MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-271K13
Chromosome	12 (Build37)
Map Location	116,759,799 - 116,954,261
singlet/doublet	doublet
Overlap gene	Igh, Ighv1-65, EG668554, EG636462, LOC217924, Ighv1-66, EG435328, Ighv1-68, LOC435329, EG668563, Ighv1-69, Ighv8-12, LOC619863, EG638634
Upstream gene	EG380809, Ighv1-6, EG668474, Ighv10-4, Ighv1-8, Ighv15-2, Ighv1-9, Ighv1-10, Ighv1-11, EG629860, Ighv1-13, Ighv1-14, Ighv1-15, EG629866, Ighv1-17-1, Ighv1-17, Ighv1-18, EG668493, Ighv1-19, EG668497, Ighv1-21-1, Ighv1-21, Ighv1-22, Ighv1-23, Ighv1-24, Ighv1-25, Ighv1-26, Ighv1-27, Ighv1-28, Ighv1-29, Ighv1-30, Ighv1-31, Ighv1-32, Ighv1-33, Ighv1-34, EG668515, Ighv1-36, Ighv1-37, Ighv1-38, Ighv1-39, Ighv1-40, Ighv1-41, EG629906, EG629908, Ighv1-44, Ighv1-45, Ighv1-46, Ighv1-47, Ighv8-3, EG629919, Ighv1-48, Ighv1-49, EG640506, Ighv1-50, Ighv1-51, Ighv1-52, Ighv1-53, EG629930, EG668534, EG211331, Ighv1-55, EG634662, Ighv1-56, EG629936, Ighv8-7, Ighv1-57, Ighv8-8, Ighv1-58, EG432708, Ighv1-60, Ighv1-61, Ighv1-62, EG668544, EG238448, EG668549, EG432709, EG668552, Ighv1-63, Ighv1-64, Ighv8-10
Downstream gene	EG619886, Ighv1-72, EG668575, EG668577, EG668582, Ighv1-75, Ighv1-77, Ighv1-78, GA_x5J8B7W27DS-1519-2216, Ighv1-79, LOC668586, Ighv1-80, Ighv1-81, Olfr241-ps1, Ighv1-83, EG434609, LOC668595, EG668597, EG668599, Zfp386, Vipr2, LOC676058, Wdr60, LOC100042963, D12Ertd551e, D430020J02Rik, Ncapg2, Rnu7-ps1, Ptprn2, LOC627375
Link	Open Mouse BAC browser

Click to get alignment info.

name	Igh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:111507 MGI:96442
definition	gene_synonym : MGC118122; MGC118132; MGC19003; MGC25748; MGC6342; MGC68311; MGC91096 note : immunoglobulin heavy chain complex

name	EG380809 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	gene_synonym : IgH; IGHV10-3 note : predicted gene, EG380809

name	Ighv1-6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	note : immunoglobulin heavy variable V1-6 pseudo : _no_value

name	EG668474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	gene_synonym : Ighv1-7 note : predicted gene, EG668474

name	Ighv10-4 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	note : immunoglobulin heavy variable V10-4 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	note : immunoglobulin heavy variable V1-8 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	note : immunoglobulin heavy variable V15-2

name	Ighv1-9 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	note : immunoglobulin heavy variable V1-9

name	Ighv1-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	note : immunoglobulin heavy variable V1-10 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	note : immunoglobulin heavy variable V1-11

name	EG629860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	gene_synonym : IGHV1-12 note : predicted gene, EG629860

name	Ighv1-13 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	note : immunoglobulin heavy variable V1-13 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	note : immunoglobulin heavy variable V1-14

name	Ighv1-15 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	note : immunoglobulin heavy variable V1-15

name	EG629866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	gene_synonym : IGHV1-16 note : predicted gene, EG629866

name	Ighv1-17-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	note : immunoglobulin heavy variable V1-17-1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	note : immunoglobulin heavy variable V1-17 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	note : immunoglobulin heavy variable V1-18

name	EG668493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	gene_synonym : Ighv1-19-1 note : predicted gene, EG668493

name	Ighv1-19 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	note : immunoglobulin heavy variable V1-19

name	EG668497 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	gene_synonym : IGHV1-20 note : predicted gene, EG668497

name	Ighv1-21-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631595 IMGT/GENE-DB:IGHV1-21-1
definition	note : immunoglobulin heavy variable V1-21-1 pseudo : _no_value

name	Ighv1-21 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668499 IMGT/GENE-DB:IGHV1-21
definition	note : immunoglobulin heavy variable V1-21 pseudo : _no_value

name	Ighv1-22 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780883 IMGT/GENE-DB:IGHV1-22
definition	note : immunoglobulin heavy variable V1-22

name	Ighv1-23 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780884 IMGT/GENE-DB:IGHV1-23
definition	note : immunoglobulin heavy variable V1-23

name	Ighv1-24 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780885 IMGT/GENE-DB:IGHV1-24
definition	note : immunoglobulin heavy variable V1-24

name	Ighv1-25 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640497 IMGT/GENE-DB:IGHV1-25
definition	note : immunoglobulin heavy variable V1-25 pseudo : _no_value

name	Ighv1-26 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629884 IMGT/GENE-DB:IGHV1-26
definition	note : immunoglobulin heavy variable V1-26

name	Ighv1-27 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780886 IMGT/GENE-DB:IGHV1-27
definition	note : immunoglobulin heavy variable V1-27 pseudo : _no_value

name	Ighv1-28 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668510 IMGT/GENE-DB:IGHV1-28
definition	note : immunoglobulin heavy variable V1-28 pseudo : _no_value

name	Ighv1-29 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780887 IMGT/GENE-DB:IGHV1-29
definition	note : immunoglobulin heavy variable V1-29 pseudo : _no_value

name	Ighv1-30 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668511 IMGT/GENE-DB:IGHV1-30
definition	note : immunoglobulin heavy variable V1-30 pseudo : _no_value

name	Ighv1-31 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629893 IMGT/GENE-DB:IGHV1-31
definition	note : immunoglobulin heavy variable V1-31

name	Ighv1-32 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780888 IMGT/GENE-DB:IGHV1-32
definition	note : immunoglobulin heavy variable V1-32 pseudo : _no_value

name	Ighv1-33 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641247 IMGT/GENE-DB:IGHV1-33
definition	note : immunoglobulin heavy variable V1-33 pseudo : _no_value

name	Ighv1-34 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628614 IMGT/GENE-DB:IGHV1-34
definition	note : immunoglobulin heavy variable V1-34

name	EG668515 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668515 IMGT/GENE-DB:IGHV1-35 MGI:3644935
definition	gene_synonym : Ighv1-35 note : predicted gene, EG668515 pseudo : _no_value

name	Ighv1-36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629897 IMGT/GENE-DB:IGHV1-36
definition	note : immunoglobulin heavy variable V1-36

name	Ighv1-37 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668517 IMGT/GENE-DB:IGHV1-37
definition	note : immunoglobulin heavy variable V1-37

name	Ighv1-38 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780890 IMGT/GENE-DB:IGHV1-38
definition	note : immunoglobulin heavy variable V1-38 pseudo : _no_value

name	Ighv1-39 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780891 IMGT/GENE-DB:IGHV1-39
definition	note : immunoglobulin heavy variable V1-39

name	Ighv1-40 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780892 IMGT/GENE-DB:IGHV1-40
definition	note : immunoglobulin heavy variable V1-40 pseudo : _no_value

name	Ighv1-41 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629904 IMGT/GENE-DB:IGHV1-41
definition	note : immunoglobulin heavy variable V1-41 pseudo : _no_value

name	EG629906 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629906 IMGT/GENE-DB:IGHV1-42 MGI:3704123
definition	gene_synonym : Ighv1-42 note : predicted gene, EG629906

