MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-315L05
Chromosome	12 (Build37)
Map Location	3,050,044 - 3,051,170
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668260, LOC668262
Downstream gene	LOC668267, LOC668270, EG668274, LOC100041946, 1700012B15Rik, Rab10, Kif3c, LOC100043040, Asxl2, LOC627245, Dtnb, LOC668197, Dnmt3a, LOC668289, Pomc1, C030014M07Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668260 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC668262 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC668267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC668270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	EG668274 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668274 MGI:3644455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins

name	1700012B15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74173 MGI:1921423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 12 ESTs

name	Rab10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19325 MGI:105066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16570 MGI:107979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043040 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Asxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75302 MGI:1922552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627245 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 156 ESTs, 12 Proteins pseudo : _no_value

name	Dtnb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13528 MGI:1203728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 7 Proteins pseudo : _no_value

name	Dnmt3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13435 MGI:1261827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 13 Proteins pseudo : _no_value

name	Pomc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18976 MGI:97742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030014M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668212 MGI:2444851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262772 GeneID:100041946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 2 Proteins product : similar to 1700012B15Rik protein transcript_id : XM_001477246.1

name	Rab10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352796 GeneID:19325 MGI:105066
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB10, member RAS oncogene family transcript_id : NM_016676.4

name	Kif3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781816 GeneID:16570 MGI:107979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 3C transcript_id : NM_008445.2

name	LOC100043040 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262826 GeneID:100043040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : hypothetical protein LOC100043040 transcript_id : XM_001480016.1

name	Asxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801200 GeneID:75302 MGI:1922552
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : additional sex combs like 2 (Drosophila) transcript_id : NM_172421.2

name	Dtnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681234 GeneID:13528 MGI:1203728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrobrevin, beta transcript_id : NM_007886.1

name	Dnmt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145580 GeneID:13435 MGI:1261827
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3A transcript_id : NM_007872.4

name	Dnmt3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110224481 GeneID:13435 MGI:1261827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA methyltransferase 3A transcript_id : NM_153743.3

name	Pomc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346465 GeneID:18976 MGI:97742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pro-opiomelanocortin-alpha transcript_id : NM_008895.3

name	C030014M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723101 GeneID:668212 MGI:2444851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030014M07 gene transcript_id : NM_001082483.1

name	LOC100041946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262773 GeneID:100041946
definition	codon_start : 1 product : similar to 1700012B15Rik protein protein_id : XP_001477296.1

name	Rab10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710086 CCDS:CCDS25782.1 GeneID:19325 MGI:105066
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB10, member RAS oncogene family protein_id : NP_057885.1

name	Kif3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781817 CCDS:CCDS25783.1 GeneID:16570 MGI:107979
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : N-4 kinesin product : kinesin family member 3C protein_id : NP_032471.2

name	LOC100043040 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262827 GeneID:100043040
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480066.1

name	Asxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369555 GeneID:75302 MGI:1922552
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : polycomb group protein ASXH2 homolog protein_id : NP_766009.1

name	Dtnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681235 GeneID:13528 MGI:1203728
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dystrobrevin, beta protein_id : NP_031912.1

name	Dnmt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681209 GeneID:13435 MGI:1261827
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0000791 - euchromatin [Evidence ISS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS] [Evidence IDA]; GO:0006349 - imprinting [Evidence IMP] [Evidence ISS]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : DNA methyltransferase 3A isoform 1 protein_id : NP_031898.1

name	Dnmt3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24371231 CCDS:CCDS25784.1 GeneID:13435 MGI:1261827
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0000791 - euchromatin [Evidence ISS]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003886 - DNA (cytosine-5-)-methyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006306 - DNA methylation [Evidence ISS] [Evidence IDA]; GO:0006349 - imprinting [Evidence IMP] [Evidence ISS]; GO:0006346 - methylation-dependent chromatin silencing [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : DNA methyltransferase 3A isoform 2 protein_id : NP_714965.1

