MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-328D13
Chromosome	12 (Build37)
Map Location	104,475,195 - 104,633,666
singlet/doublet	doublet
Overlap gene	Prima1, EG544888, Asb2, Otub2
Upstream gene	Slc24a4, Rin3, Lgmn, Golga5, Chga, Itpk1, Moap1, D230037D09Rik, 5730410I19Rik, Btbd7, EG634678, Cox8c, 9030205A07Rik, LOC667269
Downstream gene	Ddx24, D12Ertd647e, Ifi27, 1810023F06Rik, 8430415E04Rik, Serpina10, Serpina6, Gm46, Serpina1f, EG435316, Serpina1b, Serpina1d, LOC667951, LOC628801, Serpina1a, LOC667954, Serpina1c, Serpina1e, Serpina11, Serpina9, Serpina12, Serpina4-ps1, Serpina5, Serpina3a, Serpina3b, Serpina3c, LOC435318, LOC628883, Serpina3f, LOC667997, Serpina3g, Serpina3h, EG628900, EG238395, Serpina3k, EG628916, Serpina3m
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc24a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238384 MGI:2447362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rin3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217835 MGI:2385708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19141 MGI:1330838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golga5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27277 MGI:1351475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12652 MGI:88394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217837 MGI:2446159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Moap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64113 MGI:1915555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230037D09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320351 MGI:2443862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730410I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66622 MGI:1913872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btbd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238386 MGI:1917858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG634678 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:634678 MGI:3646528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 1359 ESTs, 8 Proteins pseudo : _no_value

name	Cox8c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75483 MGI:1922733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030205A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217843 MGI:2684729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 147 ESTs, 4 Proteins pseudo : _no_value

name	Prima1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170952 MGI:1926097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544888 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544888 MGI:3647570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	Asb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65256 MGI:1929743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otub2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68149 MGI:1915399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27225 MGI:1351337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D12Ertd647e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52668 MGI:1277180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Ifi27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76933 MGI:1924183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810023F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217845 MGI:1916390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430415E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74521 MGI:1921771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217847 MGI:2667725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12401 MGI:88278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194604 MGI:2684892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Serpina1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68348 MGI:1915598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG435316 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435316 MGI:3648024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Serpina1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20701 MGI:891970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20703 MGI:891968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 262 ESTs, 50 Proteins pseudo : _no_value

name	LOC628801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Serpina1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20700 MGI:891971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Serpina1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20702 MGI:891969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20704 MGI:891967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380780 MGI:2685741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71907 MGI:1919157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68054 MGI:1915304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina4-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321018 MGI:2448363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Serpina5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268591 MGI:107817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74069 MGI:1921319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Serpina3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271047 MGI:2182835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16625 MGI:102848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins pseudo : _no_value

name	LOC628883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Serpina3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238393 MGI:2182838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins pseudo : _no_value

name	Serpina3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20715 MGI:105046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546546 MGI:2182839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628900 MGI:3643496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	EG238395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238395 MGI:3645874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 36 Proteins

name	Serpina3k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20714 MGI:98377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628916 MGI:3648113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins pseudo : _no_value

name	Serpina3m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20717 MGI:98378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc24a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130080 GeneID:238384 MGI:2447362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 transcript_id : NM_172152.2

name	Rin3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801790 GeneID:217835 MGI:2385708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras and Rab interactor 3 transcript_id : NM_177620.3

name	Lgmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130389 GeneID:19141 MGI:1330838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : legumain transcript_id : NM_011175.2

name	Golga5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560499 GeneID:27277 MGI:1351475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi autoantigen, golgin subfamily a, 5 transcript_id : NM_013747.2

name	Chga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680931 GeneID:12652 MGI:88394
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chromogranin A transcript_id : NM_007693.1

name	Itpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343814 GeneID:217837 MGI:2446159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,3,4-triphosphate 5/6 kinase transcript_id : NM_172584.2