name	EG629908 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629908 IMGT/GENE-DB:IGHV1-43 MGI:3704124
definition	gene_synonym : Ighv1-43 note : predicted gene, EG629908

name	Ighv1-44 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668521 IMGT/GENE-DB:IGHV1-44
definition	note : immunoglobulin heavy variable V1-44 pseudo : _no_value

name	Ighv1-45 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780894 IMGT/GENE-DB:IGHV1-45
definition	note : immunoglobulin heavy variable V1-45 pseudo : _no_value

name	Ighv1-46 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668522 IMGT/GENE-DB:IGHV1-46
definition	note : immunoglobulin heavy variable V1-46 pseudo : _no_value

name	Ighv1-47 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629915 IMGT/GENE-DB:IGHV1-47
definition	note : immunoglobulin heavy variable V1-47

name	Ighv8-3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780927 IMGT/GENE-DB:IGHV8-3
definition	note : immunoglobulin heavy variable V8-3 pseudo : _no_value

name	EG629919 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629919 IMGT/GENE-DB:IGHV8-4 MGI:3646040
definition	gene_synonym : IGHV8-4 note : predicted gene, EG629919

name	Ighv1-48 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780928 IMGT/GENE-DB:IGHV1-48
definition	note : immunoglobulin heavy variable V1-48 pseudo : _no_value

name	Ighv1-49 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629925 IMGT/GENE-DB:IGHV1-49
definition	note : immunoglobulin heavy variable V1-49

name	EG640506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640506 IMGT/GENE-DB:IGHV8-5 MGI:3645478
definition	gene_synonym : IGHV8-5 note : predicted gene, EG640506

name	Ighv1-50 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780929 IMGT/GENE-DB:IGHV1-50
definition	note : immunoglobulin heavy variable V1-50

name	Ighv1-51 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780930 IMGT/GENE-DB:IGHV1-51
definition	note : immunoglobulin heavy variable V1-51 pseudo : _no_value

name	Ighv1-52 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382696 IMGT/GENE-DB:IGHV-1-52
definition	note : immunoglobulin heavy variable V1-52

name	Ighv1-53 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780931 IMGT/GENE-DB:IGHV1-53
definition	note : immunoglobulin heavy variable V1-53

name	EG629930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629930 IMGT/GENE-DB:IGHV8-6 MGI:3645823
definition	gene_synonym : IGHV8-6 note : predicted gene, EG629930

name	EG668534 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668534 MGI:3646995
definition	note : predicted gene, EG668534 pseudo : _no_value

name	EG211331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211331 IMGT/GENE-DB:IGHV1-54 MGI:3647133
definition	gene_synonym : IgH; IGHV1-54; VH note : predicted gene, EG211331

name	Ighv1-55 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780932 IMGT/GENE-DB:IGHV1-55
definition	note : immunoglobulin heavy variable V1-55

name	EG634662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634662 MGI:3646714
definition	note : predicted gene, EG634662 pseudo : _no_value

name	Ighv1-56 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382695 IMGT/GENE-DB:IGHV1-56
definition	note : immunoglobulin heavy variable V1-56

name	EG629936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629936 MGI:3645821
definition	note : predicted gene, EG629936 pseudo : _no_value

name	Ighv8-7 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780936 IMGT/GENE-DB:IGHV8-7
definition	note : immunoglobulin heavy variable V8-7 pseudo : _no_value

name	Ighv1-57 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780937 IMGT/GENE-DB:IGHV1-57
definition	note : immunoglobulin heavy variable V1-57

name	Ighv8-8 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780938 IMGT/GENE-DB:IGHV8-8
definition	note : immunoglobulin heavy variable V8-8

name	Ighv1-58 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780939 IMGT/GENE-DB:IGHV1-58
definition	note : immunoglobulin heavy variable V1-58

name	EG432708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432708 IMGT/GENE-DB:IGHV1-59 MGI:3644474
definition	gene_synonym : IgH; IGHV1-59 note : predicted gene, EG432708

name	Ighv1-60 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780940 IMGT/GENE-DB:IGHV1-60
definition	note : immunoglobulin heavy variable V1-60 pseudo : _no_value

name	Ighv1-61 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674018 IMGT/GENE-DB:IGHV1-61
definition	gene_synonym : Vh3 note : immunoglobulin heavy variable V1-61

name	Ighv1-62 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668542 IMGT/GENE-DB:IGHV1-62
definition	note : immunoglobulin heavy variable V1-62 pseudo : _no_value

name	EG668544 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668544 IMGT/GENE-DB:IGHV1-62-1 MGI:3704125
definition	gene_synonym : Ighv1-62-1 note : predicted gene, EG668544

name	EG238448 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238448 IMGT/GENE-DB:IGHV1-62-2 MGI:3644968
definition	gene_synonym : IGHV1-62-2 note : predicted gene, EG238448

name	EG668549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668549 IMGT/GENE-DB:IGHV1-63-1 MGI:3648544
definition	gene_synonym : IGHV1-62-3 note : predicted gene, EG668549

name	EG432709 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432709 IMGT/GENE-DB:IGHV8-9 MGI:3644475
definition	gene_synonym : IGHV8-9 note : predicted gene, EG432709

name	EG668552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668552 MGI:3645301
definition	note : predicted gene, EG668552 pseudo : _no_value

name	Ighv1-63 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780956 IMGT/GENE-DB:IGHV1-63
definition	note : immunoglobulin heavy variable V1-63

name	Ighv1-64 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380823 IMGT/GENE-DB:IGHV1-64
definition	note : immunoglobulin heavy variable V1-64

name	Ighv8-10 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780957 IMGT/GENE-DB:IGHV8-10
definition	note : immunoglobulin heavy variable V8-10 pseudo : _no_value

name	Ighv1-65 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780958 IMGT/GENE-DB:IGHV1-65
definition	note : immunoglobulin heavy variable V1-65 pseudo : _no_value

name	EG668554 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668554 MGI:3645306
definition	note : predicted gene, EG668554 pseudo : _no_value

name	EG636462 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636462 IMGT/GENE-DB:IGHV8-11 MGI:3644925
definition	gene_synonym : IGHV8-11 note : predicted gene, EG636462

name	LOC217924 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:217924
definition	note : ribosomal protein L7a pseudogene pseudo : _no_value

name	Ighv1-66 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:380824 IMGT/GENE-DB:IGHV1-66
definition	note : immunoglobulin heavy variable V1-66

name	EG435328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435328 IMGT/GENE-DB:IGHV1-67 MGI:3645228
definition	gene_synonym : IGHV1-67 note : predicted gene, EG435328

name	Ighv1-68 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780959 IMGT/GENE-DB:IGHV1-68
definition	note : immunoglobulin heavy variable V1-68

name	LOC435329 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435329
definition	note : cell division cycle 5-like pseudogene pseudo : _no_value

name	EG668563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668563 MGI:3648326
definition	note : predicted gene, EG668563 pseudo : _no_value

name	Ighv1-69 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619833 IMGT/GENE-DB:IGHV1-69
definition	note : immunoglobulin heavy variable V1-69

name	Ighv8-12 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:780960 IMGT/GENE-DB:IGHV8-12
definition	note : immunoglobulin heavy variable V8-12

name	LOC619863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619863
definition	note : high mobility group box 2 pseudogene pseudo : _no_value

name	EG638634 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638634 IMGT/GENE-DB:IGHV1-70 MGI:3644620
definition	gene_synonym : IGHV1-70 note : predicted gene, EG638634

name	EG619886 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619886 IMGT/GENE-DB:IGHV1-71 MGI:3643033
definition	gene_synonym : IGHV1-71 note : predicted gene, EG619886

name	Ighv1-72 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619916
definition	note : immunoglobulin heavy variable V1-72