name	Pomc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679415 CCDS:CCDS25785.1 GeneID:18976 MGI:97742
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IDA] GO_process : GO:0008217 - blood pressure regulation [Evidence IGI]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : adrenal corticotropic hormone; alpha-melanocyte stimulating hormone; beta-melanocyte stimulating hormone; gamma-melanocyte stimulating hormone product : pro-opiomelanocortin-alpha protein_id : NP_032921.1

name	C030014M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723102 GeneID:668212 MGI:2444851
definition	codon_start : 1 product : hypothetical protein LOC668212 protein_id : NP_001075952.1

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 1 pseudo : _no_value

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 2 pseudo : _no_value

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 3 pseudo : _no_value

name	LOC668260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668260
definition	number : 4 pseudo : _no_value

name	LOC668262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668262
definition	number : 1 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 1 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 2 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 3 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 4 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 5 pseudo : _no_value

name	LOC668267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668267
definition	number : 6 pseudo : _no_value

name	EG668274 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668274
definition	number : 2 pseudo : _no_value

name	EG668274 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668274
definition	number : 1 pseudo : _no_value

name	LOC668270 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262771 GeneID:668270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to mKIAA1116 protein pseudo : _no_value transcript_id : XR_033129.1

name	1700012B15Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262825 GeneID:74173 MGI:1921423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : RIKEN cDNA 1700012B15 gene transcript_id : XR_035415.1

name	LOC627245 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262828 GeneID:627245
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 156 ESTs, 12 Proteins product : similar to Odc1 protein pseudo : _no_value transcript_id : XR_034503.1

name	LOC668197 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262829 GeneID:668197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 7 Proteins product : similar to ribosomal protein S26 pseudo : _no_value transcript_id : XR_034504.1

name	LOC668289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262830 GeneID:668289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 51 ESTs, 13 Proteins product : similar to peptidylprolyl isomerase H (cyclophilin H) pseudo : _no_value transcript_id : XR_034506.1