name	Moap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376503 GeneID:64113 MGI:1915555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : modulator of apoptosis 1 transcript_id : NM_022323.4

name	D230037D09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342894 GeneID:320351 MGI:2443862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230037D09 gene transcript_id : NM_177140.2

name	5730410I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354569 GeneID:66622 MGI:1913872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730410I19 gene transcript_id : NM_025666.2

name	Btbd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044480 GeneID:238386 MGI:1917858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 7 transcript_id : NM_172806.2

name	Cox8c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794656 GeneID:75483 MGI:1922733
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIIIc transcript_id : NM_001039049.1

name	9030205A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486611 GeneID:217843 MGI:2684729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030205A07 Gene transcript_id : NM_001081017.1

name	Prima1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872179 GeneID:170952 MGI:1926097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich membrane anchor 1 transcript_id : NM_133364.2

name	EG544888 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393107 GeneID:544888 MGI:3647570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : predicted gene, EG544888 transcript_id : XM_619025.3

name	Asb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956121 GeneID:65256 MGI:1929743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 2 transcript_id : NM_023049.1

name	Otub2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801789 GeneID:68149 MGI:1915399
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain, ubiquitin aldehyde binding 2 transcript_id : NM_026580.2

name	Ddx24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328252 GeneID:27225 MGI:1351337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 transcript_id : NM_020494.2

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732710 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_026790.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732716 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194066.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732718 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194067.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732720 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194068.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732722 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194069.1

name	Ifi27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:44771123 GeneID:76933 MGI:1924183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon, alpha-inducible protein 27 transcript_id : NM_029803.1

name	1810023F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703895 GeneID:217845 MGI:1916390
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810023F06 gene transcript_id : NM_145449.1

name	8430415E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803539 GeneID:74521 MGI:1921771
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430415E04 gene transcript_id : NM_028980.2

name	Serpina10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892606 GeneID:217847 MGI:2667725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 transcript_id : NM_144834.3

name	Serpina6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131216 GeneID:12401 MGI:88278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 6 transcript_id : NM_007618.2

name	Gm46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393116 GeneID:194604 MGI:2684892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 46, (NCBI) transcript_id : XM_112098.3

name	Serpina1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404228 GeneID:68348 MGI:1915598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1f transcript_id : NM_026687.1

name	Serpina1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102380 GeneID:20701 MGI:891970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) preptidase inhibitor, clade A, member 1b transcript_id : NM_009244.4

name	Serpina1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102381 GeneID:20703 MGI:891968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1d transcript_id : NM_009246.3

name	Serpina1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102382 GeneID:20700 MGI:891971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1a transcript_id : NM_009243.3

name	Serpina1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881808 GeneID:20702 MGI:891969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1c transcript_id : NM_009245.2

name	Serpina1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881810 GeneID:20704 MGI:891967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1e transcript_id : NM_009247.2

name	Serpina11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556295 GeneID:380780 MGI:2685741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 transcript_id : NM_199314.1

name	Serpina9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130410 GeneID:71907 MGI:1919157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 transcript_id : NM_027997.2

name	Serpina12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129832 GeneID:68054 MGI:1915304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 transcript_id : NM_026535.2

name	Serpina5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385329 GeneID:268591 MGI:107817
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 5 transcript_id : NM_172953.2

name	Serpina3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393057 GeneID:74069 MGI:1921319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : serine (or cysteine) peptidase inhibitor, clade A, member 3A, transcript variant 1 transcript_id : XM_282560.6

name	Serpina3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387237 GeneID:271047 MGI:2182835
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3B transcript_id : NM_173024.2

name	Serpina3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130776 GeneID:16625 MGI:102848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3C transcript_id : NM_008458.2

name	Serpina3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368572 GeneID:238393 MGI:2182838
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3F transcript_id : NM_001033335.2

name	Serpina3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476055 GeneID:20715 MGI:105046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3G transcript_id : NM_009251.1

name	Serpina3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517725 GeneID:546546 MGI:2182839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3H transcript_id : NM_001034870.2

