2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Igh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111507 MGI:96442
definition	gene_synonym : MGC118122; MGC118132; MGC19003; MGC25748; MGC6342; MGC68311; MGC91096 note : immunoglobulin heavy chain complex

name	Ighv7-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629822 IMGT/GENE-DB:IGHV7-3
definition	gene_synonym : IgH; V(11)-djn note : immunoglobulin heavy variable V7-3 pseudo : _no_value

name	Ighv15-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780827 IMGT/GENE-DB:IGHV15-1
definition	note : immunoglobulin heavy variable V15-1 pseudo : _no_value

name	Ighv14-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629826 IMGT/GENE-DB:IGHV14-4
definition	note : immunoglobulin heavy variable V14-4

name	EG668438 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668438 IMGT/GENE-DB:IGHV3-3 MGI:3643949
definition	gene_synonym : IGHV3-3 note : predicted gene, EG668438

name	Ighv7-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632654 IMGT/GENE-DB:IGHV7-4
definition	gene_synonym : V(13)-b note : immunoglobulin heavy variable V7-4

name	EG629833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629833 IMGT/GENE-DB:IGHV3-4 MGI:3644034
definition	gene_synonym : IGHV3-4 note : predicted gene, EG629833

name	EG633457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633457 IMGT/GENE-DB:IGHV3-5 MGI:3648045
definition	gene_synonym : C72-3A1; IGHV3-5 note : predicted gene, EG633457

name	Ighv13-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780828 IMGT/GENE-DB:IGHV13-1
definition	note : immunoglobulin heavy variable V13-1

name	Ighv3-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780829 IMGT/GENE-DB:IGHV3-6
definition	note : immunoglobulin heavy variable V3-6

name	EG636260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636260 IMGT/GENE-DB:IGHV9-4 MGI:3646379
definition	gene_synonym : IgH; IGHV9-4; MRP5 note : predicted gene, EG636260

name	Ighv3-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780830 IMGT/GENE-DB:IGHV3-7
definition	note : immunoglobulin heavy variable V3-7 pseudo : _no_value

name	Ighv5-21 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780832 IMGT/GENE-DB:IGHV5-21
definition	note : immunoglobulin heavy variable V5-21 pseudo : _no_value

name	Ighv3-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780831 IMGT/GENE-DB:IGHV3-8
definition	note : immunoglobulin heavy variable V3-8

name	Ighv8-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780833 IMGT/GENE-DB:IGHV8-1
definition	note : immunoglobulin heavy variable V8-1 pseudo : _no_value

name	Ighv1-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780834 IMGT/GENE-DB:IGHV1-1
definition	note : immunoglobulin heavy variable V1-1 pseudo : _no_value

name	Ighv13-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629842 IMGT/GENE-DB:IGHV13-2
definition	note : immunoglobulin heavy variable V13-2

name	EG435321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435321 IMGT/GENE-DB:IGHV12-3 MGI:3646760
definition	gene_synonym : IGHV12-3 note : predicted gene, EG435321

name	Ighv6-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629845 IMGT/GENE-DB:IGHV6-3
definition	note : immunoglobulin heavy variable V6-3

name	EG628398 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628398 IMGT/GENE-DB:IGHV6-4 MGI:3704120
definition	gene_synonym : Ighv6-4 note : predicted gene, EG628398

name	EG639510 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639510 IMGT/GENE-DB:IGHV6-5 MGI:3647134
definition	gene_synonym : IGHV6-5 note : predicted gene, EG639510

name	Ighv6-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238427 IMGT/GENE-DB:IGHV6-6
definition	gene_synonym : IgH; VH10G1 note : immunoglobulin heavy variable V6-6

name	EG432701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432701 IMGT/GENE-DB:IGHV6-7 MGI:3644477
definition	gene_synonym : IGHV6-7 note : predicted gene, EG432701

name	EG629849 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629849 IMGT/GENE-DB:IGHV8-2 MGI:3647474
definition	gene_synonym : IGHV8-2 note : predicted gene, EG629849

name	Ighv1-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238428 IMGT/GENE-DB:IGHV1-2
definition	note : immunoglobulin heavy variable V1-2 pseudo : _no_value

name	Ighv10-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380808 IMGT/GENE-DB:IGHV10-1
definition	note : immunoglobulin heavy variable V10-1

name	Ighv1-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780859 IMGT/GENE-DB:IGHV1-3
definition	note : immunoglobulin heavy variable V1-3 pseudo : _no_value

name	Ighv1-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432702 IMGT/GENE-DB:IGHV1-4
definition	note : immunoglobulin heavy variable V1-4

name	Ighv10-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780860 IMGT/GENE-DB:IGHV10-2
definition	note : immunoglobulin heavy variable V10-2 pseudo : _no_value

name	EG668469 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668469 IMGT/GENE-DB:IGHV1-5 MGI:3704121
definition	gene_synonym : Ighv1-5 note : predicted gene, EG668469

name	EG380809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	gene_synonym : IgH; IGHV10-3 note : predicted gene, EG380809

name	Ighv1-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	note : immunoglobulin heavy variable V1-6 pseudo : _no_value

name	EG668474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	gene_synonym : Ighv1-7 note : predicted gene, EG668474

name	Ighv10-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	note : immunoglobulin heavy variable V10-4 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	note : immunoglobulin heavy variable V1-8 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	note : immunoglobulin heavy variable V15-2

name	Ighv1-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	note : immunoglobulin heavy variable V1-9

name	Ighv1-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	note : immunoglobulin heavy variable V1-10 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	note : immunoglobulin heavy variable V1-11

name	EG629860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	gene_synonym : IGHV1-12 note : predicted gene, EG629860

name	Ighv1-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	note : immunoglobulin heavy variable V1-13 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	note : immunoglobulin heavy variable V1-14

name	Ighv1-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	note : immunoglobulin heavy variable V1-15

name	EG629866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	gene_synonym : IGHV1-16 note : predicted gene, EG629866

name	Ighv1-17-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	note : immunoglobulin heavy variable V1-17-1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	note : immunoglobulin heavy variable V1-17 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	note : immunoglobulin heavy variable V1-18

name	EG668493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	gene_synonym : Ighv1-19-1 note : predicted gene, EG668493

name	Ighv1-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	note : immunoglobulin heavy variable V1-19

name	EG668497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	gene_synonym : IGHV1-20 note : predicted gene, EG668497

name	Ighv1-21-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631595 IMGT/GENE-DB:IGHV1-21-1
definition	note : immunoglobulin heavy variable V1-21-1 pseudo : _no_value

name	Ighv1-21 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668499 IMGT/GENE-DB:IGHV1-21
definition	note : immunoglobulin heavy variable V1-21 pseudo : _no_value

name	Ighv1-22 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780883 IMGT/GENE-DB:IGHV1-22
definition	note : immunoglobulin heavy variable V1-22

name	Ighv1-23 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780884 IMGT/GENE-DB:IGHV1-23
definition	note : immunoglobulin heavy variable V1-23

name	Ighv1-24 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780885 IMGT/GENE-DB:IGHV1-24
definition	note : immunoglobulin heavy variable V1-24

name	Ighv1-25 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640497 IMGT/GENE-DB:IGHV1-25
definition	note : immunoglobulin heavy variable V1-25 pseudo : _no_value

name	Ighv1-26 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629884 IMGT/GENE-DB:IGHV1-26
definition	note : immunoglobulin heavy variable V1-26

