MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-291M03
Chromosome	12 (Build37)
Map Location	4,289,499 - 4,345,039
singlet/doublet	doublet
Overlap gene	Ncoa1
Upstream gene	Rab10, Kif3c, LOC100043040, Asxl2, LOC627245, Dtnb, LOC668197, Dnmt3a, LOC668289, Pomc1, C030014M07Rik, C330021A05Rik, Adcy3, Cenpo, 2410017P09Rik
Downstream gene	LOC100041995, LOC100042005, LOC100042014, Itsn2, 4930417G10Rik, A830093I24Rik, Pfn4, EG626534, 0610009D07Rik, Fkbp1b, BC068281, Gm1964, Ubxd4, Atad2b, LOC668332, Klhl29
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rab10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19325 MGI:105066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16570 MGI:107979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043040 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Asxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75302 MGI:1922552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 156 ESTs, 12 Proteins pseudo : _no_value

name	Dtnb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13528 MGI:1203728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 7 Proteins pseudo : _no_value

name	Dnmt3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13435 MGI:1261827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 13 Proteins pseudo : _no_value

name	Pomc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18976 MGI:97742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030014M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668212 MGI:2444851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330021A05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217378 MGI:2443036
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adcy3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104111 MGI:99675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52504 MGI:1923800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410017P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69709 MGI:1916959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 33 ESTs, 2 Proteins

name	Ncoa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17977 MGI:1276523
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041995 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042005 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042014 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	Itsn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20403 MGI:1338049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930417G10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74855 MGI:1922105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830093I24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207921 MGI:2442121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382562 MGI:1920121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG626534 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626534 MGI:3647156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 576 ESTs, 8 Proteins

name	0610009D07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66055 MGI:1913305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fkbp1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14226 MGI:1336205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC068281 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238037 MGI:3040699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1964 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432628 MGI:3583946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubxd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217379 MGI:2442310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atad2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320817 MGI:2444798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 89 ESTs, 18 Proteins

name	LOC668332 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Klhl29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208439 MGI:2683857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 43 ESTs, 17 Proteins

name	Rab10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352796 GeneID:19325 MGI:105066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB10, member RAS oncogene family transcript_id : NM_016676.4

name	Kif3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781816 GeneID:16570 MGI:107979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 3C transcript_id : NM_008445.2

name	LOC100043040 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262826 GeneID:100043040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : hypothetical protein LOC100043040 transcript_id : XM_001480016.1

name	Asxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801200 GeneID:75302 MGI:1922552
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : additional sex combs like 2 (Drosophila) transcript_id : NM_172421.2

name	Dtnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681234 GeneID:13528 MGI:1203728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrobrevin, beta transcript_id : NM_007886.1

name	Dnmt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145580 GeneID:13435 MGI:1261827
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3A transcript_id : NM_007872.4

name	Dnmt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224481 GeneID:13435 MGI:1261827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3A transcript_id : NM_153743.3

name	Pomc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346465 GeneID:18976 MGI:97742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pro-opiomelanocortin-alpha transcript_id : NM_008895.3

name	C030014M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723101 GeneID:668212 MGI:2444851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030014M07 gene transcript_id : NM_001082483.1

name	C330021A05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352689 GeneID:217378 MGI:2443036
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330021A05 gene transcript_id : NM_153082.3

name	Adcy3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475810 GeneID:104111 MGI:99675
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 3 transcript_id : NM_138305.2

name	Cenpo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373701 GeneID:52504 MGI:1923800
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein O transcript_id : NM_134046.4

name	Ncoa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754799 GeneID:17977 MGI:1276523
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor coactivator 1 transcript_id : NM_010881.1

name	LOC100041995 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262774 GeneID:100041995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041995 transcript_id : XM_001477354.1

name	LOC100042005 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262776 GeneID:100042005
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Dmn protein transcript_id : XM_001477368.1

name	LOC100042014 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262778 GeneID:100042014
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042014 transcript_id : XM_001477387.1

name	Itsn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46560562 GeneID:20403 MGI:1338049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intersectin 2 transcript_id : NM_011365.2

name	4930417G10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378242 GeneID:74855 MGI:1922105
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930417G10 gene transcript_id : NM_029107.2

name	A830093I24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948412 GeneID:207921 MGI:2442121
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830093I24 gene transcript_id : NM_175431.3

