MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-326P18
Chromosome	12 (Build37)
Map Location	19,959,679 - 20,119,375
singlet/doublet	doublet
Overlap gene	EG668600, LOC100042727, LOC673301
Upstream gene	LOC668570, EG668413, LOC671401, EG546524, EG668584, EG544848, EG627871, LOC100042698, LOC629055, EG668588, LOC100042706, EG668594
Downstream gene	EG668605, LOC668614, LOC100042751, LOC100043371, EG668455, LOC100042755, LOC100043377, LOC625810, 1700030C10Rik, 3110053B16Rik, LOC668698, LOC546752, EG629257, Ddef2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG668413 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668413 MGI:3643721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	LOC671401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	EG546524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG668584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668584 MGI:3648979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	EG544848 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG627871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100042698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC629055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins pseudo : _no_value

name	EG668588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG668594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668594 MGI:3645724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG668600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668600 MGI:3643303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	LOC100042727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC673301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 Proteins pseudo : _no_value

name	EG668605 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins pseudo : _no_value

name	LOC668614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100042751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	EG668455 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668455 MGI:3644169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 139 ESTs, 7 Proteins

name	LOC100042755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC100043377 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC625810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	1700030C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69513 MGI:1916763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	3110053B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382686 MGI:1920435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	LOC668698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC546752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins pseudo : _no_value

name	EG629257 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629257 MGI:3643096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Ddef2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211914 MGI:2685438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262879 GeneID:546524 MGI:3647171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG546524 transcript_id : XM_001480466.1

name	EG544848 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392392 GeneID:544848 MGI:3647969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG544848, transcript variant 1 transcript_id : XM_001004780.1

name	EG668588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392464 GeneID:668588 MGI:3648973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668588 transcript_id : XM_001002492.1

name	LOC100042727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262801 GeneID:100042727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Predicted gene, EG245297 transcript_id : XM_001478694.1

name	LOC100043371 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262883 GeneID:100043371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480491.1

name	EG668455 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392403 GeneID:668455 MGI:3644169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 139 ESTs, 7 Proteins product : predicted gene, EG668455 transcript_id : XM_001004798.1

name	LOC100043377 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262885 GeneID:100043377
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001480493.1

name	LOC668698 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262803 GeneID:668698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478806.1

name	EG629257 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82941416 GeneID:629257 MGI:3643096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG629257 transcript_id : XM_894112.1

name	Ddef2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138527 GeneID:211914 MGI:2685438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : development and differentiation enhancing factor 2 transcript_id : NM_001004364.1

name	EG546524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262880 GeneID:546524 MGI:3647171
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480516.1

name	EG544848 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392393 GeneID:544848 MGI:3647969
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2, isoform 1 protein_id : XP_001004780.1

name	EG668588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392465 GeneID:668588 MGI:3648973
definition	codon_start : 1 product : similar to development and differentiation enhancing factor 2 protein_id : XP_001002492.1

name	LOC100042727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262802 GeneID:100042727
definition	codon_start : 1 product : similar to Predicted gene, EG245297 protein_id : XP_001478744.1

name	LOC100043371 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262884 GeneID:100043371
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480541.1

name	EG668455 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392404 GeneID:668455 MGI:3644169
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004798.1

name	LOC100043377 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262886 GeneID:100043377
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480543.1

name	LOC668698 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262804 GeneID:668698
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478856.1

name	EG629257 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82941417 GeneID:629257 MGI:3643096
definition	codon_start : 1 product : similar to NADH dehydrogenase protein_id : XP_899205.1

name	Ddef2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138528 GeneID:211914 MGI:2685438
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : PYK2 C terminus-associated protein product : development and differentiation enhancing factor 2 protein_id : NP_001004364.1

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 1 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 2 pseudo : _no_value

name	LOC668570 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668570
definition	number : 3 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 1 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 2 pseudo : _no_value

name	EG668413 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668413
definition	number : 3 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 1 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 2 pseudo : _no_value

name	LOC671401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671401
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 1 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 2 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 3 pseudo : _no_value

name	EG668584 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668584
definition	number : 4 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 1 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 2 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 3 pseudo : _no_value

name	LOC100042698 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042698
definition	number : 4 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 1 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 2 pseudo : _no_value

name	LOC100042706 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042706
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 3 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 2 pseudo : _no_value

name	EG668594 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668594
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 1 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 2 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 3 pseudo : _no_value

name	EG668600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668600
definition	number : 4 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 1 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 2 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 3 pseudo : _no_value

name	LOC673301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673301
definition	number : 4 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 1 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 2 pseudo : _no_value