name	Ighv1-27 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780886 IMGT/GENE-DB:IGHV1-27
definition	note : immunoglobulin heavy variable V1-27 pseudo : _no_value

name	Ighv1-28 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668510 IMGT/GENE-DB:IGHV1-28
definition	note : immunoglobulin heavy variable V1-28 pseudo : _no_value

name	Ighv1-29 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780887 IMGT/GENE-DB:IGHV1-29
definition	note : immunoglobulin heavy variable V1-29 pseudo : _no_value

name	Ighv1-30 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668511 IMGT/GENE-DB:IGHV1-30
definition	note : immunoglobulin heavy variable V1-30 pseudo : _no_value

name	Ighv1-31 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629893 IMGT/GENE-DB:IGHV1-31
definition	note : immunoglobulin heavy variable V1-31

name	Ighv1-32 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780888 IMGT/GENE-DB:IGHV1-32
definition	note : immunoglobulin heavy variable V1-32 pseudo : _no_value

name	Ighv1-33 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641247 IMGT/GENE-DB:IGHV1-33
definition	note : immunoglobulin heavy variable V1-33 pseudo : _no_value

name	Ighv1-34 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628614 IMGT/GENE-DB:IGHV1-34
definition	note : immunoglobulin heavy variable V1-34

name	EG668515 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668515 IMGT/GENE-DB:IGHV1-35 MGI:3644935
definition	gene_synonym : Ighv1-35 note : predicted gene, EG668515 pseudo : _no_value

name	Ighv1-36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629897 IMGT/GENE-DB:IGHV1-36
definition	note : immunoglobulin heavy variable V1-36

name	Ighv1-37 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668517 IMGT/GENE-DB:IGHV1-37
definition	note : immunoglobulin heavy variable V1-37

name	Ighv1-38 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780890 IMGT/GENE-DB:IGHV1-38
definition	note : immunoglobulin heavy variable V1-38 pseudo : _no_value

name	Ighv1-39 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780891 IMGT/GENE-DB:IGHV1-39
definition	note : immunoglobulin heavy variable V1-39

name	Ighv1-40 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780892 IMGT/GENE-DB:IGHV1-40
definition	note : immunoglobulin heavy variable V1-40 pseudo : _no_value

name	Ighv1-41 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629904 IMGT/GENE-DB:IGHV1-41
definition	note : immunoglobulin heavy variable V1-41 pseudo : _no_value

name	EG629906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629906 IMGT/GENE-DB:IGHV1-42 MGI:3704123
definition	gene_synonym : Ighv1-42 note : predicted gene, EG629906

name	EG629908 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629908 IMGT/GENE-DB:IGHV1-43 MGI:3704124
definition	gene_synonym : Ighv1-43 note : predicted gene, EG629908

name	Ighv1-44 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668521 IMGT/GENE-DB:IGHV1-44
definition	note : immunoglobulin heavy variable V1-44 pseudo : _no_value

name	Ighv1-45 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780894 IMGT/GENE-DB:IGHV1-45
definition	note : immunoglobulin heavy variable V1-45 pseudo : _no_value

name	Ighv1-46 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668522 IMGT/GENE-DB:IGHV1-46
definition	note : immunoglobulin heavy variable V1-46 pseudo : _no_value

name	Ighv1-47 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629915 IMGT/GENE-DB:IGHV1-47
definition	note : immunoglobulin heavy variable V1-47

name	Ighv8-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780927 IMGT/GENE-DB:IGHV8-3
definition	note : immunoglobulin heavy variable V8-3 pseudo : _no_value

name	EG629919 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629919 IMGT/GENE-DB:IGHV8-4 MGI:3646040
definition	gene_synonym : IGHV8-4 note : predicted gene, EG629919

name	Ighv1-48 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780928 IMGT/GENE-DB:IGHV1-48
definition	note : immunoglobulin heavy variable V1-48 pseudo : _no_value

name	Ighv1-49 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629925 IMGT/GENE-DB:IGHV1-49
definition	note : immunoglobulin heavy variable V1-49

name	EG640506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640506 IMGT/GENE-DB:IGHV8-5 MGI:3645478
definition	gene_synonym : IGHV8-5 note : predicted gene, EG640506

name	Ighv1-50 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780929 IMGT/GENE-DB:IGHV1-50
definition	note : immunoglobulin heavy variable V1-50

name	Ighv1-51 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780930 IMGT/GENE-DB:IGHV1-51
definition	note : immunoglobulin heavy variable V1-51 pseudo : _no_value

name	Ighv1-52 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382696 IMGT/GENE-DB:IGHV-1-52
definition	note : immunoglobulin heavy variable V1-52

name	Ighv1-53 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780931 IMGT/GENE-DB:IGHV1-53
definition	note : immunoglobulin heavy variable V1-53

name	EG629930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629930 IMGT/GENE-DB:IGHV8-6 MGI:3645823
definition	gene_synonym : IGHV8-6 note : predicted gene, EG629930

name	EG668534 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668534 MGI:3646995
definition	note : predicted gene, EG668534 pseudo : _no_value

name	EG211331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211331 IMGT/GENE-DB:IGHV1-54 MGI:3647133
definition	gene_synonym : IgH; IGHV1-54; VH note : predicted gene, EG211331

name	Ighv1-55 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780932 IMGT/GENE-DB:IGHV1-55
definition	note : immunoglobulin heavy variable V1-55

name	EG634662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634662 MGI:3646714
definition	note : predicted gene, EG634662 pseudo : _no_value

name	Ighv1-56 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382695 IMGT/GENE-DB:IGHV1-56
definition	note : immunoglobulin heavy variable V1-56

name	EG629936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629936 MGI:3645821
definition	note : predicted gene, EG629936 pseudo : _no_value

name	Ighv8-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780936 IMGT/GENE-DB:IGHV8-7
definition	note : immunoglobulin heavy variable V8-7 pseudo : _no_value

name	Ighv1-57 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780937 IMGT/GENE-DB:IGHV1-57
definition	note : immunoglobulin heavy variable V1-57

name	Ighv8-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780938 IMGT/GENE-DB:IGHV8-8
definition	note : immunoglobulin heavy variable V8-8

name	Ighv1-58 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780939 IMGT/GENE-DB:IGHV1-58
definition	note : immunoglobulin heavy variable V1-58

name	EG432708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432708 IMGT/GENE-DB:IGHV1-59 MGI:3644474
definition	gene_synonym : IgH; IGHV1-59 note : predicted gene, EG432708

name	Ighv1-60 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780940 IMGT/GENE-DB:IGHV1-60
definition	note : immunoglobulin heavy variable V1-60 pseudo : _no_value

name	Ighv1-61 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674018 IMGT/GENE-DB:IGHV1-61
definition	gene_synonym : Vh3 note : immunoglobulin heavy variable V1-61

name	Ighv1-62 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668542 IMGT/GENE-DB:IGHV1-62
definition	note : immunoglobulin heavy variable V1-62 pseudo : _no_value

name	EG668544 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668544 IMGT/GENE-DB:IGHV1-62-1 MGI:3704125
definition	gene_synonym : Ighv1-62-1 note : predicted gene, EG668544

name	EG238448 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238448 IMGT/GENE-DB:IGHV1-62-2 MGI:3644968
definition	gene_synonym : IGHV1-62-2 note : predicted gene, EG238448

name	EG668549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668549 IMGT/GENE-DB:IGHV1-63-1 MGI:3648544
definition	gene_synonym : IGHV1-62-3 note : predicted gene, EG668549