clone name	MSMg01-528O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051C02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319N09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-315L05.b	B6Ng01-315L05.g
ACC	GA106277	GA106278
length	449	1,149
definition	B6Ng01-315L05.b	B6Ng01-315L05.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	agaacttttcagctgggggaacgagagtaccagtgagtacagctttacga ggtaagcctggccttgaactttctaaggaaattcaagacagtctatcaga agtaaagtggaaaatgtttggccttgaattttttctaatgttagaagccc ttttgttccttttcacatgttatcaagtggttaaggcagggcggattctg gatgaaattcagggcaatctatcagaagtaaagcggggagagagagtagg agcaaagagaaaatatggtgcacaaaataagtatacaggcctttccaagg gtcttgaacccgaggaaaagttaaggttaggtaggaatacctggagagag attagaagaaaaagaggaaaaagggaaaagaagaaagatcaattagcgga ggtctctaggaaaaggagcctgtgctcatcgctggatgggctcggggag	gaattcagcgctgagtttgttctctgacatcacattctacctacctctcc atgagatgaggctttgtctcactttaggaaatgcagaattcaatacatca gaatcttgctgatctacatggctgaaattcacaccactgcctcactgaga acagccacactggaaggtttcagggtgtgttgaagtagtccagcatgtca gtgtaacctgcaaggtgcctggcgacattaggaacagaaatctggagcat tcctccacagcagttttcactatgatcttcaaagtctttttttttttttt ttttacagaaatactatgggttcacagatgcacatacacacacaaacatg aagaccagaggacttcatgggaggattgttctctaccatgtgcattccaa ggaagaaattcaggtttttaagctgggcagcaaggatgaatacctgctaa cccaagccatcagctgatcatctaaagcaaagaatttcataagctctgta actgtatttatgttctttctctgtctctctgtctctctctgtctctctca tctctctcttttgtgtgtgtgtgtgtgtgtgtgttttattctcattgtgc acattttcccacaccaagaatcacgtgagaattaatgaaaatacataaga aatggaacccaaggaggcaccttcggggaaggctggaggttagagtgacg taaaagcccctaaggtgactctccttttgttgtacgttacacctcagata taattgggtcctttattgtatttttctttccctatagccctgcagactag aatggaacctagggcattgtgcatgttaggcaaatactgtaaactttaat cacatcccaggtctagaaacccatttcatctacaattatttacagggcag gtggaatcaagacactcagctgagaacactgctgaaaatgtggccaatct caagacttggttgtcagatggtcgaacaaaaatgctttccaattctggga attgttttgcatgccctggagaagaaaaataagacacttgtgttctaatg cccataagtcaggatttagactgttaggtcttgacttgattataatttca cagttgccaagtgaaaagtccaggataattggtaatatttcggtataca
quality values	Open. Hide. 25 47 62 56 56 62 62 62 62 32 20 54 62 62 62 49 62 62 62 59 43 59 62 62 62 54 62 62 59 54 62 59 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 45 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 16 25 13	Open. Hide. 62 49 31 41 62 47 38 56 62 35 45 31 28 20 21 44 45 62 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 54 35 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 59 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 43 51 35 28 48 50 51 59 50 43 48 45 56 56 62 62 59 59 59 51 59 51 45 43 50 56 56 39 56 45 51 43 56 37 50 39 51 39 50 39 50 56 62 56 62 59 59 59 39 59 59 56 43 30 59 51 56 59 59 59 59 56 39 51 59 59 56 59 56 56 44 47 56 56 51 56 56 50 56 50 51 56 56 51 56 56 50 50 56 56 62 62 62 44 56 56 56 62 56 56 31 56 56 56 54 62 56 51 38 62 56 56 56 56 62 56 62 56 62 62 62 62 62 56 56 51 56 56 56 56 62 47 44 56 62 56 56 56 62 56 56 56 56 39 56 56 62 62 54 47 62 56 62 62 56 56 56 47 35 50 52 52 47 44 52 43 48 52 40 43 52 62 62 62 62 52 46 35 52 46 46 62 52 52 46 52 52 52 37 52 52 46 52 52 47 47 46 54 52 52 42 48 46 52 54 54 54 58 54 54 58 54 58 58 58 52 46 52 54 52 58 52 54 48 39 47 54 52 54 52 58 47 49 43 58 52 58 52 58 52 52 52 52 41 52 52 52 52 52 54 54 41 41 58 58 58 58 53 58 40 58 51 58 50 58 50 58 47 58 49 58 34 50 34 41 34 58 47 58 48 41 47 50 46 34 33 41 19 23 28 50 50 54 24 46 30 28 29 20 44 58 54 44 43 41 43 31 52 39 53 47 27 51 50 58 49 37 53 33 39 48 51 58 47 25 58 40 47 54 34 49 33 58 54 50 51 50 50 40 43 31 50 35 51 40 58 58 50 41 58 58 49 40 43 58 51 32 39 50 58 28 19 46 32 26 40 52 42 51 37 18 49 50 49 29 22 11 34 27 49 54 50 38 13 34 21 42 44 24 51 50 29 49 30 34 32 45 40 54 54 49 17 38 53 51 51 31 33 12 14 54 19 49 41 32 37 43 37 34 52 40 54 36 33 37 33 35 40 29 14 4 8 28 40 26 30 30 10 9 6 5 6 10 46 24 40 33 33 45 23 51 34 53 53 31 28 21 31 47 32 19 21 42 51 16 32 33 51 46 46 28 39 31 51 26 16 46 31 31 31 30 31 19 31 23 14 14 23 29 31 13 43 24 33 30 6 27 31 20 27 31 38 31 15 31 25 37 10 46 46 19 31 30 25 27 26 31 32 23 32 11 9 23 28 24 31 35 30 46 32 19 29 32 26 30 15 31 41 23 29 32 39 31 23 14 11 31 21 30 22 37 27 46 14 19 11 27 13 31 30 21 15 16 37 29 24 39 35 13 26 41 28 32 22 32 31 29 22 29 11 25 7 26 9 20 34 24 9 11 6 21 48 31 27 20 22 16 17 31 26 19 9 11 25 11 14 5 31 17 13 22 32 31 22 13 22 21 16 17 6 4 15 14 12 17 19 27 34 34 14 22 7 6 11 34 21 5 19 31 5 6 9 11 14 31 14 19 22 15 12 22 14 10 10 32 25 4 14 25 18 12 21 7 31 4 10 21 9 38 8 27 8 5 9 30 32 26 20 8 15 27 24 30 5 14 10 8 11 6 11 8 8 13 29 16 17 15 9 6 8 13 47 40 16 21 27 6 6 15 13 16 10 17 9 7 4 5 10 11 5 14 30 28 32 12 23 7 20 10 19 4 6 10 19 9 11 7 6 1 5 4 4 4 2 2 3 4 1 2 4 3 2 2 3 2 2 4 5 7 5 4 11 23 21 13 7 9 17 22 5 9 12 10 11 3 6 5 4 3 4 4 8 9 9 11 3 7 7 22 5 8 6 5 13 3 4 12 22 8 8 8 16 8 15 4 5 5 15 5 5 29 28 3 1 2 4 4 4 9 6 4 6 11 13 9 5 15 9 19 7 4 4 1 2 5 4 7 13 10 3 5 1 5 11 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_3050044_3051170
seq2: B6Ng01-315L05.g_68_1216 (reverse)