name	LOC668614 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668614
definition	number : 3 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 1 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 2 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 3 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 4 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 5 pseudo : _no_value

name	LOC100042751 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042751
definition	number : 6 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 1 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 2 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 3 pseudo : _no_value

name	LOC100042755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042755
definition	number : 4 pseudo : _no_value

name	LOC625810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625810
definition	number : 1 pseudo : _no_value

name	LOC625810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625810
definition	number : 2 pseudo : _no_value

name	LOC625810 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625810
definition	number : 3 pseudo : _no_value

name	3110053B16Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382686
definition	number : 3

name	3110053B16Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382686
definition	number : 2

name	3110053B16Rik (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382686
definition	number : 1

name	EG627871 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94392463 GeneID:627871 MGI:3646076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627871 transcript_id : XR_002310.1

name	LOC629055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262881 GeneID:629055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034711.1

name	EG668605 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262882 GeneID:668605 MGI:3643307
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 30 Proteins product : predicted gene, EG668605 pseudo : _no_value transcript_id : XR_002219.2

name	1700030C10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262887 GeneID:69513 MGI:1916763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 1700030C10 gene transcript_id : XR_035444.1

name	LOC546752 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262888 GeneID:546752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_035702.1

clone name	MSMg01-495C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061A04
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-246A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143C14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-326P18.b	B6Ng01-326P18.g
ACC	GA114650	GA114651
length	941	959
definition	B6Ng01-326P18.b	B6Ng01-326P18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(20,118,852 - 20,119,375)	(19,959,679 - 19,960,629)
sequence	gaattccaattaaagatatgtgccaccatgcctgaccagagggtattttc ttttcttccttccttccttccttccttccttcctttctttctttctttct ttctttctttctttctttctttctttctttctttctttctttctttcttt ctttcttgttttgtttttttgagacagggtttctctgtataaccctggat gtcctggaactcactttttagaccaggctgtcctcgaactcaaatccgcc tgcctctacctcccaagtgctgggattaaaggcatgtgggccttgcccag agagggtattttcttaactagtgattgtgaagcagagcccagcccattgt aggtggtacaaccctgggctagtattctgagttctaaaagaaagaaggtt gagcaagccatggggaacaagtcagtaattaccaaccctttcatggtctc tgtatcagctcctgccttcaggttcctgccctgtttgagtcctgccctca ctgcttttgatgatgaactgttatgtggaaactctgagtgaataaaccct ttcctccccaagttgcttgtggccatggtgtgtcatcagagcaatggaaa ccttaactcagacaacacggatgaagcctacagctcagagggtctactga catgcccatggttatagagccctaggaagggtgcaggatgcaggctaggt gtacctgaccctgaattctagtctccctccctcaatcagagctgaatcaa gtgggctggaaaagggcagtcctgcatagggaagagagtgtatcccaaac acctctgtgccatcaatagtttcacagggtcatctactcccctctcccca ccccccacccctcccaattccctcctccaccccacctgctcacttcctgc catgtttcctaccttcattgttttgtgtccatctgcctgaa	gaattcccattcggtttgtaccgtggtcaattccctatgcaaaacacgtg cctttacccctggcttcttaaggctgtgagaaggagcacacacagaacat gggtaatatcgctagaggtcatggctggtgcgaggtgggagtcccgcact gcagcccaggagagggcgcgccctcgaaccacagcacgtagagaagggaa acacaatgcggcggcccacaggcacgaacatgcctagaacacacatcgcc ctctgtcctgcgggctccgcttccgggctgctgggtcgcggcgagcgtcc cgattggcggccaggcctttgccccgcctcgcctggccggccaccgcccc ctccccagcgcgtcccgcccctctccgcagaaggcaccggggcaagcggc ctgttggcgcgcaattccagctggctgttcgcgctagcatcagggctcga tctagaggacgcggcagccgcagctcctggagcacagcgggcagagctgc gggctgcacgcgcacctgcagccaccgggcgtcccgcggaggctcccgcg ccctgcggcgacttccgcgcccgcgctcccctttgtcaaagtccccaagc ggcggcaggggcggcggcggggtcggagcccgcgccgtgggcgactgagg cggccgcagtccgcgccccggcgccctggcgatgccggaccagatctctg tgtcggaattcctggccgagacccttgaggactacaaggcgcccacggcc tctagcttcaccacgcgcacggcccagtgccggaacaccgtggcggcggt tcgaggaggtgagcggtagctttgcccgcgccgggaggggaggctagggc ctcggggatcccgctaagccctggggcccgggctaggcttccgcggcctg gtgcccgatatccagtggcccttccgcctgccgcccacaccccgggaaaa gtttttggt