name	EG628900 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263490 GeneID:628900 MGI:3643496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : predicted gene, EG628900 transcript_id : XM_893705.2

name	EG238395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393122 GeneID:238395 MGI:3645874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 36 Proteins product : predicted gene, EG238395 transcript_id : XM_138240.6

name	Serpina3k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859635 GeneID:20714 MGI:98377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3K transcript_id : NM_011458.1

name	Serpina3m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678094 GeneID:20717 MGI:98378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3M transcript_id : NM_009253.1

name	Slc24a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024351 CCDS:CCDS26117.1 GeneID:238384 MGI:2447362
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008273 - calcium, potassium:sodium antiporter activity [Evidence ISS]; GO:0005432 - calcium:sodium antiporter activity [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : K-dependent Na/Ca exchanger NCKX4 product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 4 protein_id : NP_742164.1

name	Rin3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244002 CCDS:CCDS26118.1 GeneID:217835 MGI:2385708
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Ras and Rab interactor 3 protein_id : NP_808288.1

name	Lgmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242187 CCDS:CCDS26119.1 GeneID:19141 MGI:1330838
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0001509 - legumain activity [Evidence IMP]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0040015 - negative regulation of body size [Evidence IMP]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 note : protease, cysteine, 1; preprolegumain product : legumain protein_id : NP_035305.1

name	Golga5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305095 GeneID:27277 MGI:1351475
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence ISS] GO_process : GO:0007030 - Golgi organization and biogenesis [Evidence ISS]; GO:0048193 - Golgi vesicle transport [Evidence ISS] codon_start : 1 product : golgi autoantigen, golgin subfamily a, 5 protein_id : NP_038775.1

name	Chga (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680932 CCDS:CCDS26120.1 GeneID:12652 MGI:88394
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : chromogranin A protein_id : NP_031719.1

name	Itpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789389 CCDS:CCDS26121.1 GeneID:217837 MGI:2446159
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0047325 - inositol tetrakisphosphate 1-kinase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : inositol 1,3,4-triphosphate 5/6 kinase protein_id : NP_766172.1

name	Moap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612503 CCDS:CCDS26122.1 GeneID:64113 MGI:1915555
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence ISS] codon_start : 1 product : MAP-1 protein protein_id : NP_071718.1

name	D230037D09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893105 GeneID:320351 MGI:2443862
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320351 protein_id : NP_796114.1

name	5730410I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789154 CCDS:CCDS26124.1 GeneID:66622 MGI:1913872
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66622 protein_id : NP_079942.1

name	Btbd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044481 CCDS:CCDS26125.1 GeneID:238386 MGI:1917858
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BTB (POZ) domain containing 7 protein_id : NP_766394.2

name	Cox8c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794657 GeneID:75483 MGI:1922733
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] codon_start : 1 product : cytochrome c oxidase subunit 8C protein_id : NP_001034138.1

name	9030205A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486612 GeneID:217843 MGI:2684729
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217843 protein_id : NP_001074486.1

name	Prima1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872180 CCDS:CCDS26127.1 GeneID:170952 MGI:1926097
definition	GO_component : GO:0031226 - intrinsic to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA] GO_function : GO:0019899 - enzyme binding [Evidence IPI]; GO:0043495 - protein anchor [Evidence IPI] GO_process : GO:0051649 - establishment of cellular localization [Evidence IDA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 note : acetylcholinesterase membrane anchor product : proline rich membrane anchor 1 precursor protein_id : NP_579942.2

name	EG544888 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393108 GeneID:544888 MGI:3647570
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619025.3

name	Asb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956122 CCDS:CCDS26128.1 GeneID:65256 MGI:1929743
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ankyrin repeat-containing SOCS box protein 2 product : ankyrin repeat and SOCS box-containing protein 2 protein_id : NP_075536.1

name	Otub2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386070 GeneID:68149 MGI:1915399
definition	GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : OTU domain, ubiquitin aldehyde binding 2 protein_id : NP_080856.1

name	Ddx24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328253 CCDS:CCDS26129.1 GeneID:27225 MGI:1351337
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 13 (RNA helicase A) product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 protein_id : NP_065240.2