name	EG432709 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432709 IMGT/GENE-DB:IGHV8-9 MGI:3644475
definition	gene_synonym : IGHV8-9 note : predicted gene, EG432709

name	EG668552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668552 MGI:3645301
definition	note : predicted gene, EG668552 pseudo : _no_value

name	Ighv1-63 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780956 IMGT/GENE-DB:IGHV1-63
definition	note : immunoglobulin heavy variable V1-63

name	Ighv1-64 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380823 IMGT/GENE-DB:IGHV1-64
definition	note : immunoglobulin heavy variable V1-64

name	Ighv8-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780957 IMGT/GENE-DB:IGHV8-10
definition	note : immunoglobulin heavy variable V8-10 pseudo : _no_value

name	Ighv1-65 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780958 IMGT/GENE-DB:IGHV1-65
definition	note : immunoglobulin heavy variable V1-65 pseudo : _no_value

name	EG668554 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668554 MGI:3645306
definition	note : predicted gene, EG668554 pseudo : _no_value

name	EG636462 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636462 IMGT/GENE-DB:IGHV8-11 MGI:3644925
definition	gene_synonym : IGHV8-11 note : predicted gene, EG636462

name	LOC217924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:217924
definition	note : ribosomal protein L7a pseudogene pseudo : _no_value

name	Ighv1-66 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380824 IMGT/GENE-DB:IGHV1-66
definition	note : immunoglobulin heavy variable V1-66

name	EG435328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435328 IMGT/GENE-DB:IGHV1-67 MGI:3645228
definition	gene_synonym : IGHV1-67 note : predicted gene, EG435328

name	Ighv1-68 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780959 IMGT/GENE-DB:IGHV1-68
definition	note : immunoglobulin heavy variable V1-68

name	LOC435329 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435329
definition	note : cell division cycle 5-like pseudogene pseudo : _no_value

name	EG668563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668563 MGI:3648326
definition	note : predicted gene, EG668563 pseudo : _no_value

name	Ighv1-69 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619833 IMGT/GENE-DB:IGHV1-69
definition	note : immunoglobulin heavy variable V1-69

name	Ighv8-12 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780960 IMGT/GENE-DB:IGHV8-12
definition	note : immunoglobulin heavy variable V8-12

name	LOC619863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619863
definition	note : high mobility group box 2 pseudogene pseudo : _no_value

name	EG638634 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638634 IMGT/GENE-DB:IGHV1-70 MGI:3644620
definition	gene_synonym : IGHV1-70 note : predicted gene, EG638634

name	EG619886 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619886 IMGT/GENE-DB:IGHV1-71 MGI:3643033
definition	gene_synonym : IGHV1-71 note : predicted gene, EG619886

name	Ighv1-72 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619916
definition	note : immunoglobulin heavy variable V1-72

name	EG668575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668575 MGI:3645129
definition	note : predicted gene, EG668575 pseudo : _no_value

name	EG668577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668577 IMGT/GENE-DB:IGHV1-73 MGI:3645131
definition	gene_synonym : Ighv1-73 note : predicted gene, EG668577

name	EG668582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668582 IMGT/GENE-DB:IGHV8-14 MGI:3648977
definition	gene_synonym : IGHV8-14 note : predicted gene, EG668582

name	Ighv1-75 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622728 IMGT/GENE-DB:IGHV1-75
definition	note : immunoglobulin heavy variable V1-75

name	Ighv1-77 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619994 IMGT/GENE-DB:IGHV1-77
definition	gene_synonym : IgH note : immunoglobulin heavy variable V1-77

name	Ighv1-78 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:213570
definition	note : immunoglobulin heavy variable V1-78

name	GA_x5J8B7W27DS-1519-2216 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257855
definition	note : olfactory receptor GA_x5J8B7W27DS-1519-2216 pseudo : _no_value

name	Ighv1-79 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435331 IMGT/GENE-DB:IGHV1-79
definition	note : immunoglobulin heavy variable V1-79

name	LOC668586 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668586
definition	note : signaling molecule ATTP pseudogene pseudo : _no_value

name	Ighv1-80 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668589 IMGT/GENE-DB:IGHV1-80
definition	note : immunoglobulin heavy variable V1-80

name	Ighv1-81 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668591 IMGT/GENE-DB:IGHV1-81
definition	note : immunoglobulin heavy variable V1-81

name	Olfr241-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404357 MGI:3030075
definition	gene_synonym : MOR179-8_p note : olfactory receptor 241, pseudogene 1 pseudo : _no_value

name	Ighv1-83 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620140 IMGT/GENE-DB:IGHV1-83
definition	note : immunoglobulin heavy variable V1-83

name	EG434609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434609 IMGT/GENE-DB:IGHV1-84 MGI:3644235
definition	gene_synonym : IgH; IGHV1-84 note : predicted gene, EG434609

name	LOC668595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668595
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	EG668597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668597 IMGT/GENE-DB:IGHV1-85 MGI:3645723
definition	gene_synonym : IGHV1-85 note : predicted gene, EG668597

name	EG668599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668599 IMGT/GENE-DB:IGHV1-86 MGI:3645729
definition	gene_synonym : Ighv1-86 note : predicted gene, EG668599

name	Zfp386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56220 MGI:1930708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vipr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22355 MGI:107166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102384 GeneID:56220 MGI:1930708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 386 (Kruppel-like) transcript_id : NM_001004066.2

name	Zfp386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102383 GeneID:56220 MGI:1930708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 386 (Kruppel-like) transcript_id : NM_019565.3

name	Vipr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678574 GeneID:22355 MGI:107166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasoactive intestinal peptide receptor 2 transcript_id : NM_009511.1

name	Ighv7-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629822 IMGT/GENE-DB:IGHV7-3
definition	codon_start : 1 gene_synonym : IgH; V(11)-djn pseudo : _no_value

name	Ighv15-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780827 IMGT/GENE-DB:IGHV15-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv14-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629826 IMGT/GENE-DB:IGHV14-4
definition	codon_start : 1 exception : rearrangement required for product

name	EG668438 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668438 IMGT/GENE-DB:IGHV3-3 MGI:3643949
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV3-3

name	Ighv7-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:632654 IMGT/GENE-DB:IGHV7-4
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : V(13)-b

name	EG629833 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629833 IMGT/GENE-DB:IGHV3-4 MGI:3644034
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV3-4

name	EG633457 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:633457 IMGT/GENE-DB:IGHV3-5 MGI:3648045
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : C72-3A1; IGHV3-5

name	Ighv13-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780828 IMGT/GENE-DB:IGHV13-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv3-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780829 IMGT/GENE-DB:IGHV3-6
definition	codon_start : 1 exception : rearrangement required for product

name	EG636260 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:636260 IMGT/GENE-DB:IGHV9-4 MGI:3646379
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV9-4; MRP5

name	Ighv3-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780830 IMGT/GENE-DB:IGHV3-7
definition	codon_start : 1 pseudo : _no_value

name	Ighv5-21 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780832 IMGT/GENE-DB:IGHV5-21
definition	codon_start : 1 pseudo : _no_value

name	Ighv3-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780831 IMGT/GENE-DB:IGHV3-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780833 IMGT/GENE-DB:IGHV8-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780834 IMGT/GENE-DB:IGHV1-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv13-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629842 IMGT/GENE-DB:IGHV13-2
definition	codon_start : 1 exception : rearrangement required for product