name	Pfn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803435 GeneID:382562 MGI:1920121
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : profilin family, member 4 transcript_id : NM_028376.2

name	0610009D07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981274 GeneID:66055 MGI:1913305
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610009D07 gene transcript_id : NM_025323.2

name	Fkbp1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173727 GeneID:14226 MGI:1336205
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FK506 binding protein 1b transcript_id : NM_016863.3

name	BC068281 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362297 GeneID:238037 MGI:3040699
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC068281 transcript_id : NM_173416.2

name	Gm1964 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702024 GeneID:432628 MGI:3583946
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1964, (NCBI) transcript_id : NM_001033488.1

name	Ubxd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375695 GeneID:217379 MGI:2442310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UBX domain containing 4 transcript_id : NM_145441.3

name	Atad2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262840 GeneID:320817 MGI:2444798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 89 ESTs, 18 Proteins product : ATPase family, AAA domain containing 2B transcript_id : XM_001480129.1

name	Klhl29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392376 GeneID:208439 MGI:2683857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 43 ESTs, 17 Proteins product : kelch-like 29 (Drosophila) transcript_id : XM_906219.2

name	Rab10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710086 CCDS:CCDS25782.1 GeneID:19325 MGI:105066
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB10, member RAS oncogene family protein_id : NP_057885.1

name	Kif3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781817 CCDS:CCDS25783.1 GeneID:16570 MGI:107979
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : N-4 kinesin product : kinesin family member 3C protein_id : NP_032471.2

name	LOC100043040 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262827 GeneID:100043040
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480066.1

name	Asxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369555 GeneID:75302 MGI:1922552
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : polycomb group protein ASXH2 homolog protein_id : NP_766009.1

name	Dtnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681235 GeneID:13528 MGI:1203728
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dystrobrevin, beta protein_id : NP_031912.1

name	Dnmt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681209 GeneID:13435 MGI:1261827
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0000791 - euchromatin [Evidence ISS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS] [Evidence IDA]; GO:0006349 - imprinting [Evidence IMP] [Evidence ISS]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DNA methyltransferase 3A isoform 1 protein_id : NP_031898.1

name	Dnmt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371231 CCDS:CCDS25784.1 GeneID:13435 MGI:1261827
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0000791 - euchromatin [Evidence ISS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS] [Evidence IDA]; GO:0006349 - imprinting [Evidence IMP] [Evidence ISS]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DNA methyltransferase 3A isoform 2 protein_id : NP_714965.1

name	Pomc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679415 CCDS:CCDS25785.1 GeneID:18976 MGI:97742
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IDA] GO_process : GO:0008217 - blood pressure regulation [Evidence IGI]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : adrenal corticotropic hormone; alpha-melanocyte stimulating hormone; beta-melanocyte stimulating hormone; gamma-melanocyte stimulating hormone product : pro-opiomelanocortin-alpha protein_id : NP_032921.1

name	C030014M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723102 GeneID:668212 MGI:2444851
definition	codon_start : 1 product : hypothetical protein LOC668212 protein_id : NP_001075952.1

name	C330021A05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70887607 CCDS:CCDS25786.1 GeneID:217378 MGI:2443036
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] codon_start : 1 product : Rab-related GTP-binding protein protein_id : NP_694722.2

name	Adcy3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270241 CCDS:CCDS25787.1 GeneID:104111 MGI:99675
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : adenylyl cyclase 3 product : adenylate cyclase 3 protein_id : NP_612178.1

name	Cenpo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336049 CCDS:CCDS25788.1 GeneID:52504 MGI:1923800
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : centromere protein O protein_id : NP_598807.2

name	Ncoa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754800 CCDS:CCDS25789.1 GeneID:17977 MGI:1276523
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : transcriptional coactivator for steroid and nuclear hormone receptors note : SRC-a/NCoA-1; steroid receptor coactivator-1 product : nuclear receptor coactivator 1 protein_id : NP_035011.1

name	LOC100041995 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262775 GeneID:100041995
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477404.1

name	LOC100042005 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262777 GeneID:100042005
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477418.1

name	LOC100042014 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262779 GeneID:100042014
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477437.1

name	Itsn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46560563 GeneID:20403 MGI:1338049
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : Eh domain, SH3 domain regulator of endocytosis 2 product : SH3 domain protein 1B protein_id : NP_035495.2