name	EG668575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668575 MGI:3645129
definition	note : predicted gene, EG668575 pseudo : _no_value

name	EG668577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668577 IMGT/GENE-DB:IGHV1-73 MGI:3645131
definition	gene_synonym : Ighv1-73 note : predicted gene, EG668577

name	EG668582 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668582 IMGT/GENE-DB:IGHV8-14 MGI:3648977
definition	gene_synonym : IGHV8-14 note : predicted gene, EG668582

name	Ighv1-75 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622728 IMGT/GENE-DB:IGHV1-75
definition	note : immunoglobulin heavy variable V1-75

name	Ighv1-77 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619994 IMGT/GENE-DB:IGHV1-77
definition	gene_synonym : IgH note : immunoglobulin heavy variable V1-77

name	Ighv1-78 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:213570
definition	note : immunoglobulin heavy variable V1-78

name	GA_x5J8B7W27DS-1519-2216 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257855
definition	note : olfactory receptor GA_x5J8B7W27DS-1519-2216 pseudo : _no_value

name	Ighv1-79 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435331 IMGT/GENE-DB:IGHV1-79
definition	note : immunoglobulin heavy variable V1-79

name	LOC668586 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668586
definition	note : signaling molecule ATTP pseudogene pseudo : _no_value

name	Ighv1-80 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668589 IMGT/GENE-DB:IGHV1-80
definition	note : immunoglobulin heavy variable V1-80

name	Ighv1-81 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668591 IMGT/GENE-DB:IGHV1-81
definition	note : immunoglobulin heavy variable V1-81

name	Olfr241-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404357 MGI:3030075
definition	gene_synonym : MOR179-8_p note : olfactory receptor 241, pseudogene 1 pseudo : _no_value

name	Ighv1-83 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620140 IMGT/GENE-DB:IGHV1-83
definition	note : immunoglobulin heavy variable V1-83

name	EG434609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434609 IMGT/GENE-DB:IGHV1-84 MGI:3644235
definition	gene_synonym : IgH; IGHV1-84 note : predicted gene, EG434609

name	LOC668595 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668595
definition	note : ornithine decarboxylase, structural 1 pseudogene pseudo : _no_value

name	EG668597 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668597 IMGT/GENE-DB:IGHV1-85 MGI:3645723
definition	gene_synonym : IGHV1-85 note : predicted gene, EG668597

name	EG668599 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668599 IMGT/GENE-DB:IGHV1-86 MGI:3645729
definition	gene_synonym : Ighv1-86 note : predicted gene, EG668599

name	Zfp386 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56220 MGI:1930708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Vipr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22355 MGI:107166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Wdr60 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217935 MGI:2445085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042963 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	D12Ertd551e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52635 MGI:1261845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430020J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319545 MGI:2442237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 26 ESTs

name	Ncapg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76044 MGI:1923294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu7-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19867 MGI:97993
definition	note : U7 small nuclear RNA, pseudogene 1 pseudo : _no_value

name	Ptprn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19276 MGI:107418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 619 ESTs, 10 Proteins

name	Zfp386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102384 GeneID:56220 MGI:1930708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 386 (Kruppel-like) transcript_id : NM_001004066.2

name	Zfp386 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102383 GeneID:56220 MGI:1930708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 386 (Kruppel-like) transcript_id : NM_019565.3

name	Vipr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678574 GeneID:22355 MGI:107166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasoactive intestinal peptide receptor 2 transcript_id : NM_009511.1

name	Wdr60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199780 GeneID:217935 MGI:2445085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 60 transcript_id : NM_146039.3

name	LOC100042963 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263571 GeneID:100042963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042963 transcript_id : XM_001478482.1

name	D12Ertd551e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76096371 GeneID:52635 MGI:1261845
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 551, expressed transcript_id : NM_028731.5

name	D430020J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263562 GeneID:319545 MGI:2442237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 26 ESTs product : RIKEN cDNA D430020J02 gene transcript_id : XM_001478239.1

name	Ncapg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91208438 GeneID:76044 MGI:1923294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-SMC condensin II complex, subunit G2 transcript_id : NM_133762.3

name	Ptprn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859597 GeneID:19276 MGI:107418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, N polypeptide 2 transcript_id : NM_011215.1

name	LOC627375 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263573 GeneID:627375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 619 ESTs, 10 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001478560.1

name	EG380809 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:380809 IMGT/GENE-DB:IGHV10-3 MGI:3648785
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV10-3

name	Ighv1-6 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780861 IMGT/GENE-DB:IGHV1-6
definition	codon_start : 1 pseudo : _no_value

name	EG668474 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668474 IMGT/GENE-DB:IGHV1-7 MGI:3704122
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-7

name	Ighv10-4 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780862 IMGT/GENE-DB:IGHV10-4
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780863 IMGT/GENE-DB:IGHV1-8
definition	codon_start : 1 pseudo : _no_value

name	Ighv15-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780864 IMGT/GENE-DB:IGHV15-2
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-9 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668478 IMGT/GENE-DB:IGHV1-9
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:637050 IMGT/GENE-DB:IGHV1-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-11 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629859 IMGT/GENE-DB:IGHV1-11
definition	codon_start : 1 exception : rearrangement required for product

name	EG629860 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629860 IMGT/GENE-DB:IGHV1-12 MGI:3646284
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-12

name	Ighv1-13 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780865 IMGT/GENE-DB:IGHV1-13
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-14 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629863 IMGT/GENE-DB:IGHV1-14
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-15 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629865 IMGT/GENE-DB:IGHV1-15
definition	codon_start : 1 exception : rearrangement required for product

name	EG629866 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629866 IMGT/GENE-DB:IGHV1-16 MGI:3647704
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780926 IMGT/GENE-DB:IGHV1-17-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-17 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629869 IMGT/GENE-DB:IGHV1-17
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-18 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629871 IMGT/GENE-DB:IGHV1-18
definition	codon_start : 1 exception : rearrangement required for product

name	EG668493 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668493 IMGT/GENE-DB:IGHV1-19-1 MGI:3644603
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-19-1

name	Ighv1-19 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382692 IMGT/GENE-DB:IGHV1-19
definition	codon_start : 1 exception : rearrangement required for product

name	EG668497 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668497 IMGT/GENE-DB:IGHV1-20 MGI:3644607
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-20

name	Ighv1-21-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:631595 IMGT/GENE-DB:IGHV1-21-1
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-21 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668499 IMGT/GENE-DB:IGHV1-21
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-22 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780883 IMGT/GENE-DB:IGHV1-22
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-23 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780884 IMGT/GENE-DB:IGHV1-23
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-24 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780885 IMGT/GENE-DB:IGHV1-24
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-25 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:640497 IMGT/GENE-DB:IGHV1-25
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-26 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629884 IMGT/GENE-DB:IGHV1-26
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-27 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780886 IMGT/GENE-DB:IGHV1-27
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-28 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668510 IMGT/GENE-DB:IGHV1-28
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-29 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780887 IMGT/GENE-DB:IGHV1-29
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-30 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668511 IMGT/GENE-DB:IGHV1-30
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-31 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629893 IMGT/GENE-DB:IGHV1-31
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-32 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780888 IMGT/GENE-DB:IGHV1-32
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-33 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:641247 IMGT/GENE-DB:IGHV1-33
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-34 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:628614 IMGT/GENE-DB:IGHV1-34
definition	codon_start : 1 exception : rearrangement required for product

name	EG668515 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668515 IMGT/GENE-DB:IGHV1-35 MGI:3644935
definition	codon_start : 1 gene_synonym : Ighv1-35 pseudo : _no_value