name	EG435321 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:435321 IMGT/GENE-DB:IGHV12-3 MGI:3646760
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV12-3

name	Ighv6-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629845 IMGT/GENE-DB:IGHV6-3
definition	codon_start : 1 exception : rearrangement required for product

name	EG628398 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:628398 IMGT/GENE-DB:IGHV6-4 MGI:3704120
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv6-4

name	EG639510 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:639510 IMGT/GENE-DB:IGHV6-5 MGI:3647134
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV6-5

name	Ighv6-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238427 IMGT/GENE-DB:IGHV6-6
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; VH10G1

name	EG432701 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432701 IMGT/GENE-DB:IGHV6-7 MGI:3644477
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV6-7

name	EG629849 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629849 IMGT/GENE-DB:IGHV8-2 MGI:3647474
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-2

name	Ighv1-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:238428 IMGT/GENE-DB:IGHV1-2
definition	codon_start : 1 pseudo : _no_value

name	Ighv10-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380808 IMGT/GENE-DB:IGHV10-1
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780859 IMGT/GENE-DB:IGHV1-3
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:432702 IMGT/GENE-DB:IGHV1-4
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv10-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780860 IMGT/GENE-DB:IGHV10-2
definition	codon_start : 1 pseudo : _no_value

name	EG668469 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668469 IMGT/GENE-DB:IGHV1-5 MGI:3704121
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-5

name	EG380809 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV10-3

name	Ighv1-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	codon_start : 1 pseudo : _no_value

name	EG668474 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-7

name	Ighv10-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	codon_start : 1 exception : rearrangement required for product

name	EG629860 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-12

name	Ighv1-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	codon_start : 1 exception : rearrangement required for product

name	EG629866 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	codon_start : 1 exception : rearrangement required for product

name	EG668493 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-19-1

name	Ighv1-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	codon_start : 1 exception : rearrangement required for product

name	EG668497 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-20

name	Ighv1-21-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:631595 IMGT/GENE-DB:IGHV1-21-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-21 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668499 IMGT/GENE-DB:IGHV1-21
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-22 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780883 IMGT/GENE-DB:IGHV1-22
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-23 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780884 IMGT/GENE-DB:IGHV1-23
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-24 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780885 IMGT/GENE-DB:IGHV1-24
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-25 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:640497 IMGT/GENE-DB:IGHV1-25
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-26 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629884 IMGT/GENE-DB:IGHV1-26
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-27 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780886 IMGT/GENE-DB:IGHV1-27
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-28 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668510 IMGT/GENE-DB:IGHV1-28
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-29 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780887 IMGT/GENE-DB:IGHV1-29
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-30 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668511 IMGT/GENE-DB:IGHV1-30
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-31 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629893 IMGT/GENE-DB:IGHV1-31
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-32 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780888 IMGT/GENE-DB:IGHV1-32
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-33 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:641247 IMGT/GENE-DB:IGHV1-33
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-34 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628614 IMGT/GENE-DB:IGHV1-34
definition	codon_start : 1 exception : rearrangement required for product

name	EG668515 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668515 IMGT/GENE-DB:IGHV1-35 MGI:3644935
definition	codon_start : 1 gene_synonym : Ighv1-35 pseudo : _no_value

name	Ighv1-36 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629897 IMGT/GENE-DB:IGHV1-36
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-37 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668517 IMGT/GENE-DB:IGHV1-37
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-38 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780890 IMGT/GENE-DB:IGHV1-38
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-39 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780891 IMGT/GENE-DB:IGHV1-39
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-40 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780892 IMGT/GENE-DB:IGHV1-40
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-41 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629904 IMGT/GENE-DB:IGHV1-41
definition	codon_start : 1 pseudo : _no_value

name	EG629906 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629906 IMGT/GENE-DB:IGHV1-42 MGI:3704123
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-42

name	EG629908 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629908 IMGT/GENE-DB:IGHV1-43 MGI:3704124
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-43

name	Ighv1-44 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668521 IMGT/GENE-DB:IGHV1-44
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-45 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780894 IMGT/GENE-DB:IGHV1-45
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-46 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668522 IMGT/GENE-DB:IGHV1-46
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-47 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629915 IMGT/GENE-DB:IGHV1-47
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780927 IMGT/GENE-DB:IGHV8-3
definition	codon_start : 1 pseudo : _no_value

name	EG629919 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629919 IMGT/GENE-DB:IGHV8-4 MGI:3646040
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-4

name	Ighv1-48 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780928 IMGT/GENE-DB:IGHV1-48
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-49 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629925 IMGT/GENE-DB:IGHV1-49
definition	codon_start : 1 exception : rearrangement required for product

name	EG640506 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:640506 IMGT/GENE-DB:IGHV8-5 MGI:3645478
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-5

name	Ighv1-50 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780929 IMGT/GENE-DB:IGHV1-50
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-51 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780930 IMGT/GENE-DB:IGHV1-51
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-52 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382696 IMGT/GENE-DB:IGHV-1-52
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-53 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780931 IMGT/GENE-DB:IGHV1-53
definition	codon_start : 1 exception : rearrangement required for product

name	EG629930 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629930 IMGT/GENE-DB:IGHV8-6 MGI:3645823
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-6

name	EG211331 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:211331 IMGT/GENE-DB:IGHV1-54 MGI:3647133
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-54; VH

name	Ighv1-55 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780932 IMGT/GENE-DB:IGHV1-55
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-56 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382695 IMGT/GENE-DB:IGHV1-56
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780936 IMGT/GENE-DB:IGHV8-7
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-57 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780937 IMGT/GENE-DB:IGHV1-57
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780938 IMGT/GENE-DB:IGHV8-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-58 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780939 IMGT/GENE-DB:IGHV1-58
definition	codon_start : 1 exception : rearrangement required for product

name	EG432708 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432708 IMGT/GENE-DB:IGHV1-59 MGI:3644474
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-59

name	Ighv1-60 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780940 IMGT/GENE-DB:IGHV1-60
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-61 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:674018 IMGT/GENE-DB:IGHV1-61
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Vh3

name	Ighv1-62 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668542 IMGT/GENE-DB:IGHV1-62
definition	codon_start : 1 pseudo : _no_value

name	EG668544 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668544 IMGT/GENE-DB:IGHV1-62-1 MGI:3704125
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-62-1

name	EG238448 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:238448 IMGT/GENE-DB:IGHV1-62-2 MGI:3644968
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-62-2

name	EG668549 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668549 IMGT/GENE-DB:IGHV1-63-1 MGI:3648544
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-62-3

name	EG432709 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432709 IMGT/GENE-DB:IGHV8-9 MGI:3644475
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-9

name	Ighv1-63 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780956 IMGT/GENE-DB:IGHV1-63
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-64 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380823 IMGT/GENE-DB:IGHV1-64
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780957 IMGT/GENE-DB:IGHV8-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-65 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780958 IMGT/GENE-DB:IGHV1-65
definition	codon_start : 1 pseudo : _no_value

name	EG636462 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:636462 IMGT/GENE-DB:IGHV8-11 MGI:3644925
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-11

name	Ighv1-66 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380824 IMGT/GENE-DB:IGHV1-66
definition	codon_start : 1 exception : rearrangement required for product

name	EG435328 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:435328 IMGT/GENE-DB:IGHV1-67 MGI:3645228
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-67