quality values	Open. Hide. 58 54 27 39 58 62 33 19 62 62 49 62 62 47 47 42 47 47 41 41 47 47 62 47 44 62 49 47 62 62 44 28 24 28 21 19 16 12 46 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 43 43 43 38 43 54 54 54 54 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 54 62 62 62 62 62 62 62 59 62 59 59 62 59 59 59 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 59 62 59 50 56 56 43 62 59 62 62 62 59 51 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 62 62 62 56 62 56 56 56 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 56 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 52 62 62 52 62 62 62 52 62 54 62 54 54 52 62 62 62 62 62 62 62 49 62 62 48 52 62 62 62 62 62 62 62 62 58 54 54 42 35 54 52 58 58 58 58 58 58 58 58 58 54 58 54 51 52 58 52 54 54 54 54 58 58 58 58 58 42 58 58 58 54 52 54 58 54 54 52 58 34 35 54 54 54 54 58 58 58 54 58 58 54 52 54 52 52 52 52 37 46 54 58 51 54 50 58 25 58 58 52 52 51 42 45 58 58 54 51 37 58 53 51 48 44 49 50 54 58 53 53 53 53 50 40 54 47 47 49 47 51 58 49 58 49 47 37 58 40 39 54 52 50 37 58 51 40 58 51 38 15 58 53 52 49 16 51 50 58 50 49 50 58 54 54 36 22 28 29 47 51 58 41 35 53 50 40 45 39 50 52 53 50 49 49 41 30 49 41 41 50 51 25 50 52 40 25 58 16 35 50 36 49 40 40 28 31 52 52 53 41 53 46 39 42 54 50 50 51 49 47 26 54 54 35 49 37 42 39 38 40 49 42 33 42 32 15 54 40 49 47 33 39 25 39 32 49 51 28 42 45 33 41 33 40 35 33 37 31 31 42 49 53 45 35 31 45 37 34 29 40 32 28 54 40 31 27 28 51 38 31 25 31 35 27 54 36 28 32 31 32 35 35 36 35 22 10 45 32 26 27 32 42 32 40 40 33 21 16 41 13 14 16 9 11 11 41 40 31 28 28 18 12 9 9 16 33 21 23 25 21 8 12 19 18 19 11 25 23 28 30 21 8 12 30 31 28 31 20 20 32 24 10 30 27 31 33 23 16 10 16 38 31 23 20 17 25 20 22 24 25 33 25 22 32 12 15 29 10 42 32 14 10 5 9 31 29 20 10 22 26 31 9 6 25 7 21 30 13	Open. Hide. 34 38 39 47 62 62 62 47 39 56 15 19 7 14 15 22 50 38 28 45 35 56 56 43 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 59 59 59 43 51 56 34 33 40 46 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 59 59 62 62 62 62 59 59 49 59 59 62 54 56 49 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 49 59 62 62 62 62 62 59 59 59 59 59 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 56 54 54 59 62 62 54 59 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 59 62 62 62 56 50 59 59 59 62 62 62 62 62 62 56 56 62 62 62 59 59 62 62 62 62 59 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 56 62 56 62 62 62 62 62 62 62 56 62 56 62 62 62 44 62 62 47 47 62 56 62 62 62 62 62 56 62 54 47 62 62 56 62 62 62 62 62 62 62 62 62 62 56 51 62 56 62 54 51 56 62 56 62 62 62 51 62 62 56 62 47 47 62 62 62 62 62 62 56 47 42 62 62 56 56 47 62 54 62 62 62 62 56 62 56 62 62 62 62 56 62 62 62 62 62 62 62 62 62 54 50 62 49 42 52 62 62 62 52 50 52 54 52 54 49 54 52 52 52 52 52 52 62 62 62 54 62 52 47 38 62 52 54 52 52 52 52 52 52 54 54 54 54 54 54 41 45 41 52 54 35 48 52 48 39 47 52 42 52 52 52 33 54 52 58 58 32 52 52 43 52 52 58 54 54 50 47 58 58 52 47 42 54 52 52 39 52 40 52 47 52 39 34 45 40 39 52 52 42 52 37 46 52 46 37 47 42 50 58 58 49 34 34 40 49 47 23 28 34 37 40 40 46 46 50 37 37 46 42 47 35 40 51 39 52 51 24 6 38 50 31 51 24 35 23 27 28 29 46 52 50 39 50 46 50 50 26 27 46 42 39 39 33 48 42 38 35 50 43 50 52 39 37 16 50 40 51 32 12 39 36 22 39 52 53 50 32 49 52 53 50 39 18 8 28 47 33 39 44 33 41 39 50 40 6 21 13 28 10 28 40 40 40 39 41 41 49 24 38 31 25 28 39 49 39 25 20 35 21 30 28 36 32 37 40 29 50 21 39 34 33 34 53 28 40 33 34 28 25 25 35 32 32 27 41 40 30 39 43 31 38 15 29 19 26 20 23 35 33 47 29 53 53 26 32 21 27 42 24 26 52 37 27 24 32 29 30 32 15 19 33 15 40 9 12 31 16 36 31 31 22 12 27 30 30 10 26 13 28 33 46 45 31 32 45 37 28 32 23 20 30 12 20 24 21 17 43 33 9 19 27 31 27 26 31 16 27 28 19 31 23 29 16 25 32 13 42 22 9 5 11 10 12 9 9 9 8 29 39 27 12 39 30 31 31 22 37 21 16 23 17 6 27 31 31 24 16 30 32 21 29 29 26 9 24 30 15 31 22 12 5 15 28 28 19 18 31 13 11 29 16 32 18 20 27 27 23 31 31 19 8 13 21 29 7 13 7 16 23 19 24 17 22 31 26 18 7 6 10 12 25 9 11 16 12 5 31 34 30 6 6 24 21 10 6 4 11 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_20118852_20119375
seq2: B6Ng01-326P18.b_467_991 (reverse)