name	Ighv1-36 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629897 IMGT/GENE-DB:IGHV1-36
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-37 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668517 IMGT/GENE-DB:IGHV1-37
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-38 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780890 IMGT/GENE-DB:IGHV1-38
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-39 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780891 IMGT/GENE-DB:IGHV1-39
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-40 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780892 IMGT/GENE-DB:IGHV1-40
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-41 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629904 IMGT/GENE-DB:IGHV1-41
definition	codon_start : 1 pseudo : _no_value

name	EG629906 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629906 IMGT/GENE-DB:IGHV1-42 MGI:3704123
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-42

name	EG629908 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629908 IMGT/GENE-DB:IGHV1-43 MGI:3704124
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-43

name	Ighv1-44 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668521 IMGT/GENE-DB:IGHV1-44
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-45 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780894 IMGT/GENE-DB:IGHV1-45
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-46 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668522 IMGT/GENE-DB:IGHV1-46
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-47 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629915 IMGT/GENE-DB:IGHV1-47
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-3 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780927 IMGT/GENE-DB:IGHV8-3
definition	codon_start : 1 pseudo : _no_value

name	EG629919 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629919 IMGT/GENE-DB:IGHV8-4 MGI:3646040
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-4

name	Ighv1-48 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780928 IMGT/GENE-DB:IGHV1-48
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-49 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:629925 IMGT/GENE-DB:IGHV1-49
definition	codon_start : 1 exception : rearrangement required for product

name	EG640506 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:640506 IMGT/GENE-DB:IGHV8-5 MGI:3645478
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-5

name	Ighv1-50 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780929 IMGT/GENE-DB:IGHV1-50
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-51 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780930 IMGT/GENE-DB:IGHV1-51
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-52 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382696 IMGT/GENE-DB:IGHV-1-52
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-53 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780931 IMGT/GENE-DB:IGHV1-53
definition	codon_start : 1 exception : rearrangement required for product

name	EG629930 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:629930 IMGT/GENE-DB:IGHV8-6 MGI:3645823
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-6

name	EG211331 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:211331 IMGT/GENE-DB:IGHV1-54 MGI:3647133
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-54; VH

name	Ighv1-55 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780932 IMGT/GENE-DB:IGHV1-55
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-56 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:382695 IMGT/GENE-DB:IGHV1-56
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-7 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780936 IMGT/GENE-DB:IGHV8-7
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-57 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780937 IMGT/GENE-DB:IGHV1-57
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-8 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780938 IMGT/GENE-DB:IGHV8-8
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-58 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780939 IMGT/GENE-DB:IGHV1-58
definition	codon_start : 1 exception : rearrangement required for product

name	EG432708 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432708 IMGT/GENE-DB:IGHV1-59 MGI:3644474
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-59

name	Ighv1-60 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780940 IMGT/GENE-DB:IGHV1-60
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-61 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:674018 IMGT/GENE-DB:IGHV1-61
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Vh3

name	Ighv1-62 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668542 IMGT/GENE-DB:IGHV1-62
definition	codon_start : 1 pseudo : _no_value

name	EG668544 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668544 IMGT/GENE-DB:IGHV1-62-1 MGI:3704125
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-62-1

name	EG238448 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:238448 IMGT/GENE-DB:IGHV1-62-2 MGI:3644968
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-62-2

name	EG668549 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668549 IMGT/GENE-DB:IGHV1-63-1 MGI:3648544
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-62-3

name	EG432709 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:432709 IMGT/GENE-DB:IGHV8-9 MGI:3644475
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-9

name	Ighv1-63 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780956 IMGT/GENE-DB:IGHV1-63
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-64 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380823 IMGT/GENE-DB:IGHV1-64
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-10 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780957 IMGT/GENE-DB:IGHV8-10
definition	codon_start : 1 pseudo : _no_value

name	Ighv1-65 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780958 IMGT/GENE-DB:IGHV1-65
definition	codon_start : 1 pseudo : _no_value

name	EG636462 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:636462 IMGT/GENE-DB:IGHV8-11 MGI:3644925
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-11

name	Ighv1-66 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:380824 IMGT/GENE-DB:IGHV1-66
definition	codon_start : 1 exception : rearrangement required for product

name	EG435328 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:435328 IMGT/GENE-DB:IGHV1-67 MGI:3645228
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-67

name	Ighv1-68 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780959 IMGT/GENE-DB:IGHV1-68
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-69 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619833 IMGT/GENE-DB:IGHV1-69
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv8-12 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:780960 IMGT/GENE-DB:IGHV8-12
definition	codon_start : 1 exception : rearrangement required for product

name	EG638634 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:638634 IMGT/GENE-DB:IGHV1-70 MGI:3644620
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-70

name	EG619886 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:619886 IMGT/GENE-DB:IGHV1-71 MGI:3643033
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-71

name	Ighv1-72 (CDS detail)
type	CDS
link	vega ensembl
xref	IMGT/GENE-DB:IGHV1-72 GeneID:619916
definition	codon_start : 1 exception : rearrangement required for product

name	EG668577 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668577 IMGT/GENE-DB:IGHV1-73 MGI:3645131
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-73

name	EG668582 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668582 IMGT/GENE-DB:IGHV8-14 MGI:3648977
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV8-14

name	Ighv1-75 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:622728 IMGT/GENE-DB:IGHV1-75
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-77 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:619994 IMGT/GENE-DB:IGHV1-77
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH

name	Ighv1-78 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:213570
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-79 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:435331 IMGT/GENE-DB:IGHV1-79
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-80 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668589 IMGT/GENE-DB:IGHV1-80
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-81 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:668591 IMGT/GENE-DB:IGHV1-81
definition	codon_start : 1 exception : rearrangement required for product

name	Ighv1-83 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:620140 IMGT/GENE-DB:IGHV1-83
definition	codon_start : 1 exception : rearrangement required for product

name	EG434609 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:434609 IMGT/GENE-DB:IGHV1-84 MGI:3644235
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IgH; IGHV1-84

name	EG668597 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668597 IMGT/GENE-DB:IGHV1-85 MGI:3645723
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : IGHV1-85

name	EG668599 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:668599 IMGT/GENE-DB:IGHV1-86 MGI:3645729
definition	codon_start : 1 exception : rearrangement required for product gene_synonym : Ighv1-86

name	Zfp386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526048 CCDS:CCDS26209.1 GeneID:56220 MGI:1930708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; kruppel-like protein; Kruppel associated box (KRAB) zinc finger 1 product : zinc finger protein 386 (Kruppel-like) isoform a protein_id : NP_001004066.1

name	Zfp386 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526050 GeneID:56220 MGI:1930708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; kruppel-like protein; Kruppel associated box (KRAB) zinc finger 1 product : zinc finger protein 386 (Kruppel-like) isoform b protein_id : NP_062511.2

name	Vipr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678575 CCDS:CCDS26210.1 GeneID:22355 MGI:107166
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004999 - vasoactive intestinal polypeptide receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : VIP receptor subtype 2; VPAC2 receptor product : vasoactive intestinal peptide receptor 2 protein_id : NP_033537.1

name	Wdr60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199781 GeneID:217935 MGI:2445085
definition	codon_start : 1 product : WD repeat domain 60 protein_id : NP_666151.3

name	LOC100042963 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263572 GeneID:100042963
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478532.1

name	D12Ertd551e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67782360 CCDS:CCDS26211.1 GeneID:52635 MGI:1261845
definition	codon_start : 1 product : chr2 synaptotagmin protein_id : NP_083007.2

name	D430020J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263563 GeneID:319545 MGI:2442237
definition	codon_start : 1 product : hypothetical protein LOC319545 protein_id : XP_001478289.1

name	Ncapg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91208439 CCDS:CCDS26212.1 GeneID:76044 MGI:1923294
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001833 - inner cell mass cell proliferation [Evidence IMP] codon_start : 1 note : more than blood product : leucine zipper protein 5 protein_id : NP_598523.3