name	Ighv1-68 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780959 IMGT/GENE-DB:IGHV1-68
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-69 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619833 IMGT/GENE-DB:IGHV1-69
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-12 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780960 IMGT/GENE-DB:IGHV8-12
definition	codon_start : 1 exception : rearrangement required for product

name	EG638634 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:638634 IMGT/GENE-DB:IGHV1-70 MGI:3644620
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-70

name	EG619886 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:619886 IMGT/GENE-DB:IGHV1-71 MGI:3643033
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-71

name	Ighv1-72 (CDS detail)
type	CDS
link	vega ensembl
xref	IMGT/GENE-DB:IGHV1-72 GeneID:619916
definition	codon_start : 1 exception : rearrangement required for product

name	EG668577 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668577 IMGT/GENE-DB:IGHV1-73 MGI:3645131
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-73

name	EG668582 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668582 IMGT/GENE-DB:IGHV8-14 MGI:3648977
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-14

name	Ighv1-75 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:622728 IMGT/GENE-DB:IGHV1-75
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-77 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619994 IMGT/GENE-DB:IGHV1-77
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH

name	Ighv1-78 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:213570
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-79 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:435331 IMGT/GENE-DB:IGHV1-79
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-80 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668589 IMGT/GENE-DB:IGHV1-80
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-81 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668591 IMGT/GENE-DB:IGHV1-81
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-83 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620140 IMGT/GENE-DB:IGHV1-83
definition	codon_start : 1 exception : rearrangement required for product

name	EG434609 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434609 IMGT/GENE-DB:IGHV1-84 MGI:3644235
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-84

name	EG668597 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668597 IMGT/GENE-DB:IGHV1-85 MGI:3645723
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-85

name	EG668599 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668599 IMGT/GENE-DB:IGHV1-86 MGI:3645729
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-86

name	Zfp386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526048 CCDS:CCDS26209.1 GeneID:56220 MGI:1930708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; kruppel-like protein; Kruppel associated box (KRAB) zinc finger 1 product : zinc finger protein 386 (Kruppel-like) isoform a protein_id : NP_001004066.1

name	Zfp386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526050 GeneID:56220 MGI:1930708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; kruppel-like protein; Kruppel associated box (KRAB) zinc finger 1 product : zinc finger protein 386 (Kruppel-like) isoform b protein_id : NP_062511.2

name	Vipr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678575 CCDS:CCDS26210.1 GeneID:22355 MGI:107166
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004999 - vasoactive intestinal polypeptide receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : VIP receptor subtype 2; VPAC2 receptor product : vasoactive intestinal peptide receptor 2 protein_id : NP_033537.1

name	Ighv7-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629822
definition	gene_synonym : IgH; V(11)-djn pseudo : _no_value standard_name : IGHV7-3

name	Ighv15-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780827
definition	pseudo : _no_value standard_name : IGHV15-1

name	Ighv14-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629826
definition	standard_name : IGHV14-4

name	EG668438 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668438
definition	gene_synonym : IGHV3-3 standard_name : IGHV3-3

name	Ighv7-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:632654
definition	gene_synonym : V(13)-b standard_name : IGHV7-4

name	EG629833 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629833
definition	gene_synonym : IGHV3-4 standard_name : IGHV3-4

name	EG633457 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633457
definition	gene_synonym : C72-3A1; IGHV3-5 standard_name : IGHV3-5

name	Ighv13-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780828
definition	standard_name : IGHV13-1

name	Ighv3-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780829
definition	standard_name : IGHV3-6

name	EG636260 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:636260
definition	gene_synonym : IgH; IGHV9-4; MRP5 standard_name : IGHV9-4

name	Ighv3-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780830
definition	pseudo : _no_value standard_name : IGHV3-7

name	Ighv5-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780832
definition	pseudo : _no_value standard_name : IGHV5-21

name	Ighv3-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780831
definition	standard_name : IGHV3-8

name	Ighv8-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780833
definition	pseudo : _no_value standard_name : IGHV8-1

name	Ighv1-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780834
definition	pseudo : _no_value standard_name : IGHV1-1

name	Ighv13-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629842
definition	standard_name : IGHV13-2

name	EG435321 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435321
definition	gene_synonym : IGHV12-3 standard_name : IGHV12-3

name	Ighv6-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629845
definition	standard_name : IGHV6-3

name	EG628398 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628398
definition	gene_synonym : Ighv6-4 standard_name : IGHV6-4

name	EG639510 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:639510
definition	gene_synonym : IGHV6-5 standard_name : IGHV6-5

name	Ighv6-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238427
definition	gene_synonym : IgH; VH10G1 standard_name : IGHV6-6

name	EG432701 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432701
definition	gene_synonym : IGHV6-7 standard_name : IGHV6-7

name	EG629849 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629849
definition	gene_synonym : IGHV8-2 standard_name : IGHV8-2

name	Ighv1-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238428
definition	pseudo : _no_value standard_name : IGHV1-2

name	Ighv10-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380808
definition	standard_name : IGHV10-1

name	Ighv1-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780859
definition	pseudo : _no_value standard_name : IGHV1-3

name	Ighv1-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432702
definition	standard_name : IGHV1-4

name	Ighv10-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780860
definition	pseudo : _no_value standard_name : IGHV10-2

name	EG668469 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668469
definition	gene_synonym : Ighv1-5 standard_name : IGHV1-5

name	EG380809 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380809
definition	gene_synonym : IgH; IGHV10-3 standard_name : IGHV10-3

name	Ighv1-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780861
definition	pseudo : _no_value standard_name : IGHV1-6

name	EG668474 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668474
definition	gene_synonym : Ighv1-7 standard_name : IGHV1-7

name	Ighv10-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780862
definition	pseudo : _no_value standard_name : IGHV10-4

name	Ighv1-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780863
definition	pseudo : _no_value standard_name : IGHV1-8

name	Ighv15-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780864
definition	standard_name : IGHV15-2

name	Ighv1-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668478
definition	standard_name : Ighv1-9

name	Ighv1-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:637050
definition	pseudo : _no_value standard_name : IGHV1-10

name	Ighv1-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629859
definition	standard_name : IGHV1-11

name	EG629860 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629860
definition	gene_synonym : IGHV1-12 standard_name : IGHV1-12

name	Ighv1-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780865
definition	pseudo : _no_value standard_name : IGHV1-13

name	Ighv1-14 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629863
definition	standard_name : IGHV1-14

name	Ighv1-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629865
definition	standard_name : IGHV1-15

name	EG629866 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629866
definition	gene_synonym : IGHV1-16 standard_name : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780926
definition	pseudo : _no_value standard_name : IGHV1-17-1

name	Ighv1-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629869
definition	pseudo : _no_value standard_name : IGHV1-17

name	Ighv1-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629871
definition	standard_name : IGHV1-18

name	EG668493 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668493
definition	gene_synonym : Ighv1-19-1 standard_name : IGHV1-19-1

name	Ighv1-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382692
definition	standard_name : IGHV1-19

name	EG668497 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668497
definition	gene_synonym : IGHV1-20 standard_name : IGHV1-20

name	Ighv1-21-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:631595
definition	pseudo : _no_value standard_name : IGHV1-21-1

name	Ighv1-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668499
definition	pseudo : _no_value standard_name : IGHV1-21

name	Ighv1-22 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780883
definition	standard_name : IGHV1-22

name	Ighv1-23 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780884
definition	standard_name : IGHV1-23

name	Ighv1-24 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780885
definition	standard_name : IGHV1-24

name	Ighv1-25 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640497
definition	pseudo : _no_value standard_name : IGHV1-25