seq1  TGTATAC-------------ATTATCCTGGATTTTTCTACTGGCACTTGT  37
      |||||||             ||||||||||| |||||   |||||  |||
seq2  TGTATACCGAAATATTACCAATTATCCTGGACTTTTCACTTGGCAACTGT  50

seq1  GAAATAATAATTCATGTCAGCCCTTACCAGTCTAATCTGTCCT---TAAT  84
      ||||| |||| ||| ||||   | || ||||||||    ||||   | ||
seq2  GAAATTATAA-TCAAGTCAAGACCTAACAGTCTAA---ATCCTGACTTAT  96

seq1  GTGCATGTGGACCAC-AGTGTCTTATTTT--CTCTCCCAGGC-TGCAAAA  130
      | |||| | || ||| |||||||||||||   |||||  ||| |||||||
seq2  GGGCAT-TAGAACACAAGTGTCTTATTTTTCTTCTCCAGGGCATGCAAAA  145

seq1  C-ATTCCCAGATTTGG-AAGCATTTT--GTCGGCCATTCTTGACAACC-A  175
      | ||||||||| |||| |||||||||   ||| ||||   |||||||| |
seq2  CAATTCCCAGAATTGGAAAGCATTTTTGTTCGACCAT--CTGACAACCAA  193

seq1  GTCTTGAGA-TGGCCACATTGTCAGCAGTG-TCTCAGCTGAGTGTCTTGA  223
      ||||||||| |||||||||| ||||||||| |||||||||||||||||||
seq2  GTCTTGAGATTGGCCACATTTTCAGCAGTGTTCTCAGCTGAGTGTCTTGA  243

seq1  TTCCACCTGCCCTGT-AATAATTGTAGATG-AATGGGTTTCTAGACCTGG  271
      ||||||||||||||| |||||||||||||| |||||||||||||||||||
seq2  TTCCACCTGCCCTGTAAATAATTGTAGATGAAATGGGTTTCTAGACCTGG  293

seq1  GATGTGATTAAAGTTTACAGTATTTGCCTAACATGCACAATGCCCTAGGT  321
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTGATTAAAGTTTACAGTATTTGCCTAACATGCACAATGCCCTAGGT  343