name	4930417G10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037391 GeneID:74855 MGI:1922105
definition	codon_start : 1 product : hypothetical protein LOC74855 protein_id : NP_083383.1

name	A830093I24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948413 GeneID:207921 MGI:2442121
definition	codon_start : 1 product : hypothetical protein LOC207921 protein_id : NP_780640.2

name	Pfn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47058966 CCDS:CCDS25790.1 GeneID:382562 MGI:1920121
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : profilin IV product : profilin family, member 4 protein_id : NP_082652.1

name	0610009D07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384692 CCDS:CCDS25791.1 GeneID:66055 MGI:1913305
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : splicing factor 3B, 14 kDa subunit protein_id : NP_079599.1

name	Fkbp1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123173728 CCDS:CCDS25792.1 GeneID:14226 MGI:1336205
definition	GO_function : GO:0005528 - FK506 binding [Evidence ISS] codon_start : 1 note : FK506 binding protein 1b (12.6 kDa) product : FK506 binding protein 1b protein_id : NP_058559.3

name	BC068281 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734144 CCDS:CCDS25793.1 GeneID:238037 MGI:3040699
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC238037 protein_id : NP_775592.1

name	Gm1964 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702025 GeneID:432628 MGI:3583946
definition	codon_start : 1 product : hypothetical protein LOC432628 protein_id : NP_001028660.1

name	Ubxd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703880 CCDS:CCDS25795.1 GeneID:217379 MGI:2442310
definition	codon_start : 1 product : UBX domain containing 4 protein_id : NP_663416.1

name	Atad2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262841 GeneID:320817 MGI:2444798
definition	codon_start : 1 product : ATPase family, AAA domain containing 2B protein_id : XP_001480179.1

name	Klhl29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392377 GeneID:208439 MGI:2683857
definition	codon_start : 1 product : similar to mKIAA1921 protein protein_id : XP_911312.2

name	LOC668332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668332
definition	number : 4 pseudo : _no_value

name	LOC668332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668332
definition	number : 3 pseudo : _no_value

name	LOC668332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668332
definition	number : 2 pseudo : _no_value

name	LOC668332 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668332
definition	number : 1 pseudo : _no_value

name	LOC627245 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262828 GeneID:627245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 156 ESTs, 12 Proteins product : similar to Odc1 protein pseudo : _no_value transcript_id : XR_034503.1

name	LOC668197 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262829 GeneID:668197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 7 Proteins product : similar to ribosomal protein S26 pseudo : _no_value transcript_id : XR_034504.1

name	LOC668289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262830 GeneID:668289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 13 Proteins product : similar to peptidylprolyl isomerase H (cyclophilin H) pseudo : _no_value transcript_id : XR_034506.1

name	2410017P09Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262835 GeneID:69709 MGI:1916959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 33 ESTs, 2 Proteins product : RIKEN cDNA 2410017P09 gene transcript_id : XR_001632.2

name	EG626534 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262838 GeneID:626534 MGI:3647156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 576 ESTs, 8 Proteins product : predicted gene, EG626534 transcript_id : XR_034533.1