name	Ighv1-26 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629884
definition	standard_name : IGHV1-26

name	Ighv1-27 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780886
definition	pseudo : _no_value standard_name : IGHV1-27

name	Ighv1-28 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668510
definition	pseudo : _no_value standard_name : IGHV1-28

name	Ighv1-29 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780887
definition	pseudo : _no_value standard_name : IGHV1-29

name	Ighv1-30 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668511
definition	pseudo : _no_value standard_name : IGHV1-30

name	Ighv1-31 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629893
definition	standard_name : IGHV1-31

name	Ighv1-32 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780888
definition	pseudo : _no_value standard_name : IGHV1-32

name	Ighv1-33 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:641247
definition	pseudo : _no_value standard_name : IGHV1-33

name	Ighv1-34 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628614
definition	standard_name : IGHV1-34

name	EG668515 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668515
definition	gene_synonym : Ighv1-35 pseudo : _no_value standard_name : IGHV1-35

name	Ighv1-36 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629897
definition	standard_name : IGHV1-36

name	Ighv1-37 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668517
definition	standard_name : IGHV1-37

name	Ighv1-38 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780890
definition	pseudo : _no_value standard_name : IGHV1-38

name	Ighv1-39 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780891
definition	standard_name : IGHV1-39

name	Ighv1-40 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780892
definition	pseudo : _no_value standard_name : IGHV1-40

name	Ighv1-41 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629904
definition	pseudo : _no_value standard_name : IGHV1-41

name	EG629906 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629906
definition	gene_synonym : Ighv1-42 standard_name : IGHV1-42

name	EG629908 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629908
definition	gene_synonym : Ighv1-43 standard_name : IGHV1-43

name	Ighv1-44 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668521
definition	pseudo : _no_value standard_name : IGHV1-44

name	Ighv1-45 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780894
definition	pseudo : _no_value standard_name : IGHV1-45

name	Ighv1-46 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668522
definition	pseudo : _no_value standard_name : IGHV1-46

name	Ighv1-47 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629915
definition	standard_name : IGHV1-47

name	Ighv8-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780927
definition	pseudo : _no_value standard_name : IGHV8-3

name	EG629919 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629919
definition	gene_synonym : IGHV8-4 standard_name : IGHV8-4

name	Ighv1-48 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780928
definition	pseudo : _no_value standard_name : IGHV1-48

name	Ighv1-49 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629925
definition	standard_name : IGHV1-49

name	EG640506 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640506
definition	gene_synonym : IGHV8-5 standard_name : IGHV8-5

name	Ighv1-50 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780929
definition	standard_name : IGHV1-50

name	Ighv1-51 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780930
definition	pseudo : _no_value standard_name : IGHV1-51

name	Ighv1-52 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382696
definition	standard_name : IGHV1-52

name	Ighv1-53 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780931
definition	standard_name : IGHV1-53

name	EG629930 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629930
definition	gene_synonym : IGHV8-6 standard_name : IGHV8-6

name	EG211331 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:211331
definition	gene_synonym : IgH; IGHV1-54; VH standard_name : IGHV1-54

name	Ighv1-55 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780932
definition	standard_name : IGHV1-55

name	Ighv1-56 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382695
definition	standard_name : IGHV1-56

name	Ighv8-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780936
definition	pseudo : _no_value standard_name : IGHV807

name	Ighv1-57 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780937
definition	standard_name : IGHV1-57

name	Ighv8-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780938
definition	standard_name : IGHV8-8

name	Ighv1-58 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780939
definition	standard_name : IGHV1-58

name	EG432708 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432708
definition	gene_synonym : IgH; IGHV1-59 standard_name : IGHV1-59

name	Ighv1-60 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780940
definition	pseudo : _no_value standard_name : IGHV1-60

name	Ighv1-61 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:674018
definition	gene_synonym : Vh3 standard_name : IGHV1-61

name	Ighv1-62 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668542
definition	pseudo : _no_value standard_name : IGHV1-62

name	EG668544 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668544
definition	gene_synonym : Ighv1-62-1 standard_name : IGHV1-62-1

name	EG238448 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238448
definition	gene_synonym : IGHV1-62-2 standard_name : IGHV1-62-2

name	EG668549 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668549
definition	gene_synonym : IGHV1-62-3 standard_name : IGHV1-62-3

name	EG432709 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432709
definition	gene_synonym : IGHV8-9 standard_name : IGHV8-9

name	Ighv1-63 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780956
definition	standard_name : IGHV1-63

name	Ighv1-64 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380823
definition	standard_name : IGHV1-64

name	Ighv8-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780957
definition	pseudo : _no_value standard_name : IGHV8-10

name	Ighv1-65 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780958
definition	pseudo : _no_value standard_name : IGHV1-65

name	EG636462 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:636462
definition	gene_synonym : IGHV8-11 standard_name : IGHV8-11

name	Ighv1-66 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380824
definition	standard_name : IGHV1-66

name	EG435328 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435328
definition	gene_synonym : IGHV1-67 standard_name : IGHV1-67

name	Ighv1-68 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780959
definition	standard_name : IGHV1-68

name	Ighv1-69 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619833
definition	standard_name : IGHV1-69

name	Ighv8-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780960
definition	standard_name : IGHV8-12

name	EG638634 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:638634
definition	gene_synonym : IGHV1-70 standard_name : IGHV1-70

name	EG619886 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619886
definition	gene_synonym : IGHV1-71 standard_name : IGHV1-71

name	Ighv1-72 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619916
definition	standard_name : IGHV1-72

name	EG668577 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668577
definition	gene_synonym : Ighv1-73 standard_name : IGHV1-73

name	EG668582 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668582
definition	gene_synonym : IGHV8-14 standard_name : IGHV8-14

name	Ighv1-75 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:622728
definition	standard_name : IGHV1-75

name	Ighv1-77 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619994
definition	gene_synonym : IgH standard_name : IGHV1-77

name	Ighv1-78 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:213570
definition	standard_name : IGHV1-78

name	Ighv1-79 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435331
definition	standard_name : IGHV1-79

name	Ighv1-80 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668589
definition	standard_name : IGHV1-80

name	Ighv1-81 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668591
definition	standard_name : IGHV1-81

name	Ighv1-83 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620140
definition	standard_name : IGHV1-83

name	EG434609 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434609
definition	gene_synonym : IgH; IGHV1-84 standard_name : IGHV1-84

name	EG668597 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668597
definition	gene_synonym : IGHV1-85 standard_name : IGHV1-85

name	EG668599 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668599
definition	gene_synonym : Ighv1-86 standard_name : IGHV1-86