seq1  TTCAGGCAGATGGACAC-AAACAATGAAGGTAGGAAACATGGCAGG-AGT  48
      ||||||||||||||||| |||||||||||||||||||||||||||| |||
seq2  TTCAGGCAGATGGACACAAAACAATGAAGGTAGGAAACATGGCAGGAAGT  50

seq1  GAGCAGGTGGGGTGGGAGGAGGGAATTGGGAGGGGGTGGGGGTGGGGAGA  98
      ||||||||||||| |||||||||||||||||||||  |||||||||||||
seq2  GAGCAGGTGGGGT-GGAGGAGGGAATTGGGAGGGGTGGGGGGTGGGGAGA  99

seq1  GGGGAGTAGATGACCCTGTGAAACTATTGATGGCACAGAGGTGTTTGGGA  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGAGTAGATGACCCTGTGAAACTATTGATGGCACAGAGGTGTTTGGGA  149

seq1  TACACTCTCTTCCCTATGCAGGACTGCCCTTTTCCAGCCCACTTGATTCA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACTCTCTTCCCTATGCAGGACTGCCCTTTTCCAGCCCACTTGATTCA  199

seq1  GCTCTGATTGAGGGAGGGAGACTAGAATTCAGGGTCAGGTACACCTAGCC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGATTGAGGGAGGGAGACTAGAATTCAGGGTCAGGTACACCTAGCC  249

seq1  TGCATCCTGCACCCTTCCTAGGGCTCTATAACCATGGGCATGTCAGTAGA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATCCTGCACCCTTCCTAGGGCTCTATAACCATGGGCATGTCAGTAGA  299

seq1  CCCTCTGAGCTGTAGGCTTCATCCGTGTTGTCTGAGTTAAGGTTTCCATT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTGAGCTGTAGGCTTCATCCGTGTTGTCTGAGTTAAGGTTTCCATT  349

seq1  GCTCTGATGACACACCATGGCCACAAGCAACTTGGGGAGGAAAGGGTTTA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTGATGACACACCATGGCCACAAGCAACTTGGGGAGGAAAGGGTTTA  399

seq1  TTCACTCAGAGTTTCCACATAACAGTTCATCATCAAAAGCAGTGAGGGCA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACTCAGAGTTTCCACATAACAGTTCATCATCAAAAGCAGTGAGGGCA  449

seq1  GGACTCAAACAGGGCAGGAACCTGAAGGCAGGAGCTGATACAGAGACCAT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACTCAAACAGGGCAGGAACCTGAAGGCAGGAGCTGATACAGAGACCAT  499

seq1  GAAAGGGTTGGTAATTACTGACTTGT  524
      ||||||||||||||||||||||||||
seq2  GAAAGGGTTGGTAATTACTGACTTGT  525

seq1: chr12_19959679_19960629
seq2: B6Ng01-326P18.g_70_1028

seq1  GAATTCCCATTCGGTTTGTACCGTGGTCAATTCCCTATGCAAAACACGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCATTCGGTTTGTACCGTGGTCAATTCCCTATGCAAAACACGTG  50

seq1  CCTTTACCCCTGGCTTCTTAAGGCTGTGAGAAGGAGCACACACAGAACAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTACCCCTGGCTTCTTAAGGCTGTGAGAAGGAGCACACACAGAACAT  100