clone name	MSMg01-271C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-291M03.b	B6Ng01-291M03.g
ACC	GA088565	GA088566
length	1,230	1,105
definition	B6Ng01-291M03.b	B6Ng01-291M03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(4,343,829 - 4,345,039)	(4,289,499 - 4,290,619)
sequence	gaattcagagtggaaaagtacaattcaaaactccaaatcaagcttatcac tttaactttaatcacatagatattgttcattctctctcaggataattcac aaataaacttgttttaagcctttttacaaagtaaggtctacataataatt ttgaatctgaataataatactaaaatttttcagagtccagtttttacatt tatacatgcaagtgatttttctcttggtaaaaatatttctacttaatttt tccaagaaaatctttattctgattgatatcaatcatttcatggggagttg ttaattttgtttcactggcttaaaagtaagcatagtaacaagtagctggt gtccctgtggtctccttggaggccggggcttctgtgatggctgcggccac ctcgtcactgtttacaagttttgttggggttgttttgttttgttttctga tgtttagaaataacaagggagcttcccctactctcatttggttagaaagg tcatgagagatttatttttctcaccctccccatttaggtgtgaagttcat caacatgagtggccttggggacagttcatcagaccctgcaaacccagact ctcataagagaaaaggatcgccatgtgacacgctggcatcaaggtaggaa tgcgctctgtctctggcagagcttttttggtcatttcttcaacactttgg actttgtttcatccactccatattgagtggccacctgtctcctcctgctc attcagtacagtctgccccacccccacccaggtctttgaatgtgtttctc ctttcttccaacttgtatcctctttatttccagtactaatctgtagctgt tactgcagatgctgtagtaagccattacttccttaaagaaaggcttctct tcctcccacaactagtagctcaaatctttctttttattatctgttctgta catcattgtggctttgattcatagttattggctgttgctagagtatatgc tcattgcataaaattctagcttcttcgttaggcttgtatgctgctctaaa gtaagggacctattctgcctcttgctccagcaacactgtatccccttagt tcacagtgcaatatgttatcctttactagtaaggacataaatctggaata aaaatttctattgacatctttaaatggccatctttaggaactgagaagtc attgtctaaaagtctatttaaataatattt	gaattcatctttgttaataaatggagtgtgaagcctcaatttccactctt gactcctcctctcgtggtctggccaactaaaatgctgcttcccaatgtgt caacaagacaacccagtcttcttcgcggctgccttgaagtcttggggaat ttccaggaattgggtcctgacttctgaaagttccagtgagaaggcagtaa gtgaagacccatgcttgagcccattagatgatggagaggatggaaggagt ccagaagattccagaagtttccttcactttcaaggtcacacagtggtatt atcatcaatgattttttttctaattttgaaatctgatatgtgaaaaaaag actaacagtccaaatttcatgaatttcaagtattacagtactagtctatt ttagttagaagaacgctaaccagggttagcacagtcgtggcatgctttaa caccacagtctcctaaataatattccatggagactcattctgtggggtaa tgtgtattacttgaggaaagcaattctataatatggaaagtttgggcaat tctagttaaataaatatgaattggcttctctaatttaaaagaagctgcaa actttcatagccaagtacatttcatcaggaaatgatggacatgcagttgt ttagggtactttgaaacagaatcttttctttttataacactaatagtcaa gagaaagatttgaaaaacatgctctgacccaatactatatttctgagtgt tgttataggtgctctggataggaacacaaaccactctcctcgccccctaa tctgtaacaattacaaaaggaggggctatactactttagaactattcaag atcggggcatgcctggaagcctagcacttgggaagtgaaggtaggagggt caggagttcacagtcatccgcagctacgaagcgagttgagacactctggg aatacatcagactcagtctcaagaaaatgcattctatgactaaaggtaac tgcttcatggtagagtgcatagtgaaaagatgttcatcgttctttctttc ttttttgagaacagatttctctgtgtagctgctgtcctggaactcactcg tagac
quality values	Open. Hide. 34 31 16 29 62 31 24 41 62 62 47 62 62 62 62 62 49 26 47 56 56 42 62 62 62 41 42 62 62 62 62 62 62 59 43 45 38 38 35 33 29 38 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 54 54 54 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 46 58 58 54 58 58 49 58 54 42 54 58 54 58 54 54 58 58 58 52 58 52 58 58 58 58 58 54 58 54 54 58 46 38 54 54 54 58 58 58 54 51 52 58 58 52 58 42 58 58 58 54 41 58 41 37 58 46 46 46 50 54 58 51 58 42 53 52 53 51 58 51 47 58 50 50 51 53 46 51 48 58 47 51 33 51 58 48 37 58 46 41 51 53 53 53 58 52 51 53 53 52 49 41 32 50 31 58 24 49 52 58 58 58 58 58 58 49 35 52 42 50 58 51 53 53 52 52 41 52 53 49 52 58 58 52 51 50 41 25 43 58 52 51 33 49 