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732711 GeneID:52668 MGI:1277180
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC52668 isoform 1 protein_id : NP_081066.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732717 GeneID:52668 MGI:1277180
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC52668 isoform 2 protein_id : NP_919042.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732719 CCDS:CCDS26130.1 GeneID:52668 MGI:1277180
definition	codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : hypothetical protein LOC52668 isoform 3 protein_id : NP_919043.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732721 CCDS:CCDS26131.1 GeneID:52668 MGI:1277180
definition	codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : hypothetical protein LOC52668 isoform 4 protein_id : NP_919044.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732723 CCDS:CCDS26132.1 GeneID:52668 MGI:1277180
definition	codon_start : 1 note : isoform 5 is encoded by transcript variant 5 product : hypothetical protein LOC52668 isoform 5 protein_id : NP_919045.1

name	Ifi27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:44771124 GeneID:76933 MGI:1924183
definition	GO_process : GO:0007568 - aging [Evidence IDA]; GO:0009615 - response to virus [Evidence IDA] codon_start : 1 note : interferon stimulated gene 12 product : interferon stimulated gene 12(b1) protein_id : NP_084079.1

name	1810023F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703896 CCDS:CCDS26133.1 GeneID:217845 MGI:1916390
definition	codon_start : 1 product : interferon stimulated gene 12(b2) protein_id : NP_663424.1

name	8430415E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794170 GeneID:74521 MGI:1921771
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HEAT-like repeat-containing protein protein_id : NP_083256.1

name	Serpina10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981720 CCDS:CCDS26134.1 GeneID:217847 MGI:2667725
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : protein Z-dependent protease inhibitor product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 protein_id : NP_659083.2

name	Serpina6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680856 CCDS:CCDS26135.1 GeneID:12401 MGI:88278
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : corticosteroid binding globulin product : serine (or cysteine) proteinase inhibitor, clade A, member 6 protein_id : NP_031644.1

name	Gm46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943105 GeneID:194604 MGI:2684892
definition	codon_start : 1 product : similar to serine proteinase inhibitor HongrES1 protein_id : XP_112098.2

name	Serpina1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404229 CCDS:CCDS26137.1 GeneID:68348 MGI:1915598
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epididymal serine protease inhibitor product : epsin protein_id : NP_080963.1

name	Serpina1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76881807 CCDS:CCDS26138.1 GeneID:20701 MGI:891970
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 2; alpha-1-antiproteinase; serine protease inhibitor 1-2 product : serine (or cysteine) proteinase inhibitor, clade A, member 1b protein_id : NP_033270.3

name	Serpina1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678085 CCDS:CCDS26139.1 GeneID:20703 MGI:891968
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1-antitrypsin 1-4; alpha-1 protease inhibitor 4; serine protease inhibitor 1-4 product : serine (or cysteine) proteinase inhibitor, clade A, member 1d protein_id : NP_033272.1

name	Serpina1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678079 CCDS:CCDS26140.1 GeneID:20700 MGI:891971
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 1; alpha-1-antiproteinase; serine protease inhibitor 1-1; alpha-1-antitrypsin 2 product : serine (or cysteine) proteinase inhibitor, clade A, member 1a protein_id : NP_033269.1

name	Serpina1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678083 CCDS:CCDS26141.1 GeneID:20702 MGI:891969
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : apha-1 protease inhibitor 3; serine protease inhibitor 1-3 product : serine (or cysteine) proteinase inhibitor, clade A, member 1c protein_id : NP_033271.1

name	Serpina1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678087 CCDS:CCDS26142.1 GeneID:20704 MGI:891967
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 5; alpha-1-antitrypsin 1-5; serine protease inhibitor 1-5 product : serine (or cysteine) proteinase inhibitor, clade A, member 1e protein_id : NP_033273.1