name	Ptprn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859598 GeneID:19276 MGI:107418
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0007185 - transmembrane receptor protein tyrosine phosphatase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : protein tyrosine phosphatase, receptor-type, N polypeptide 2; IA-2 beta; snoRNA MBII-51 product : protein tyrosine phosphatase, receptor type, N polypeptide 2 protein_id : NP_035345.1

name	LOC627375 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263574 GeneID:627375
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478610.1

name	EG380809 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380809
definition	gene_synonym : IgH; IGHV10-3 standard_name : IGHV10-3

name	Ighv1-6 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780861
definition	pseudo : _no_value standard_name : IGHV1-6

name	EG668474 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668474
definition	gene_synonym : Ighv1-7 standard_name : IGHV1-7

name	Ighv10-4 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780862
definition	pseudo : _no_value standard_name : IGHV10-4

name	Ighv1-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780863
definition	pseudo : _no_value standard_name : IGHV1-8

name	Ighv15-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780864
definition	standard_name : IGHV15-2

name	Ighv1-9 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668478
definition	standard_name : Ighv1-9

name	Ighv1-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:637050
definition	pseudo : _no_value standard_name : IGHV1-10

name	Ighv1-11 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629859
definition	standard_name : IGHV1-11

name	EG629860 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629860
definition	gene_synonym : IGHV1-12 standard_name : IGHV1-12

name	Ighv1-13 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780865
definition	pseudo : _no_value standard_name : IGHV1-13

name	Ighv1-14 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629863
definition	standard_name : IGHV1-14

name	Ighv1-15 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629865
definition	standard_name : IGHV1-15

name	EG629866 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629866
definition	gene_synonym : IGHV1-16 standard_name : IGHV1-16

name	Ighv1-17-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780926
definition	pseudo : _no_value standard_name : IGHV1-17-1

name	Ighv1-17 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629869
definition	pseudo : _no_value standard_name : IGHV1-17

name	Ighv1-18 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629871
definition	standard_name : IGHV1-18

name	EG668493 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668493
definition	gene_synonym : Ighv1-19-1 standard_name : IGHV1-19-1

name	Ighv1-19 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382692
definition	standard_name : IGHV1-19

name	EG668497 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668497
definition	gene_synonym : IGHV1-20 standard_name : IGHV1-20

name	Ighv1-21-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:631595
definition	pseudo : _no_value standard_name : IGHV1-21-1

name	Ighv1-21 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668499
definition	pseudo : _no_value standard_name : IGHV1-21

name	Ighv1-22 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780883
definition	standard_name : IGHV1-22

name	Ighv1-23 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780884
definition	standard_name : IGHV1-23

name	Ighv1-24 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780885
definition	standard_name : IGHV1-24

name	Ighv1-25 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640497
definition	pseudo : _no_value standard_name : IGHV1-25

name	Ighv1-26 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629884
definition	standard_name : IGHV1-26

name	Ighv1-27 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780886
definition	pseudo : _no_value standard_name : IGHV1-27

name	Ighv1-28 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668510
definition	pseudo : _no_value standard_name : IGHV1-28

name	Ighv1-29 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780887
definition	pseudo : _no_value standard_name : IGHV1-29

name	Ighv1-30 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668511
definition	pseudo : _no_value standard_name : IGHV1-30

name	Ighv1-31 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629893
definition	standard_name : IGHV1-31

name	Ighv1-32 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780888
definition	pseudo : _no_value standard_name : IGHV1-32

name	Ighv1-33 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:641247
definition	pseudo : _no_value standard_name : IGHV1-33

name	Ighv1-34 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:628614
definition	standard_name : IGHV1-34

name	EG668515 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668515
definition	gene_synonym : Ighv1-35 pseudo : _no_value standard_name : IGHV1-35

name	Ighv1-36 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629897
definition	standard_name : IGHV1-36

name	Ighv1-37 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668517
definition	standard_name : IGHV1-37

name	Ighv1-38 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780890
definition	pseudo : _no_value standard_name : IGHV1-38

name	Ighv1-39 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780891
definition	standard_name : IGHV1-39

name	Ighv1-40 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780892
definition	pseudo : _no_value standard_name : IGHV1-40

name	Ighv1-41 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629904
definition	pseudo : _no_value standard_name : IGHV1-41

name	EG629906 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629906
definition	gene_synonym : Ighv1-42 standard_name : IGHV1-42

name	EG629908 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629908
definition	gene_synonym : Ighv1-43 standard_name : IGHV1-43

name	Ighv1-44 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668521
definition	pseudo : _no_value standard_name : IGHV1-44

name	Ighv1-45 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780894
definition	pseudo : _no_value standard_name : IGHV1-45

name	Ighv1-46 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668522
definition	pseudo : _no_value standard_name : IGHV1-46

name	Ighv1-47 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629915
definition	standard_name : IGHV1-47

name	Ighv8-3 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780927
definition	pseudo : _no_value standard_name : IGHV8-3

name	EG629919 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629919
definition	gene_synonym : IGHV8-4 standard_name : IGHV8-4

name	Ighv1-48 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780928
definition	pseudo : _no_value standard_name : IGHV1-48

name	Ighv1-49 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629925
definition	standard_name : IGHV1-49

name	EG640506 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:640506
definition	gene_synonym : IGHV8-5 standard_name : IGHV8-5

name	Ighv1-50 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780929
definition	standard_name : IGHV1-50

name	Ighv1-51 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780930
definition	pseudo : _no_value standard_name : IGHV1-51

name	Ighv1-52 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382696
definition	standard_name : IGHV1-52

name	Ighv1-53 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780931
definition	standard_name : IGHV1-53

name	EG629930 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:629930
definition	gene_synonym : IGHV8-6 standard_name : IGHV8-6

name	EG211331 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:211331
definition	gene_synonym : IgH; IGHV1-54; VH standard_name : IGHV1-54

name	Ighv1-55 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780932
definition	standard_name : IGHV1-55

name	Ighv1-56 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:382695
definition	standard_name : IGHV1-56

name	Ighv8-7 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780936
definition	pseudo : _no_value standard_name : IGHV807

name	Ighv1-57 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780937
definition	standard_name : IGHV1-57

name	Ighv8-8 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780938
definition	standard_name : IGHV8-8

name	Ighv1-58 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780939
definition	standard_name : IGHV1-58

name	EG432708 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432708
definition	gene_synonym : IgH; IGHV1-59 standard_name : IGHV1-59

name	Ighv1-60 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780940
definition	pseudo : _no_value standard_name : IGHV1-60

name	Ighv1-61 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:674018
definition	gene_synonym : Vh3 standard_name : IGHV1-61

name	Ighv1-62 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668542
definition	pseudo : _no_value standard_name : IGHV1-62

name	EG668544 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668544
definition	gene_synonym : Ighv1-62-1 standard_name : IGHV1-62-1

name	EG238448 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:238448
definition	gene_synonym : IGHV1-62-2 standard_name : IGHV1-62-2

name	EG668549 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668549
definition	gene_synonym : IGHV1-62-3 standard_name : IGHV1-62-3

name	EG432709 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:432709
definition	gene_synonym : IGHV8-9 standard_name : IGHV8-9

name	Ighv1-63 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780956
definition	standard_name : IGHV1-63

name	Ighv1-64 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380823
definition	standard_name : IGHV1-64

name	Ighv8-10 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780957
definition	pseudo : _no_value standard_name : IGHV8-10

name	Ighv1-65 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780958
definition	pseudo : _no_value standard_name : IGHV1-65

name	EG636462 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:636462
definition	gene_synonym : IGHV8-11 standard_name : IGHV8-11

name	Ighv1-66 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:380824
definition	standard_name : IGHV1-66

name	EG435328 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435328
definition	gene_synonym : IGHV1-67 standard_name : IGHV1-67