29 38 34 53 50 49 39 49 52 50 43 24 52 52 39 50 49 44 41 45 54 44 22 49 36 42 44 47 51 42 53 39 32 49 52 37 49 39 51 32 50 37 31 49 44 41 32 37 52 39 42 32 41 32 51 42 45 30 54 54 46 37 40 54 54 46 39 32 46 49 37 32 32 46 22 42 42 54 41 34 40 54 37 54 29 42 27 54 32 37 37 40 51 27 51 14 33 29 40 32 33 22 32 32 31 30 53 31 34 36 40 46 33 41 33 49 32 32 28 53 52 31 31 26 36 31 31 34 34 26 41 32 42 31 42 24 31 32 37 33 42 33 28 26 31 31 31 25 31 28 34 23 31 29 31 41 23 43 28 35 31 31 31 31 31 25 31 30 31 34 32 42 31 33 33 35 29 46 32 18 27 46 27 25 23 16 26 33 30 23 31 24 42 25 32 28 30 47 31 21 21 29 30 31 31 31 31 35 38 23 33 34 21 19 46 32 29 42 26 48 32 26 19 48 48 48 28 28 39 39 27 21 30 33 42 16 24 31 17 31 10 29 29 24 33 32 27 33 20 31 13 31 33 26 31 47 18 21 25 15 27 33 22 27 33 21 37 21 20 14 31 20 18 11 29 35 25 24 32 30 27 27 23 37 21 21 28 17 18 23 32 31 31 32 22 26 34 20 21 19 11 6 25 48 18 32 11 4 4 10 19 32 32 11 32 14 27 26 19 21 17 23 19 33 18 21 5 4 5 11 19 27 23 17 32 9 9 9 7 31 39 29 24 13 28 8 16 30 9 9 10 13 20 13 8 7 5 5 19 10 7 11 19 10 28 28 15 6 5 16 20 6 11 8 6 8 8 15 24 14 9 13 7 10 32 28 18 9 11 21 7 11 11 5 8 8 7 10 10 26 11 14 14 6 5 7 19 11 11 10 11 10 6 11 19 11 3 4 7 16 11 9 14 7 16 11 5 4 4 7 11 21 15 5 9 6 11 14 6 6 5 4 8 25 22 15 6 24 15 8 6 4 3 3 4 6 6 10 5 7 4 6 11 3 17 17 9 10 6 12 16 5 5 5 6 16 9 10 18 7 14 10 13 6 7 15 8 21 12 5 4 4 2 2 1 6 1 2 3 11 15 30 2 1 3 1 3 4 4 4 2 5 5 4 4 11 9 8 4 9 22 6	Open. Hide. 62 59 51 59 62 59 43 62 62 62 62 56 59 34 27 31 50 56 46 48 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 42 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 41 46 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 52 58 58 54 58 58 58 54 58 54 58 58 41 42 58 58 46 58 58 51 58 53 53 49 51 54 51 58 38 41 58 58 58 52 58 54 50 54 58 58 51 49 45 58 58 58 58 58 53 52 51 58 51 58 39 41 58 52 51 50 51 50 58 58 58 51 50 54 51 52 53 58 51 58 30 32 58 46 37 58 58 46 50 50 58 58 58 51 52 58 49 58 41 58 42 52 50 58 58 50 52 39 52 58 54 51 38 58 51 49 50 50 58 52 42 51 49 58 58 58 53 38 58 58 58 34 38 52 39 54 53 40 46 49 50 44 49 39 49 50 49 45 51 45 54 39 51 54 50 40 37 33 54 54 32 50 49 49 49 29 42 37 52 54 51 51 47 42 52 52 31 33 46 25 42 47 38 45 42 43 45 53 51 51 53 45 52 32 54 14 39 53 32 42 53 33 30 32 37 31 41 51 32 53 40 45 53 32 40 40 38 24 34 32 53 53 32 31 31 45 29 53 34 31 53 40 31 38 32 42 30 40 31 31 31 32 37 32 32 46 32 30 32 30 43 31 51 32 29 33 31 31 31 42 31 31 31 29 46 46 33 25 46 31 27 46 46 32 31 32 27 30 30 38 31 38 34 32 47 37 31 26 46 31 32 38 31 30 31 38 30 27 31 34 30 24 20 46 46 39 32 30 36 43 31 28 30 32 24 21 27 23 28 26 36 33 21 37 21 32 26 42 41 48 32 36 35 24 30 37 26 18 5 10 6 21 11 30 32 27 47 26 24 32 13 25 14 29 16 27 22 34 24 31 24 32 25 37 27 36 27 35 17 21 26 24 35 38 22 37 13 34 24 17 32 19 14 25 17 43 7 31 11 32 13 12 14 32 32 13 9 37 5 33 17 31 22 32 21 34 21 12 8 29 10 34 32 21 13 27 34 31 31 10 16 5 16 34 32 18 18 28 24 10 21 9 12 18 5 16 16 20 13 27 14 47 11 17 9 14 23 14 16 13 15 28 20 20 28 23 24 17 12 4 3 5 16 7 12 17 5 6 14 6 6 6 8 15 34 34 7 7 28 11 10 10 18 7 6 8 3 2 3 12 4 24 27 7 2 13 26 3 1 3 18 23 22 25 12 2 4 5 12 10 8 3 3 1 5 13 8 8 6 4 7 11 5 5 5 3 1 5 2 2 2 3 10 4 5 9 7 15 8 15 8 8 8 12 16 8 8 5 15 4 11 8 17 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_4343829_4345039
seq2: B6Ng01-291M03.b_47_1276 (reverse)