name	Serpina11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556296 CCDS:CCDS26143.1 GeneID:380780 MGI:2685741
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 protein_id : NP_955018.1

name	Serpina9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313654 CCDS:CCDS26144.1 GeneID:71907 MGI:1919157
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 protein_id : NP_082273.1

name	Serpina12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386038 CCDS:CCDS26145.1 GeneID:68054 MGI:1915304
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : vaspin; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 product : visceral adipose-specific SERPIN protein_id : NP_080811.1

name	Serpina5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370468 CCDS:CCDS26146.1 GeneID:268591 MGI:107817
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : protein C inhibitor; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 5 protein_id : NP_766541.1

name	Serpina3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263522 GeneID:74069 MGI:1921319
definition	codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade A, member 3A isoform 1 protein_id : XP_282560.6

name	Serpina3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370538 CCDS:CCDS26147.1 GeneID:271047 MGI:2182835
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : antitrypsin; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A, member 3B product : serine (or cysteine) peptidase inhibitor, clade A, member 3B protein_id : NP_766612.1

name	Serpina3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680586 CCDS:CCDS26148.1 GeneID:16625 MGI:102848
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : kallikrein binding protein; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3C product : serine (or cysteine) proteinase inhibitor, clade A, member 3C protein_id : NP_032484.1

name	Serpina3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701824 CCDS:CCDS26149.1 GeneID:238393 MGI:2182838
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : antitrypsin; alpha-1 antiproteinasin product : serine (or cysteine) peptidase inhibitor, clade A, member 3F protein_id : NP_001028507.1

name	Serpina3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476056 GeneID:20715 MGI:105046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor 2-1; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3G protein_id : NP_033277.1

name	Serpina3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517726 GeneID:546546 MGI:2182839
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3H product : serine (or cysteine) peptidase inhibitor, clade A, member 3H protein_id : NP_001030042.2

name	EG628900 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263491 GeneID:628900 MGI:3643496
definition	codon_start : 1 product : similar to Serpina3h protein protein_id : XP_898798.2

name	EG238395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20859253 GeneID:238395 MGI:3645874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_138240.1

name	Serpina3k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859636 GeneID:20714 MGI:98377
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor 2; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3K product : serine (or cysteine) proteinase inhibitor, clade A, member 3K protein_id : NP_035588.1

name	Serpina3m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678095 GeneID:20717 MGI:98378
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor-2 related sequence 1; contrapsin-like; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3M protein_id : NP_033279.1

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 5 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 4 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 3 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 2 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 1 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 4 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 3 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 2 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 1 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 6 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 5 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 4 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 3 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 2 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 1 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 4 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 3 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 2 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 1 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 7 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 6 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 5 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 4 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 3 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 2 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 1 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 1 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 2 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 3 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 4 pseudo : _no_value

name	EG634678 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263507 GeneID:634678 MGI:3646528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 1359 ESTs, 8 Proteins product : predicted gene, EG634678 pseudo : _no_value transcript_id : XR_002093.2

name	LOC667269 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263510 GeneID:667269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 147 ESTs, 4 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_032025.1

name	LOC667951 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263517 GeneID:667951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 262 ESTs, 50 Proteins product : similar to Serine (or cysteine) peptidase inhibitor, clade A, member 1a pseudo : _no_value transcript_id : XR_032235.1

name	Serpina4-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872153 GeneID:321018 MGI:2448363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 4, pseudogene 1 pseudo : _no_value transcript_id : NR_002861.1

name	LOC667997 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263524 GeneID:667997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to developmentally regulated GTP binding protein 2 pseudo : _no_value transcript_id : XR_032399.1