clone name	MSMg01-488F18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-149I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053I20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115C18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517M02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-109N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-307F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-479K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508B17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525G06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534D20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424N20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-503O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012B15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-231G02.b	B6Ng01-231G02.g
ACC	GA043997	GA043998
length	914	1,142
definition	B6Ng01-231G02.b	B6Ng01-231G02.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttgttcagctctgagccccatttttagtggggttatttgattt tctggagtccaccttcttgagttcatatgtatatatcatatccaatatat atattggatattagtaccctatctgatttaggataggtaaatatcctttc acaatctgttggtggtctttttgtcttgttgacagtgtcttttttttacg ttttaatattataatttattttttacactccatattttatttaccctgat ccaccgtccaactattccacatcccatatctcctccccacccccatgtct ccatgtgaatgtccccacccccactgtacctaatctctaaacatcctggg gtctccagtctcttcagggttaggtgcatcatctctggatgaacacagac atggaagtcctctactgtatatgtgttggggcctcatttcacctggtgta ttctgtctgattggtgatccagtatttgagagagctagggggtccagatt acctgagactgctggtcctccttcagagtagcctttctcctcagcttctt tcagccttccctaattcaggtgtcacctgtatctgtccactggttgggtg caactatctgcctctgactcagaagcttgttggatctttcagagggtagt catgataggtccatttagtgagtgctccatagcctcaaacaacagggtta ggccttgggatctccgcttgagctggatttcactttgggccggtcactgg accttattttcctcaggctcctctccatttccatcactgtaattctttca aacagaaatatttatgggtcagagttatgatgtgagatggcaacaccatc catcacttgatgctctgtctttcctgctgaagactataagttaataaggg ctctataagttccc	gaattcatgttctatcttcccttcctggtcagatatcatgtgatttcttg tgaattgtcagtttacaaggcagcatcctcagagcatcagggacttttct ggacaggaagaatttcccctacaatacagggtgctagatggttgtatctt ggcattacataacactgaggtgctgggtaatgtctatagtggtgtatgtc atactccagaatatgtgatgctagtgtctctcatatgttgcaatgcacag gactgcatgcctagttgattagtatggatgtacatagacatcctcctcat aaaatatcctccattcacaaatgtccaaattctgtaagattgtgaataat atgagtttattctaccaagtctaactaatatgaagatcaaaatacttgct gatctggtacaatgtctgtgcaggacatttccttgaataaatgcacacat ggatttgtaacatttttctatttttctactttcaacatgaatgatttttc ccatcacctctggttgtcccttcttttcattgatcaaaaaccactagcat ttccttttgtacctgtctatagttgatgaatcggaacaccacttaagggt ctgtgcactagttttactacttgagttgcctttgcagagacgattgtgtc tgaaaacaggctcacatcttctcactctgattcctttaaaaaactgatac accatggtgtcctcaatggtcagatatataatatgtagtaataactactt ttccaaatgttttatggaatctctggaatgttcattcagtaagttacctc tgacataaatttactgaagggcttaagcaatttaagcttttcctttccca gacactctacatgcaaaaagaatttgaccctgagtcctgccctgagaaat gggggaatgggctttactcattctattttttcagccattaacacatttac acaatggaagtaactactcaccttattaaaagagattgaatttcatgaaa cttccttaaggcaatgggatggaactacaatatcatccggagtgagggaa cccattccacaagacacccactagttactgcactcatgattagcgtaatt ttagcccagaagctctgaatttatccattataccattccaga
quality values	Open. Hide. 52 36 17 26 54 62 47 46 62 62 62 62 24 14 47 62 62 62 62 62 47 39 62 62 62 47 39 62 62 62 59 43 29 56 59 62 56 62 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 54 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 42 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 56 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 56 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 56 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 38 43 54 56 62 62 47 54 62 62 62 62 62 56 62 62 62 62 47 56 62 62 62 62 62 62 54 56 56 38 56 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 52 62 62 62 54 47 62 62 62 62 62 52 52 41 38 52 54 47 62 58 54 58 58 58 54 58 54 58 54 49 58 52 58 54 58 58 54 58 54 52 58 58 54 32 58 47 31 23 58 54 42 58 58 58 58 17 45 52 52 38 52 52 54 58 58 54 42 35 58 28 58 58 37 54 54 58 52 54 54 58 45 49 54 52 42 28 47 38 28 52 54 35 32 43 48 58 58 49 49 58 48 51 45 41 40 52 50 46 49 47 46 30 8 50 13 30 42 42 42 42 38 58 58 51 51 58 39 51 33 49 49 36 37 49 49 35 39 37 50 50 50 52 53 51 36 39 51 27 51 41 58 58 46 33 33 41 53 49 54 40 58 54 50 49 54 23 28 26 58 32 50 31 28 50 49 51 39 25 32 38 24 46 58 36 49 58 39 46 39 39 33 7 24 39 31 23 18 22 37 29 14 29 16 38 51 54 24 47 32 39 28 39 53 30 40 21 36 28 24 54 39 29 54 29 32 25 42 41 33 14 25 34 54 17 16 16 38 54 39 35 33 51 54 18 14 31 33 13 36 13 54 20 25 22 31 53 32 25 15 32 40 21 32 17 32 38 25 13 21 34 25 35 35 31 45 31 52 40 40 32 30 30 12 35 31 32 24 47 33 39 34 20 29 26 20 7 45 26 21 25 31 31 18 19 28 31 35 19 45 18 31 31 30 20 39 31 37 38 33 9 13 15 34 14 51 31 31 31 35 32 14 13 8 46 21 19 32 25 46 29	Open. Hide. 56 47 39 32 62 39 31 62 62 62 51 51 38 36 44 50 56 56 62 62 44 62 62 62 49 62 62 62 62 59 49 62 62 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 59 59 62 62 59 62 62 59 62 62 62 54 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 49 59 54 54 59 62 62 62 62 62 62 62 62 59 62 59 62 62 59 59 46 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 62 59 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 44 38 62 59 62 62 62 62 62 62 59 59 62 62 59 56 48 54 62 59 59 62 62 62 54 59 62 59 62 62 62 62 62 62 62 59 62 62 59 59 62 59 56 62 54 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 59 56 59 59 62 62 62 62 62 62 62 62 59 59 62 62 59 62 56 59 59 56 56 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 56 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 59 59 59 59 62 59 59 62 62 62 62 62 62 62 59 59 62 59 59 59 62 62 62 47 54 62 62 62 62 62 47 62 54 62 62 62 62 62 62 54 54 62 62 62 62 62 62 51 56 62 62 62 62 62 51 62 62 41 47 47 62 62 62 62 47 54 62 62 62 56 56 56 56 56 56 62 62 54 62 62 62 47 47 62 56 62 62 43 62 62 62 62 62 62 62 62 62 47 56 54 62 62 62 42 47 47 62 62 52 52 43 62 54 54 27 31 21 9 21 27 54 62 62 62 62 62 62 62 58 54 39 46 54 44 41 54 52 54 58 52 58 37 52 54 54 54 54 47 54 54 52 42 54 52 52 58 52 52 47 44 54 41 52 54 42 54 45 30 58 31 49 54 46 58 54 48 52 32 52 42 47 37 54 54 54 54 48 58 49 54 50 58 49 58 58 52 51 50 50 50 49 51 54 54 49 40 28 10 22 16 42 48 34 54 50 42 42 39 58 53 53 42 42 51 50 58 32 26 25 51 58 50 58 36 22 52 37 53 39 41 51 53 53 39 50 26 26 49 29 35 36 39 34 31 51 7 54 29 37 51 50 58 54 39 41 42 54 31 26 42 54 29 47 44 53 40 50 51 50 58 28 40 50 50 32 34 41 35 39 58 21 39 33 34 53 29 49 35 45 33 19 38 39 35 35 40 39 42 31 39 34 42 53 34 32 42 31 34 28 15 52 51 39 37 39 18 42 38 47 32 14 54 54 41 33 42 39 44 49 38 33 52 33 33 42 41 42 27 31 42 49 54 6 14 31 33 51 31 27 26 28 12 24 30 25 25 38 33 25 37 52 29 30 21 12 28 39 18 53 28 23 52 32 37 39 31 53 37 14 12 52 51 21 32 24 28 42 18 29 27 32 10 51 16 20 26 6 20 13 37 24 18 15 36 8 32 29 38 32 33 21 15 28 13 13 29 31 32 31 31 26 8 31 25 18 13 40 36 46 32 26 27 33 41 46 30 17 32 16 42 18 28 36 37 18 37 37 25 20 42 19 48 33 17 35 33 19 33 46 32 22 18 46 41 31 32 19 26 24 21 39 19 19 25 39 35 10 11 32 21 14 33 10 13 20 10 7 36 39 46 46 9 13 7 30 32 31 8 18 16 32 17 13 29 27 31 31 41 31 21 14 7 10 14 13 8 31 21 11 24 31 24 18 10 11 23 24 23 19 18 8 32 36 11 9 6 5 16 24 32 41 31 24 26 5 28 13 11 7 14 33 11 36 17 37 10 32 27 27 43 22 16 17 12 7 19 29 21 11 26 9 24 5 4 5 23 19 30 10 8 7 11 18 5 10 10 17 9 4 4 3 5 10 22 19 8 28 14 17 3 6 21 9 9 6 15 11 29 13 3 3 5 7 6 6 5 5 8 15 7 7 22 21 5 6 6 4 6 22 8 4 4 6 6 16 25 9 22 9 5 6 8 8 6 10 20 5 7 8 10 8 8 11 4 2 3 3 5 6 4 8 17 6 10 4 17 21 16 1 1 5 22 5 10 5 6 4 6 8 6 10 10 7 7 23 8 16 5 17 16 4 6 4 16 6 19 5 9 5 8 3 3 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_116385827_116386947
seq2: B6Ng01-231G02.g_68_1209