seq1  GGGTAATATCGCTAGAGGTCATGGCTGGTGCGAGGTGGGAGTCCCGCACT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTAATATCGCTAGAGGTCATGGCTGGTGCGAGGTGGGAGTCCCGCACT  150

seq1  GCAGCCCAGGAGAGGGCGCGCCCTCGAACCACAGCACGTAGAGAAGGGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCCCAGGAGAGGGCGCGCCCTCGAACCACAGCACGTAGAGAAGGGAA  200

seq1  ACACAATGCGGCGGCCCACAGGCACGAACATGCCTAGAACACACATCGCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAATGCGGCGGCCCACAGGCACGAACATGCCTAGAACACACATCGCC  250

seq1  CTCTGTCCTGCGGGCTCCGCTTCCGGGCTGCTGGGTCGCGGCGAGCGTCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTCCTGCGGGCTCCGCTTCCGGGCTGCTGGGTCGCGGCGAGCGTCC  300

seq1  CGATTGGCGGCCAGGCCTTTGCCCCGCCTCGCCTGGCCGGCCACCGCCCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGATTGGCGGCCAGGCCTTTGCCCCGCCTCGCCTGGCCGGCCACCGCCCC  350

seq1  CTCCCCAGCGCGTCCCGCCCCTCTCCGCAGAAGGCACCGGGGCAAGCGGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCCAGCGCGTCCCGCCCCTCTCCGCAGAAGGCACCGGGGCAAGCGGC  400

seq1  CTGTTGGCGCGCAATTCCAGCTGGCTGTTCGCGCTAGCATCAGGGCTCGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTGGCGCGCAATTCCAGCTGGCTGTTCGCGCTAGCATCAGGGCTCGA  450

seq1  TCTAGAGGACGCGGCAGCCGCAGCTCCTGGAGCACAGCGGGCAGAGCTGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGAGGACGCGGCAGCCGCAGCTCCTGGAGCACAGCGGGCAGAGCTGC  500

seq1  GGGCTGCACGCGCACCTGCAGCCACCGGGCGTCCCGCGGAGGCTCCCGCG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTGCACGCGCACCTGCAGCCACCGGGCGTCCCGCGGAGGCTCCCGCG  550

seq1  CCCTGCGGCGACTTCCGCGCCCGCGCTCCCCTTTGTCAAAGTCCCCAAGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGCGGCGACTTCCGCGCCCGCGCTCCCCTTTGTCAAAGTCCCCAAGC  600

seq1  GGCGGCAGGGGCGGCGGCGGGGTCGGAGCCCGCGCCGTGGGCGACTGAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGGCAGGGGCGGCGGCGGGGTCGGAGCCCGCGCCGTGGGCGACTGAGG  650

seq1  CGGCCGCAGTCCGCGCCCCGGCGCCCTGGCGATGCCGGACCAGATCTCTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCCGCAGTCCGCGCCCCGGCGCCCTGGCGATGCCGGACCAGATCTCTG  700

seq1  TGTCGGAATTCCTGGCCGAGACCCTTGAGGACTACAAGGCGCCCACGGCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCGGAATTCCTGGCCGAGACCCTTGAGGACTACAAGGCGCCCACGGCC  750

seq1  TCTAGCTTCACCACGCGCACGGCCCAGTGCCGGAACACCGTGGCGGCGG-  799
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TCTAGCTTCACCACGCGCACGGCCCAGTGCCGGAACACCGTGGCGGCGGT  800

seq1  TCGAGGAGGTGAGCGGTAGCTTTGCCCGCGCCGGGA-GGGAGGCTAGGGC  848
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TCGAGGAGGTGAGCGGTAGCTTTGCCCGCGCCGGGAGGGGAGGCTAGGGC  850

seq1  CTCGGGGATCGCGCTGAGCCCTGGGGCCC-GGCTAGGCTTCCGC-GCCTG  896
      |||||||||| |||| ||||||||||||| |||||||||||||| |||||
seq2  CTCGGGGATCCCGCTAAGCCCTGGGGCCCGGGCTAGGCTTCCGCGGCCTG  900

seq1  GTGCCCGATATCCAGTG--CCCTCCGCCTG-CGCCCACA-CCCGGGAAAA  942
      |||||||||||||||||  || |||||||| |||||||| ||||||||||
seq2  GTGCCCGATATCCAGTGGCCCTTCCGCCTGCCGCCCACACCCCGGGAAAA  950

seq1  GTTTCTGGT  951
      |||| ||||
seq2  GTTTTTGGT  959

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information