seq1  TCCATTCTAGTCTGCAGGGCTATAGGGAAAGAAAAATACAATAAAGGACC  371
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATTCTAGTCTGCAGGGCTATAGGGAAAGAAAAATACAATAAAGGACC  393

seq1  CAATTATATCTGAGGTGTAACCTACAACAAAAGGAGAGTCACCTTAGGGG  421
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CAATTATATCTGAGGTGTAACGTACAACAAAAGGAGAGTCACCTTAGGGG  443

seq1  CTTTTACGTCACTCTAACCTCCAGCCTTCCCCGAAGGTGCCTCCTTGGGT  471
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTACGTCACTCTAACCTCCAGCCTTCCCCGAAGGTGCCTCCTTGGGT  493

seq1  TCCATTTCTTATGTATTTTCATTAATTCTCACGTGATTCTTGGTGTGGGA  521
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATTTCTTATGTATTTTCATTAATTCTCACGTGATTCTTGGTGTGGGA  543

seq1  AAATGTGCACAATGAGAATAAAACACACACACACACACACACACAAAAGA  571
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTGCACAATGAGAATAAAACACACACACACACACACACACAAAAGA  593

seq1  GAGAGATGAGAGAGACAGAGAGAGACAGAGAGACAGAGAAAGAACATAAA  621
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGATGAGAGAGACAGAGAGAGACAGAGAGACAGAGAAAGAACATAAA  643

seq1  TACAGTTACAGAGCTTATGAAATTCTTTGCTTTAGATGATCAGCTGATGG  671
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGTTACAGAGCTTATGAAATTCTTTGCTTTAGATGATCAGCTGATGG  693

seq1  CTTGGGTTAGCAGGTATTCATCCTTGCTGCCCAGCTTAAAAACCTGAATT  721
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGGTTAGCAGGTATTCATCCTTGCTGCCCAGCTTAAAAACCTGAATT  743

seq1  TCTTCCTTGGAATGCACATGGTAGAGAACAATCCTCCCATGAAGTCCTCT  771
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTTGGAATGCACATGGTAGAGAACAATCCTCCCATGAAGTCCTCT  793

seq1  GGTCTTCATGTTTGTGTGTGTATGTGCATCTGTGAACCCATAGTATTTCT  821
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTCATGTTTGTGTGTGTATGTGCATCTGTGAACCCATAGTATTTCT  843

seq1  GTAAAAAAAAAAAAAAAAAAGACTTTGAAGATCATAGTGAAAACTGCTGT  871
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAAAAAAAAAAAAAAAAGACTTTGAAGATCATAGTGAAAACTGCTGT  893

seq1  GGAGGAATGCTCCAGATTTCTGTTCCTAATGTCGCCAGGCACCTTGCAGG  921
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGAATGCTCCAGATTTCTGTTCCTAATGTCGCCAGGCACCTTGCAGG  943

seq1  TTACACTGACATGCTGGACTACTTCAACACACCCTGAAACCTTCCAGTGT  971
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACACTGACATGCTGGACTACTTCAACACACCCTGAAACCTTCCAGTGT  993

seq1  GGCTGTTCTCAGTGAGGCAGTGGTGTGAATTTCAGCCATGTAGATCAGCA  1021
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGTTCTCAGTGAGGCAGTGGTGTGAATTTCAGCCATGTAGATCAGCA  1043

seq1  AGATTCTGATGTATTGAATTCTGCATTTCCTAAAGTGAGACAAAGCCTCA  1071
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTCTGATGTATTGAATTCTGCATTTCCTAAAGTGAGACAAAGCCTCA  1093

seq1  TCTCATGGAGAGGTAGGTAGAATGTGATGTCAGAGAACAAACTCAGCGCT  1121
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCATGGAGAGGTAGGTAGAATGTGATGTCAGAGAACAAACTCAGCGCT  1143

seq1  GAATTC  1127
      ||||||
seq2  GAATTC  1149

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information