seq1  -----------AAATA---TTATA-ACAATGTACTTCTTAGTTCCT-AAG  34
                 |||||   || || |||||| |||||| ||||||| |||
seq2  AAATATTATTTAAATAGACTTTTAGACAATG-ACTTCTCAGTTCCTAAAG  49

seq1  ATGG-CATTTAAAGATGTTCAATAGAAATTTTTATCCAGGATTTATTGTC  83
      |||| |||||||||||| ||||||||||||||||| |  |||||| ||||
seq2  ATGGCCATTTAAAGATG-TCAATAGAAATTTTTATTCCAGATTTA-TGTC  97

seq1  CTTACTAGTTAAAAGAT-ACATATTGCACTGTGAACTA--GGGATACAGT  130
      |||||||| |||| ||| ||||||||||||||||||||  ||||||||||
seq2  CTTACTAG-TAAAGGATAACATATTGCACTGTGAACTAAGGGGATACAGT  146

seq1  GTTGCT-GAGCAAGA-GCAG-ATAGGTCCCTTACTTTAGAGCAGCATAC-  176
      |||||| |||||||| |||| |||||||||||||||||||||||||||| 
seq2  GTTGCTGGAGCAAGAGGCAGAATAGGTCCCTTACTTTAGAGCAGCATACA  196

seq1  AGCCTAACGAAGAAGCTAAGAATTTATGCAATGAGCATATACTCTAGCAA  226
      ||||||||||||||||||  | ||||||||||||||||||||||||||||
seq2  AGCCTAACGAAGAAGCTAGAATTTTATGCAATGAGCATATACTCTAGCAA  246

seq1  CAGCCAATAACTATGAATCAAAGCCACAATGATGTACAGAACAGATAAAT  276
      |||||||||||||||||||||||||||||||||||||||||||||| |||
seq2  CAGCCAATAACTATGAATCAAAGCCACAATGATGTACAGAACAGAT-AAT  295

seq1  AAAAAGAAAGATTTGAGCTACTAGTTGTGGGAGGAAGAGAAGCCTTTCTT  326
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGAAAGATTTGAGCTACTAGTTGTGGGAGGAAGAGAAGCCTTTCTT  345

seq1  TAAGGAAGTAATGGCTTACTACAGCATCTGCAGTAACAGCTACAGATTAG  376
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGAAGTAATGGCTTACTACAGCATCTGCAGTAACAGCTACAGATTAG  395

seq1  TACTGGAAATAAAGAGGATACAAGTTGGAAGAAAGGAGAAACACATTCAA  426
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGGAAATAAAGAGGATACAAGTTGGAAGAAAGGAGAAACACATTCAA  445

seq1  AGACCTGGGTGGGGGTGGGGCAGACTGTACTGAATGAGCAGGAGGAGACA  476
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCTGGGTGGGGGTGGGGCAGACTGTACTGAATGAGCAGGAGGAGACA  495

seq1  GGTGGCCACTCAATATGGAGTGGATGAAACAAAGTCCAAAGTGTTGAAGA  526
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCCACTCAATATGGAGTGGATGAAACAAAGTCCAAAGTGTTGAAGA  545

seq1  AATGACCAAAAAAGCTCTGCCAGAGACAGAGCGCATTCCTACCTTGATGC  576
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGACCAAAAAAGCTCTGCCAGAGACAGAGCGCATTCCTACCTTGATGC  595

seq1  CAGCGTGTCACATGGCGATCCTTTTCTCTTATGAGAGTCTGGGTTTGCAG  626
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCGTGTCACATGGCGATCCTTTTCTCTTATGAGAGTCTGGGTTTGCAG  645