seq1  GAATTCATGTTCTATCTTCCCTTCCTGGTCAGATATCATGTGATTTCTTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGTTCTATCTTCCCTTCCTGGTCAGATATCATGTGATTTCTTG  50

seq1  TGAATTGTCAGTTTACAAGGCAGCATCCTCAGAGCATCAGGGACTTTTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATTGTCAGTTTACAAGGCAGCATCCTCAGAGCATCAGGGACTTTTCT  100

seq1  GGACAGGAAGAATTTCCCCTACAATACAGGGTGCTAGATGGTTGTATCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAGGAAGAATTTCCCCTACAATACAGGGTGCTAGATGGTTGTATCTT  150

seq1  GGCATTACATAACACTGAGGTGCTGGGTAATGTCTATAGTGGTGTATGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATTACATAACACTGAGGTGCTGGGTAATGTCTATAGTGGTGTATGTC  200

seq1  ATACTCCAGAATATGTGATGCTAGTGTCTCTCATATGTTGCAATGCACAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTCCAGAATATGTGATGCTAGTGTCTCTCATATGTTGCAATGCACAG  250

seq1  GACTGCATGCCTAGTTGATTAGTATGGATGTACATAGACATCCTCCTCAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGCATGCCTAGTTGATTAGTATGGATGTACATAGACATCCTCCTCAT  300

seq1  AAAATATCCTCCATTCACAAATGTCCAAATTCTGTAAGATTGTGAATAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATATCCTCCATTCACAAATGTCCAAATTCTGTAAGATTGTGAATAAT  350

seq1  ATGAGTTTATTCTACCAAGTCTAACTAATATGAAGATCAAAATACTTGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGTTTATTCTACCAAGTCTAACTAATATGAAGATCAAAATACTTGCT  400

seq1  GATCTGGTACAATGTCTGTGCAGGACATTTCCTTGAATAAATGCACACAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTGGTACAATGTCTGTGCAGGACATTTCCTTGAATAAATGCACACAT  450

seq1  GGATTTGTAACATTTTTCTATTTTTCTACTTTCAACATGAATGATTTTTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATTTGTAACATTTTTCTATTTTTCTACTTTCAACATGAATGATTTTTC  500

seq1  CCATCACCTCTGGTTGTCCCTTCTTTTCATTGATCAAAAACCACTAGCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATCACCTCTGGTTGTCCCTTCTTTTCATTGATCAAAAACCACTAGCAT  550

seq1  TTCCTTTTGTACCTGTCTATAGTTGATGAATCGGAACACCACTTAAGGGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTTTGTACCTGTCTATAGTTGATGAATCGGAACACCACTTAAGGGT  600

seq1  CTGTGCACTAGTTTTACTACTTGAGTTGCCTTTGCAGAGACGATTGTGTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCACTAGTTTTACTACTTGAGTTGCCTTTGCAGAGACGATTGTGTC  650

seq1  TGAAAACAGGCTCACATCTTCTCACTCTGATTCC-TTAAAAAACTGATAC  699
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  TGAAAACAGGCTCACATCTTCTCACTCTGATTCCTTTAAAAAACTGATAC  700

seq1  ACCATGGTGTCCTCAATGGTCAGATATATAATATGTAGTAATAACTAC-T  748
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  ACCATGGTGTCCTCAATGGTCAGATATATAATATGTAGTAATAACTACTT  750

seq1  TTCCAAATGTTTTATGGAATCTCTGGAATGTTCATTCAGTAAGTTACCTC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAAATGTTTTATGGAATCTCTGGAATGTTCATTCAGTAAGTTACCTC  800

seq1  TGACATAAA-TTACTGAAGGGCTTAAGCAA-TTAAGCTTT--CCTTCCCA  844
      ||||||||| |||||||||||||||||||| |||||||||  | ||||||
seq2  TGACATAAATTTACTGAAGGGCTTAAGCAATTTAAGCTTTTCCTTTCCCA  850

seq1  GACACTCTACATGCAAAAAGAATTTGA-CCTGAGTCCTGCCCTGAGAAAT  893
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  GACACTCTACATGCAAAAAGAATTTGACCCTGAGTCCTGCCCTGAGAAAT  900

seq1  -GGGGAAT-GGCTTTACTCA-TCTA--TTTTCAGCCA-TAACACATTTAC  937
       ||||||| ||||||||||| ||||  |||||||||| ||||||||||||
seq2  GGGGGAATGGGCTTTACTCATTCTATTTTTTCAGCCATTAACACATTTAC  950

seq1  ACAATGG-AGT-ACTACTCACC-TATTAAAAGAGA-TGAA-TTCATGAAA  982
      ||||||| ||| |||||||||| |||||||||||| |||| |||||||||
seq2  ACAATGGAAGTAACTACTCACCTTATTAAAAGAGATTGAATTTCATGAAA  1000

seq1  CT--CTT-AGGCAAATGGATGGAACTAGAAAATATCATCCTGAGTGAGGG  1029
      ||  ||| ||||||  ||||||||||  | |||||||||| |||||||||
seq2  CTTCCTTAAGGCAATGGGATGGAACT--ACAATATCATCCGGAGTGAGGG  1048

seq1  AACACAATCACAAAAGAACACACA-TAGT--ATGCACTCCATGATAAGCG  1076
      ||| || || || ||| |||| || ||||   |||||| |||||| ||||
seq2  AACCCATTC-CACAAG-ACACCCACTAGTTACTGCACT-CATGATTAGCG  1095

seq1  T-ATATTAGCCCAGAAGCTC--AATATATCCATTATACAATTCACAGA  1121
      | || |||||||||||||||  ||| |||||||||||| |||| ||||
seq2  TAATTTTAGCCCAGAAGCTCTGAATTTATCCATTATACCATTC-CAGA  1142

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information