name	Ighv1-68 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780959
definition	standard_name : IGHV1-68

name	Ighv1-69 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619833
definition	standard_name : IGHV1-69

name	Ighv8-12 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:780960
definition	standard_name : IGHV8-12

name	EG638634 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:638634
definition	gene_synonym : IGHV1-70 standard_name : IGHV1-70

name	EG619886 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619886
definition	gene_synonym : IGHV1-71 standard_name : IGHV1-71

name	Ighv1-72 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619916
definition	standard_name : IGHV1-72

name	EG668577 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668577
definition	gene_synonym : Ighv1-73 standard_name : IGHV1-73

name	EG668582 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668582
definition	gene_synonym : IGHV8-14 standard_name : IGHV8-14

name	Ighv1-75 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:622728
definition	standard_name : IGHV1-75

name	Ighv1-77 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:619994
definition	gene_synonym : IgH standard_name : IGHV1-77

name	Ighv1-78 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:213570
definition	standard_name : IGHV1-78

name	Ighv1-79 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:435331
definition	standard_name : IGHV1-79

name	Ighv1-80 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668589
definition	standard_name : IGHV1-80

name	Ighv1-81 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668591
definition	standard_name : IGHV1-81

name	Ighv1-83 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:620140
definition	standard_name : IGHV1-83

name	EG434609 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:434609
definition	gene_synonym : IgH; IGHV1-84 standard_name : IGHV1-84

name	EG668597 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668597
definition	gene_synonym : IGHV1-85 standard_name : IGHV1-85

name	EG668599 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:668599
definition	gene_synonym : Ighv1-86 standard_name : IGHV1-86

name	LOC676058 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263561 GeneID:676058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to ribosomal protein L32 pseudo : _no_value transcript_id : XR_033601.1

clone name	MSMg01-434I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-295B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-307F11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-078E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045I04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-479K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508B17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428L21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525G06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534D20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424N20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-430N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-503O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-271K13.b	B6Ng01-271K13.g
ACC	GA073682	GA073683
length	1,149	1,090
definition	B6Ng01-271K13.b	B6Ng01-271K13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(116,759,799 - 116,760,940)	(116,953,182 - 116,954,261)
sequence	gaattccaagcccatggtcagctcaaggactttctaggacgttggaacac tggtgaaggcttagctatctcagaattcaatcttaaaaggcacttataat aagataatactaaaaaagagcatgtggatccataaatcagactaactcgg gaatagaatgtgtatatgtgttaaagagaacaccagactccaggaggaag tttccatgaaactctctgcctcgtgagtggcttccaggtctctaggcctg tcaagctgactcgactgaagtgtgtggcaccttaagaaatgttaaatcac aattattcctctttgttcttatcagtattgatgtttcagaagttagagat aataagatttctctaactttgatcaactttatgcagtggtttgttggaat gaacatgattgaatatatggaaaacaagcttgagtagatgactgatttca ttaaagaagtctatgccaaaataaatcaagttcctttcatgaataaaaca tcttcatattttcagatgtttaaaagataaaaatatcaagttatgtccat accataaaataagatcttagtacaaagttttattaacacaagaaagagaa acgaatcccagaatgctgactgacatcagagggcctgaacccatagcata agatgtgcaataagacctgcactgacaattaggttccttttccaggtggg ttgttaattttaacatgactttttatctatgagtaaattatgtatcttga aatagaagaatttctgacattgtcctcaggagaatcaaagatcatcatgt acatcctcataagggaggaagggcccacagaaggcaaagattttgctata tatgacacagaggctaagtagccagatttggatgaagtgaccatagtgct agaaaaacaaatattgctgaatcctgaatattggaaagtcagacaagaga ttcttcaaaacactgactatcatatctaaccaggatcacagatgttgaac ttcacatgctttgtccctggagggcataaaaatgtgatataagccttata atggaagaagaaattttcctgactttttcacatgaagccttgaaagtaat ggtgggtccatgttccaataaatgttacagaacgagaaatgaacaacat	gaattcaccttcttttcatccttcccaagtcacacactaatggctggttt atatttacatctcatgagattagatcttgtctctcctagcagacatcata cataatttaaaggtgtgtttggttggtactttactccatgtacatcttca atcacattcctcactccatcaacataaaacatgttttcctcacaaattaa aaattgtgccatcattttcaatccaagcgatgaagaatttatgaaggatg aattggtgtctccattttttttctaagaattgcttacactggaagccttt cccctcacatgtcactgtgataaacagggagacccagtcattcctaaagc actgattggaaatagattaaataaactctcaccttgaatatatctgagac ctgaaattgtgaatactataaagccattcactgaaccttttgagtaagtg agctattcctactttccaaaatattttataatttttttaccacttcattg gcagggtgcttcacacctatatttatattatatatttagatgaattttat agaatacataaaaattaattcttttttttcttctaaattgttaaatttat tcatagagttacttgtatcattaaatagatgtagcatgtgcagttatatc tcagtctctcctgtggttcagtctccagaccccacttagtaggaagacga ctggcttccacacgttgtccactaacctccacaaaaattaattcttgtac ctcacagtcaatacttattattagacttttaacctcagaaccagaactac agcatgaacaagtgaaaaattcaagctgaatatcttcatccattgcagct catacgccagtcataaatcaacatcatactttttattttcctccatggac aaaacatttgaaatgcaatattctcttacctggttcgatatgatgctctc tctctcagtagagtctgtttctgcatttctcatattcagaccagcaatac ttgtacctctagcccttctgggctccttgtttcaaccctgaacagcctta gccaggttccattaatcaattccatgaattcttttgtccc
quality values	Open. Hide. 58 26 24 34 58 58 39 12 54 62 62 62 42 32 62 62 62 62 47 47 62 62 62 47 56 62 62 54 41 44 62 62 56 56 51 29 34 49 25 44 59 59 62 59 62 59 62 62 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 58 58 58 58 58 58 58 46 58 58 58 58 58 58 58 54 58 58 58 58 54 52 58 58 58 58 58 54 58 58 58 52 58 58 58 58 54 58 58 54 58 38 37 58 54 58 54 41 58 58 58 58 58 52 54 58 54 54 47 58 58 58 54 54 58 58 54 58 58 58 58 54 58 58 58 49 49 58 49 58 58 53 58 58 58 51 58 58 58 53 58 50 58 58 48 46 50 58 51 52 49 58 58 52 46 58 39 41 58 53 58 58 58 47 54 58 50 48 49 58 58 50 50 51 24 58 51 40 58 51 58 49 50 46 44 43 32 53 50 50 54 52 53 53 54 52 51 40 58 52 58 52 50 50 50 51 52 52 51 30 58 51 58 54 30 46 51 49 41 54 26 52 52 58 50 49 46 37 52 40 53 52 58 58 37 37 50 39 47 58 39 47 58 44 39 39 51 37 40 39 49 40 54 38 44 35 39 52 37 52 54 47 43 54 54 54 54 44 45 52 42 37 37 49 53 54 25 38 28 54 39 52 49 35 37 46 34 33 53 53 53 52 53 42 54 37 45 42 33 51 54 36 54 19 44 33 27 32 38 52 34 20 21 51 37 42 31 39 39 37 45 35 28 54 49 37 51 41 40 42 31 52 51 32 31 32 39 34 45 32 32 31 52 35 28 34 25 53 34 53 52 40 35 45 28 45 21 51 32 32 10 51 33 40 12 47 32 32 41 32 23 31 39 36 51 22 10 51 23 43 51 42 39 33 17 51 51 43 31 31 37 31 31 30 31 31 43 31 33 27 32 37 31 31 42 24 41 29 38 34 43 31 31 32 29 30 21 22 31 41 24 48 31 33 26 31 20 26 34 33 31 31 31 26 26 30 35 43 35 32 32 41 29 28 23 30 36 48 46 48 28 24 13 46 21 31 26 28 26 42 31 36 36 28 32 25 23 31 27 30 21 31 31 26 29 20 30 23 42 48 31 32 32 32 19 13 37 24 22 21 24 38 23 32 24 22 37 30 27 32 26 38 44 29 22 20 31 32 35 32 27 22 31 29 32 21 22 31 32 32 22 21 23 20 12 18 37 21 15 21 23 14 18 16 20 21 18 19 6 25 22 18 17 18 16 19 21 18 31 17 20 34 32 31 48 17 21 18 17 48 33 28 29 24 28 9 27 19 3 10 28 13 32 47 34 24 7 19 15 13 11 12 11 8 5 10 24 12 10 6 6 7 9 6 11 17 15 17 3 14 16 17 23 13 15 34 19 4 32 47 16 4 8 8 27 16 8 20 40 47 29 15 4 3 3 6 18 13 8 12 6 20 9 20 17 21 16 26 10 10 17 12 9 4 4 10 7 20 26 19 5 8 19 10 10 9 4 9 14 23 9 8 8 15 30 20 5 11 9 6 8 23 8 7 6 6 6 7 11 4 5 3 2 8 7 11 6 10 10 4 11 5 4	Open. Hide. 62 47 50 42 62 47 51 54 62 62 56 62 56 49 49 56 44 21 59 59 62 62 62 62 62 47 46 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 59 59 54 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 47 44 49 49 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 32 34 62 46 46 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 49 49 58 58 58 58 58 58 58 58 58 58 58 58 49 49 58 58 58 54 58 58 52 58 58 58 58 54 58 58 58 58 54 52 58 58 58 54 58 58 58 58 58 46 54 54 58 58 58 58 58 58 58 58 52 58 58 52 58 54 58 54 58 58 58 54 58 58 58 54 58 54 58 58 54 51 58 58 51 53 51 48 49 58 51 52 58 54 50 58 50 58 58 58 53 46 54 53 53 51 58 58 51 58 58 58 58 58 58 49 51 52 52 53 49 43 58 48 48 58 58 41 50 54 58 58 40 58 47 52 58 58 53 42 51 58 49 58 52 58 54 50 50 50 58 58 52 51 51 53 52 58 54 48 58 58 54 53 52 51 41 58 52 51 38 51 53 53 58 52 58 47 50 52 52 53 51 50 53 41 53 53 49 52 39 47 53 53 53 42 52 54 37 58 38 51 58 33 42 50 39 41 40 53 39 42 49 31 37 49 27 33 33 39 29 46 50 47 42 29 45 52 26 39 51 53 37 47 25 25 54 23 34 49 54 39 54 46 32 39 32 45 47 47 37 33 29 46 40 41 44 36 43 45 37 30 40 32 44 25 28 37 34 23 54 54 54 37 40 39 37 35 47 41 40 37 33 31 25 27 37 44 45 32 40 32 32 31 27 32 21 38 35 32 32 53 38 35 33 34 42 31 32 36 26 32 28 32 53 53 33 31 43 26 45 52 40 37 29 53 41 23 40 24 31 42 30 28 31 31 43 19 31 32 30 33 42 31 32 31 31 38 30 28 33 34 47 47 51 29 29 42 39 26 26 31 36 31 26 31 33 27 31 31 37 36 30 30 20 31 26 31 31 31 28 42 32 31 28 25 31 31 29 28 33 31 25 32 30 30 31 31 38 35 31 32 48 31 31 31 27 31 21 25 42 36 29 41 30 32 37 48 47 47 18 38 22 48 46 26 24 22 25 22 29 21 23 32 34 27 19 27 46 41 28 27 24 35 48 25 25 34 48 31 26 42 24 25 20 33 30 24 22 30 33 29 15 21 36 26 24 15 20 25 6 11 32 22 38 19 29 23 23 34 22 32 21 31 31 27 22 21 32 27 18 19 18 27 12 18 32 10 29 22 24 23 16 26 19 39 16 16 14 22 20 22 32 33 11 6 6 19 24 16 28 22 32 25 22 8 31 12 14 29 21 32 33 22 17 21 11 9 11 18 18 20 18 5 6 7 16 24 12 17 40 18 8 8 10 10 13 30 20 12 9 6 10 7 16 7 6 22 27 5 3 13 6 21 9 17 26 13 7 4 5 7 9 13 16 14 9 4 5 5 13 28 21 15 10 16 17 10 15 5 8 9 16 11 7 9 21 9 11 16 7 7 23 7 9 8 5 5 4 20 28 12 9 5 14 17 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_116759799_116760940
seq2: B6Ng01-271K13.b_48_1196