seq1  GGTCTGATGAACTGTCCCCAAGGCCACTCATGTTGATGAACTTCACACCT  676
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTGATGAACTGTCCCCAAGGCCACTCATGTTGATGAACTTCACACCT  695

seq1  AAATGGGGAGGGTGAGAAAAATAAATCTCTCATGACCTTTCTAACCAAAT  726
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGGGGAGGGTGAGAAAAATAAATCTCTCATGACCTTTCTAACCAAAT  745

seq1  GAGAGTAGGGGAAGCTCCCTTGTTATTTCTAAACATCAGAAAACAAAACA  776
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGTAGGGGAAGCTCCCTTGTTATTTCTAAACATCAGAAAACAAAACA  795

seq1  AAACAACCCCAACAAAACTTGTAAACAGTGACGAGGTGGCCGCAGCCATC  826
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAACCCCAACAAAACTTGTAAACAGTGACGAGGTGGCCGCAGCCATC  845

seq1  ACAGAAGCCCCGGCCTCCAAGGAGACCACAGGGACACCAGCTACTTGTTA  876
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAAGCCCCGGCCTCCAAGGAGACCACAGGGACACCAGCTACTTGTTA  895

seq1  CTATGCTTACTTTTAAGCCAGTGAAACAAAATTAACAACTCCCCATGAAA  926
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATGCTTACTTTTAAGCCAGTGAAACAAAATTAACAACTCCCCATGAAA  945

seq1  TGATTGATATCAATCAGAATAAAGATTTTCTTGGAAAAATTAAGTAGAAA  976
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGATATCAATCAGAATAAAGATTTTCTTGGAAAAATTAAGTAGAAA  995

seq1  TATTTTTACCAAGAGAAAAATCACTTGCATGTATAAATGTAAAAACTGGA  1026
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTTACCAAGAGAAAAATCACTTGCATGTATAAATGTAAAAACTGGA  1045

seq1  CTCTGAAAAATTTTAGTATTATTATTCAGATTCAAAATTATTATGTAGAC  1076
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGAAAAATTTTAGTATTATTATTCAGATTCAAAATTATTATGTAGAC  1095

seq1  CTTACTTTGTAAAAAGGCTTAAAACAAGTTTATTTGTGAATTATCCTGAG  1126
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACTTTGTAAAAAGGCTTAAAACAAGTTTATTTGTGAATTATCCTGAG  1145

seq1  AGAGAATGAACAATATCTATGTGATTAAAGTTAAAGTGATAAGCTTGATT  1176
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAATGAACAATATCTATGTGATTAAAGTTAAAGTGATAAGCTTGATT  1195

seq1  TGGAGTTTTGAATTGTACTTTTCCACTCTGAATTC  1211
      |||||||||||||||||||||||||||||||||||
seq2  TGGAGTTTTGAATTGTACTTTTCCACTCTGAATTC  1230

seq1: chr12_4289499_4290619
seq2: B6Ng01-291M03.g_67_1171

seq1  GAATTCATCTTTGTTAATAAATGGAGTGTGAAGCCTCAATTTCCACTCTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCTTTGTTAATAAATGGAGTGTGAAGCCTCAATTTCCACTCTT  50

seq1  GACTCCTCCTCTCGTGGTCTGGCCAACTAAAATGCTGCTTCCCAATGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCCTCCTCTCGTGGTCTGGCCAACTAAAATGCTGCTTCCCAATGTGT  100

seq1  CAACAAGACAACCCAGTCTTCTTCGCGGCTGCCTTGAAGTCTTGGGGAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAAGACAACCCAGTCTTCTTCGCGGCTGCCTTGAAGTCTTGGGGAAT  150

seq1  TTCCAGGAATTGGGTCCTGACTTCTGAAAGTTCCAGTGAGAAGGCAGTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGGAATTGGGTCCTGACTTCTGAAAGTTCCAGTGAGAAGGCAGTAA  200

seq1  GTGAAGACCCATGCTTGAGCCCATTAGATGATGGAGAGGATGGAAGGAGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAGACCCATGCTTGAGCCCATTAGATGATGGAGAGGATGGAAGGAGT  250

seq1  CCAGAAGATTCCAGAAGTTTCCTTCACTTTCAAGGTCACACAGTGGTATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAAGATTCCAGAAGTTTCCTTCACTTTCAAGGTCACACAGTGGTATT  300