clone name	MSMg01-513P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-394L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-154A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292H17
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-022L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-328D13.b	B6Ng01-328D13.g
ACC	GA115545	GA115546
length	1,180	1,037
definition	B6Ng01-328D13.b	B6Ng01-328D13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(104,475,195 - 104,476,370)	(104,632,654 - 104,633,666)
sequence	gaattccagtgcccctgcaacttccgccagcctgccattgcaattgggga ccctagagtccctctactatgtgagagaggcttccaatgtgcttggtggc acaacagctgcatagtggatgtcagggtggcaatgagaggacaaggctct ttgggaccacctcttagcatttttaaagcaccgctgactatgtttctgac cctggaaacagtcctgtctcccaaggtaaagctacggtgctcagaatatg agcttccttcttcattcctgtagagacacaactcgattgtcagagtcagg gtaaacaggccagacacttgccatatgtctgagcccatcccccagccagg cctgactcctgccctgctctggatcatcattgcctaagactctgagctca aacacacccagacaaagccattccttccccagtctcccagacactctgaa cacaacagagttcatgagcagcacattggtttgacctggcctgacaaaat ggccttttttttttttccgagaggacacaagagtgacgatctatctacaa gagtgtttttaatatgatcaaatggcagacaagaagatggggaccaagtt ttggggctgaaggaggaagaagtgaaggagttcgttgcatcctagaaatc aatagatcctggtctctctcatgcataggctccactgagacccaagggaa caactgctcaagaatctgttctcacgggagggccaagaaggactgtcctt cttgcccagggctgggttctggccagggtcccactggagttcctataggt tagttgtgcataagcctatgattgataagcctcgctccattgacccctta cccatcagtaggcttctcttcgcccttcaaagcccttttctttacacaat catctgggataagctgtccctacagcccaacttgagcttcttggcctcat tgctgcttcttcacttggaaatattcctctttgaggcaagttccctgctg tttaatactatctgtcccctcacaggagctgtagtgtctgggcagacaag tagatggtgaagcgttgtattcatctgagcaggacaacggtgttgaaagc taatagaaagcttattaggcatacgacaagccaagaacaaggggttcaac aagccttaaatgatgtacccagcatccaac	gaattcactgcttaagcataaggccccaagttttgtaacacagcaactgt gtaacctgcccctgccatgcacccatacctcagcactggacggagattta gagacagccagctctccggactggtgactggccaatccagccagtgagtg agctgcaggttcagtggagagacaccatctcggaaattagacgagttagg gagaggcctcagtgagcaaggcgcttgctccccaagggagacaagagttc agatccccagaacggatgtgtggcagctacctgtaaacttagccctcagg aggcagagatggatccctgcagccagctagctagctagaccacccagaat cgacaacctccaggctcagcaagagaccctgtctaaataagcagagaaca aggaagacacccagtgtcaccacctcctgacatccgcatgcagaaacaca tgtgcatgcaaatccacatacatgtgtgcccacctacttaggaggcaggt tcatatgcatacctcacacacatgcatgcgctaaatttttaaaagaaaaa cgatagaggaaggtatatgatgtcaatgtctggcctctacactcgtgcac aggttggtacaatcctctattatgaacacatacatacacagggatacaca acacacatacacccaaatctctctctctctctctcattctctctctctct ctatatatatatatacatatatatatacacacatatacatatatacacac atatatgaattacatataaacatatatatatatatacatgtatgcatgta tatatgtataaacataaatttgtatatatgtatatatgaatattcagata tggatattcatatatgaatatatgtatatatacatatatatacacttaca tatgcatccatatatatatatacatacacacatatgcacacatatatatg tgtaatatatatatgggtaatatatatcagttatatacacacacatatat gtgtgtgtgtatatatatatgtatatataaatatgaa
quality values	Open. Hide. 36 31 42 33 62 62 41 23 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 46 50 59 43 56 54 50 46 43 28 38 36 50 54 62 59 59 62 62 62 62 62 62 62 59 46 54 62 62 62 62 59 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 42 42 54 62 62 59 62 62 62 62 62 56 62 49 49 62 62 62 62 54 54 54 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 54 62 62 62 62 49 54 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 48 62 62 62 62 52 62 62 62 62 52 62 62 62 62 49 62 52 62 62 62 62 62 62 58 58 54 58 47 58 47 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 54 58 54 58 54 58 58 58 54 54 52 58 46 54 58 54 58 54 52 41 39 58 58 58 58 41 35 45 42 58 54 58 58 58 58 58 58 58 58 58 58 54 58 54 48 58 58 34 41 41 58 42 58 58 