seq1  GAATTCCAAGCCCATGGTCAGCTCAAGGACTTTCTAGGACGTTGGAACAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAGCCCATGGTCAGCTCAAGGACTTTCTAGGACGTTGGAACAC  50

seq1  TGGTGAAGGCTTAGCTATCTCAGAATTCAATCTTAAAAGGCACTTATAAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGAAGGCTTAGCTATCTCAGAATTCAATCTTAAAAGGCACTTATAAT  100

seq1  AAGATAATACTAAAAAAGAGCATGTGGATCCATAAATCAGACTAACTCGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATAATACTAAAAAAGAGCATGTGGATCCATAAATCAGACTAACTCGG  150

seq1  GAATAGAATGTGTATATGTGTTAAAGAGAACACCAGACTCCAGGAGGAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGAATGTGTATATGTGTTAAAGAGAACACCAGACTCCAGGAGGAAG  200

seq1  TTTCCATGAAACTCTCTGCCTCGTGAGTGGCTTCCAGGTCTCTAGGCCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCATGAAACTCTCTGCCTCGTGAGTGGCTTCCAGGTCTCTAGGCCTG  250

seq1  TCAAGCTGACTCGACTGAAGTGTGTGGCACCTTAAGAAATGTTAAATCAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGCTGACTCGACTGAAGTGTGTGGCACCTTAAGAAATGTTAAATCAC  300

seq1  AATTATTCCTCTTTGTTCTTATCAGTATTGATGTTTCAGAAGTTAGAGAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTATTCCTCTTTGTTCTTATCAGTATTGATGTTTCAGAAGTTAGAGAT  350

seq1  AATAAGATTTCTCTAACTTTGATCAACTTTATGCAGTGGTTTGTTGGAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAGATTTCTCTAACTTTGATCAACTTTATGCAGTGGTTTGTTGGAAT  400

seq1  GAACATGATTGAATATATGGAAAACAAGCTTGAGTAGATGACTGATTTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACATGATTGAATATATGGAAAACAAGCTTGAGTAGATGACTGATTTCA  450

seq1  TTAAAGAAGTCTATGCCAAAATAAATCAAGTTCCTTTCATGAATAAAACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGAAGTCTATGCCAAAATAAATCAAGTTCCTTTCATGAATAAAACA  500

seq1  TCTTCATATTTTCAGATGTTTAAAAGATAAAAATATCAAGTTATGTCCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCATATTTTCAGATGTTTAAAAGATAAAAATATCAAGTTATGTCCAT  550

seq1  ACCATAAAATAAGATCTTAGTACAAAGTTTTATTAACACAAGAAAGAGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATAAAATAAGATCTTAGTACAAAGTTTTATTAACACAAGAAAGAGAA  600

seq1  ACGAATCCCAGAATGCTGACTGACATCAGAGGGCCTGAACCCATAGCATA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGAATCCCAGAATGCTGACTGACATCAGAGGGCCTGAACCCATAGCATA  650

seq1  AGATGTGCAATAAGACCTGCACTGACAATTAGGTTCCTTTTCCAGGTGGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGTGCAATAAGACCTGCACTGACAATTAGGTTCCTTTTCCAGGTGGG  700