seq1  ATCATCAATGATTTTTTTTCTAATTTTGAAATCTGATATGTGAAAAAAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCAATGATTTTTTTTCTAATTTTGAAATCTGATATGTGAAAAAAAG  350

seq1  ACTAACAGTCCAAATTTCATGAATTTCAAGTATTACAGTACTAGTCTATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTAACAGTCCAAATTTCATGAATTTCAAGTATTACAGTACTAGTCTATT  400

seq1  TTAGTTAGAAGAACGCTAACCAGGGTTAGCACAGTCGTGGCATGCTTTAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTAGAAGAACGCTAACCAGGGTTAGCACAGTCGTGGCATGCTTTAA  450

seq1  CACCACAGTCTCCTAAATAATATTCCATGGAGACTCATTCTGTGGGGTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACAGTCTCCTAAATAATATTCCATGGAGACTCATTCTGTGGGGTAA  500

seq1  TGTGTATTACTTGAGGAAAGCAATTCTATAATATGGAAAGTTTGGGCAAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTATTACTTGAGGAAAGCAATTCTATAATATGGAAAGTTTGGGCAAT  550

seq1  TCTAGTTAAATAAATATGAATTGGCTTCTCTAATTTAAAAGAAGCTGCAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGTTAAATAAATATGAATTGGCTTCTCTAATTTAAAAGAAGCTGCAA  600

seq1  ACTTTCATAGCCAAGTACATTTCATCAGGAAATGATGGACATGCAGTTGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTCATAGCCAAGTACATTTCATCAGGAAATGATGGACATGCAGTTGT  650

seq1  TTAGGGTACTTTGAAACAGAATCTTTTCTTTTTATAACACTAATAGTCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGGTACTTTGAAACAGAATCTTTTCTTTTTATAACACTAATAGTCAA  700

seq1  GAGAAAGATTTGAAAAACATGCTCTGACCCAATACTATATTTCTGAGTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAGATTTGAAAAACATGCTCTGACCCAATACTATATTTCTGAGTGT  750

seq1  TGTTATAGGTGCTCTGGATAGGAACACAAACCACTCTCCTCGCCCCCTAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTATAGGTGCTCTGGATAGGAACACAAACCACTCTCCTCGCCCCCTAA  800

seq1  TCTGTAACAATTACAAAAGGAGGGGCTATACTACTTTAGAACTATTCAAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTAACAATTACAAAAGGAGGGGCTATACTACTTTAGAACTATTCAAG  850

seq1  ATCGGGGCATGCCTGGAAGCCTAGCACTTGGGAAGTGAAGGTAGGAGGGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGGGGCATGCCTGGAAGCCTAGCACTTGGGAAGTGAAGGTAGGAGGGT  900

seq1  CAGGAGTTCACAGTCATCCGCAGCTACGAAGCGAGTTTGAGACACTCT-G  949
      ||||||||||||||||||||||||||||||||||| |||||||||||| |
seq2  CAGGAGTTCACAGTCATCCGCAGCTACGAAGCGAG-TTGAGACACTCTGG  949

seq1  GAATACATCAGACTCAGTCTCAAAGAAAATGCATTCTTATGACTAAAGGT  999
      ||||||||||||||||||||| |||||||||||||| |||||||||||||
seq2  GAATACATCAGACTCAGTCTC-AAGAAAATGCATTC-TATGACTAAAGGT  997

seq1  AACTGCTTCATGGTTAGAGTGGCATAGTGAAAAGATGTTTCATTCTTTTT  1049
      ||||||||||||| |||||| |||||||||||||||| ||||       |
seq2  AACTGCTTCATGG-TAGAGT-GCATAGTGAAAAGATG-TTCA-------T  1037

seq1  TTTTTTTTTTTTTTTTTTTGAGACAGGGTTTCTCTGTGTAGCCCTGGCTG  1099
        || ||| ||| ||||||||||   | ||||||||||||||    ||||
seq2  CGTTCTTTCTTTCTTTTTTGAGAACAGATTTCTCTGTGTAGC---TGCTG  1084

seq1  TCCTGGAACTCACTCTGTAGAC  1121
      ||||||||||||||| ||||||
seq2  TCCTGGAACTCACTC-GTAGAC  1105

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information