50 54 58 58 58 47 58 58 52 58 51 51 49 58 54 51 54 50 51 50 49 48 51 34 58 58 50 49 50 41 58 52 51 50 41 42 50 58 48 46 51 52 53 49 40 49 53 50 50 46 49 58 53 46 52 52 51 58 50 41 51 40 31 39 46 39 32 24 46 31 51 50 39 43 49 58 39 39 40 35 36 50 51 39 58 50 51 52 39 50 39 58 37 52 58 52 49 50 50 50 52 41 33 38 53 54 49 39 23 54 44 27 51 23 52 25 49 32 14 49 37 31 40 54 40 35 49 44 44 39 49 42 45 26 42 34 47 42 40 44 27 42 44 35 25 31 41 37 40 54 35 35 49 38 40 52 54 30 36 44 44 25 33 27 44 41 39 21 51 30 27 47 29 43 40 39 16 42 39 41 32 25 32 53 37 31 32 31 26 32 34 53 31 52 51 28 34 31 34 40 29 37 36 39 28 32 51 31 34 46 37 31 32 34 43 32 35 21 30 18 24 31 31 51 46 24 24 27 28 26 46 29 17 35 31 31 35 29 33 30 31 25 34 36 31 31 31 30 30 34 31 38 40 19 27 42 23 20 46 29 21 31 40 25 22 42 47 13 23 13 41 6 12 19 21 20 16 31 31 31 29 31 32 34 43 48 29 31 17 10 34 24 27 29 32 25 29 41 29 15 19 36 27 32 32 41 32 17 25 30 31 28 28 31 27 31 30 30 24 13 32 20 27 12 9 16 20 31 41 27 26 20 24 13 18 31 38 22 14 24 13 8 8 9 14 16 17 33 48 20 10 11 21 17 21 22 31 18 7 41 22 12 31 27 32 17 34 17 11 20 24 24 44 24 13 32 24 18 15 28 37 18 11 7 11 16 18 17 20 20 33 27 30 27 32 39 37 26 32 21 6 10 11 25 15 33 9 32 27 18 7 4 12 6 15 18 27 27 30 43 29 7 18 8 20 8 16 28 7 7 13 7 9 10 27 18 8 12 16 19 9 26 16 15 22 15 5 6 6 26 24 18 14 27 8 12 20 10 23 13 16 22 8 4 3 6 6 7 6 7 17 9 27 8 9 6 3 3 9 27 11 6 6 7 20 6 28 17 11 10 14 7 13 15 18 6 5 5 24 6 7 7 23 10 22 4 5 4 22 5 5 21 21 7 11 10 7 7 11 13 26 30 18 5 8 11 16 23 7 5 18 9 10 6 17 10 12 21 18 9 14 13 9 6 3 4 17 27 7 12 9 10 10 8 13 7 6 3 4	Open. Hide. 62 47 56 47 62 44 51 47 56 59 34 32 24 45 28 27 43 56 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 54 59 59 62 62 59 54 62 62 62 59 54 49 54 62 62 62 62 62 62 62 59 62 59 62 54 62 62 49 54 59 59 59 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 54 62 62 62 62 62 59 62 62 62 62 62 62 62 54 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 49 49 43 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 49 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 37 37 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 43 62 62 62 62 62 54 45 62 62 62 62 58 58 58 58 58 58 58 58 41 58 54 58 54 54 54 52 58 58 58 54 58 58 58 43 54 54 46 58 58 52 58 58 54 54 54 42 58 58 58 58 54 54 54 54 54 54 54 51 58 58 58 48 54 58 54 58 54 58 52 54 58 54 54 58 54 41 58 58 42 42 49 52 52 58 48 52 52 49 54 39 54 54 58 52 54 52 58 51 45 34 58 58 49 58 58 58 58 58 39 58 54 58 50 54 51 54 49 58 50 39 51 51 58 58 58 58 58 58 58 54 58 58 46 46 58 58 58 50 58 51 54 53 58 44 49 51 58 51 58 43 58 49 58 40 58 50 58 50 50 40 37 27 51 39 58 51 58 50 58 50 54 41 58 50 58 51 58 53 58 54 58 54 58 37 58 52 58 50 58 41 51 51 51 47 50 53 39 51 35 50 50 52 50 58 39 51 40 58 49 53 52 53 52 58 53 52 53 53 51 50 37 53 30 39 58 50 50 41 47 39 32 52 54 38 32 45 42 49 39 52 51 42 53 35 30 54 51 39 34 38 35 54 49 37 54 37 50 37 41 37 37 52 38 50 54 32 38 39 39 35 40 45 37 34 31 30 34 24 53 53 41 21 47 23 26 40 31 27 28 17 24 29 29 33 30 31 42 42 35 27 23 46 37 28 30 13 7 16 30 32 32 33 32 45 34 32 19 21 10 11 13 19 41 53 41 19 25 16 11 18 9 49 32 17 12 23 17 13 16 11 6 16 15 40 23 26 18 26 32 24 31 30 27 27 29 30 25 31 18 45 26 33 14 27 18 40 19 30 25 23 29 33 27 31 23 30 31 37 31 30 21 30 23 27 32 31 42 24 15 13 24 25 27 21 19 9 14 19 31 48 46 16 24 23 27 9 16 13 7 19 20 37 25 32 30 31 32 12 13 9 10 18 30 10 30 14 33 17 27 18 26 30 31 29 29 32 24 28 12 27 21 44 24 33 6 21 11 14 5 8 14 24 19 13 11 23 8 13 5 17 23 28 8 17 10 5 4 8 8 18 22 31