seq1  TTGTTAATTTTAACATGACTTTTTATCTATGAGTAAATTATGTATCTTGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTAATTTTAACATGACTTTTTATCTATGAGTAAATTATGTATCTTGA  750

seq1  AATAGAAGAATTTCTGACATTGTCCTCAGGAGAATCAAAGATCATCATGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAGAAGAATTTCTGACATTGTCCTCAGGAGAATCAAAGATCATCATGT  800

seq1  ACATCCTCATAAGGGAGGAAGGGCCCACAGAAGGCAAAGATTTTGCTATA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCTCATAAGGGAGGAAGGGCCCACAGAAGGCAAAGATTTTGCTATA  850

seq1  TATGACACAGAGGCTAAGTAGCCAGATTTGGATGAAGTGACCATAGTGCT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGACACAGAGGCTAAGTAGCCAGATTTGGATGAAGTGACCATAGTGCT  900

seq1  AGAAAAACAAATATTGCTGAATCCTGAATATTGGAAAGTCAGACAAGAGA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAACAAATATTGCTGAATCCTGAATATTGGAAAGTCAGACAAGAGA  950

seq1  TTCTTCAAAACACTGACTATCATATCTAACCAGGATCACAGATGTTGAAC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCAAAACACTGACTATCATATCTAACCAGGATCACAGATGTTGAAC  1000

seq1  TTCACATGCTTTGTCCCTGGAGGGCATAAAAATGTGATATAAGC--TATA  1048
      ||||||||||||||||||||||||||||||||||||||||||||  ||||
seq2  TTCACATGCTTTGTCCCTGGAGGGCATAAAAATGTGATATAAGCCTTATA  1050

seq1  ATGGAAGAAGAAATTTTTCCTGACTTTTTCACATGA--GCTTG-AAGTAA  1095
      ||||||||||||| ||||||||||||||||||||||   |||| ||||||
seq2  ATGGAAGAAGAAA-TTTTCCTGACTTTTTCACATGAAGCCTTGAAAGTAA  1099

seq1  TTGTGGGTCCATGT--CCATAAATG-TACAGACAGAGATATGAACAACAT  1142
      | ||||||||||||  | ||||||| ||||||  |||| |||||||||||
seq2  TGGTGGGTCCATGTTCCAATAAATGTTACAGAACGAGAAATGAACAACAT  1149

seq1: chr12_116953182_116954261
seq2: B6Ng01-271K13.g_66_1155 (reverse)

seq1  GGGACAAAAGA--TCATGGAA-TGA-TAATGGAACCTGGCTAA-GCTG-T  44
      |||||||||||  |||||||| ||| ||||||||||||||||| |||| |
seq2  GGGACAAAAGAATTCATGGAATTGATTAATGGAACCTGGCTAAGGCTGTT  50

seq1  CAGGTTTGAAACAA-GAG-CCAG-AGGGCTAGAGGTACAAGTATTGCTGG  91
      |||| ||||||||| ||| |||| ||||||||||||||||||||||||||
seq2  CAGGGTTGAAACAAGGAGCCCAGAAGGGCTAGAGGTACAAGTATTGCTGG  100

seq1  TCTTGAATATGAGAAATGCAGAAACAGACTCTACTGAGAGAGAGAGCATC  141
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  TC-TGAATATGAGAAATGCAGAAACAGACTCTACTGAGAGAGAGAGCATC  149

seq1  ATATCGAACCAGGTAAGAGAATATTGCATTTCAAATGTTTTGTCCATGGA  191
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCGAACCAGGTAAGAGAATATTGCATTTCAAATGTTTTGTCCATGGA  199

seq1  GGAAA--TAAAAGTATGATGTTGATTTATGACTGGCGTATGAGCTGCAAT  239
      |||||   ||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAATAAAAAGTATGATGTTGATTTATGACTGGCGTATGAGCTGCAAT  249

seq1  GGATGAAGATATTCAGCTTGAATTTTTCACTTGTTCATGCTGTAGTTCTG  289
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGAAGATATTCAGCTTGAATTTTTCACTTGTTCATGCTGTAGTTCTG  299

seq1  GTTCTGAGGTTAAAAGTCTAATAATAAGTATTGACTGTGAGGTACAAGAA  339
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGAGGTTAAAAGTCTAATAATAAGTATTGACTGTGAGGTACAAGAA  349

seq1  TTAATTTTTGTGGAGGTTAGTGGACAACGTGTGGAAGCCAGTCGTCTTCC  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATTTTTGTGGAGGTTAGTGGACAACGTGTGGAAGCCAGTCGTCTTCC  399

seq1  TACTAAGTGGGGTCTGGAGACTGAACCACAGGAGAGACTGAGATATAACT  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTAAGTGGGGTCTGGAGACTGAACCACAGGAGAGACTGAGATATAACT  449

seq1  GCACATGCTACATCTATTTAATGATACAAGTAACTCTATGAATAAATTTA  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACATGCTACATCTATTTAATGATACAAGTAACTCTATGAATAAATTTA  499

seq1  ACAATTTAGAAGAAAAAAAAGAATTAATTTTTATGTATTCTATAAAATTC  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAATTTAGAAGAAAAAAAAGAATTAATTTTTATGTATTCTATAAAATTC  549

seq1  ATCTAAATATATAATATAAATATAGGTGTGAAGCACCCTGCCAATGAAGT  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTAAATATATAATATAAATATAGGTGTGAAGCACCCTGCCAATGAAGT  599

seq1  GGTAAAAAAATTATAAAATATTTTGGAAAGTAGGAATAGCTCACTTACTC  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAAAAAAATTATAAAATATTTTGGAAAGTAGGAATAGCTCACTTACTC  649

seq1  AAAAGGTTCAGTGAATGGCTTTATAGTATTCACAATTTCAGGTCTCAGAT  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGTTCAGTGAATGGCTTTATAGTATTCACAATTTCAGGTCTCAGAT  699

seq1  ATATTCAAGGTGAGAGTTTATTTAATCTATTTCCAATCAGTGCTTTAGGA  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTCAAGGTGAGAGTTTATTTAATCTATTTCCAATCAGTGCTTTAGGA  749

seq1  ATGACTGGGTCTCCCTGTTTATCACAGTGACATGTGAGGGGAAAGGCTTC  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACTGGGTCTCCCTGTTTATCACAGTGACATGTGAGGGGAAAGGCTTC  799

seq1  CAGTGTAAGCAATTCTTAGAAAAAAAATGGAGACACCAATTCATCCTTCA  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTAAGCAATTCTTAGAAAAAAAATGGAGACACCAATTCATCCTTCA  849

seq1  TAAATTCTTCATCGCTTGGATTGAAAATGATGGCACAATTTTTAATTTGT  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATTCTTCATCGCTTGGATTGAAAATGATGGCACAATTTTTAATTTGT  899

seq1  GAGGAAAACATGTTTTATGTTGATGGAGTGAGGAATGTGATTGAAGATGT  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAAAACATGTTTTATGTTGATGGAGTGAGGAATGTGATTGAAGATGT  949

seq1  ACATGGAGTAAAGTACCAACCAAACACACCTTTAAATTATGTATGATGTC  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGGAGTAAAGTACCAACCAAACACACCTTTAAATTATGTATGATGTC  999

seq1  TGCTAGGAGAGACAAGATCTAATCTCATGAGATGTAAATATAAACCAGCC  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTAGGAGAGACAAGATCTAATCTCATGAGATGTAAATATAAACCAGCC  1049

seq1  ATTAGTGTGTGACTTGGGAAGGATGAAAAGAAGGTGAATTC  1080
      |||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTGTGTGACTTGGGAAGGATGAAAAGAAGGTGAATTC  1090

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information