Alignment Information

BAC End 1

BAC End 2

seq1: chr12_104475195_104476370
seq2: B6Ng01-328D13.b_49_1228

seq1  GAATTCCAGTGCCCCTGCAACTTCCGCCAGCCTGCCATTGCAATTGGGGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGTGCCCCTGCAACTTCCGCCAGCCTGCCATTGCAATTGGGGA  50

seq1  CCCTAGAGTCCCTCTACTATGTGAGAGAGGCTTCCAATGTGCTTGGTGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAGAGTCCCTCTACTATGTGAGAGAGGCTTCCAATGTGCTTGGTGGC  100

seq1  ACAACAGCTGCATAGTGGATGTCAGGGTGGCAATGAGAGGACAAGGCTCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACAGCTGCATAGTGGATGTCAGGGTGGCAATGAGAGGACAAGGCTCT  150

seq1  TTGGGACCACCTCTTAGCATTTTTAAAGCACCGCTGACTATGTTTCTGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGACCACCTCTTAGCATTTTTAAAGCACCGCTGACTATGTTTCTGAC  200

seq1  CCTGGAAACAGTCCTGTCTCCCAAGGTAAAGCTACGGTGCTCAGAATATG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGAAACAGTCCTGTCTCCCAAGGTAAAGCTACGGTGCTCAGAATATG  250

seq1  AGCTTCCTTCTTCATTCCTGTAGAGACACAACTCGATTGTCAGAGTCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTCCTTCTTCATTCCTGTAGAGACACAACTCGATTGTCAGAGTCAGG  300

seq1  GTAAACAGGCCAGACACTTGCCATATGTCTGAGCCCATCCCCCAGCCAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACAGGCCAGACACTTGCCATATGTCTGAGCCCATCCCCCAGCCAGG  350

seq1  CCTGACTCCTGCCCTGCTCTGGATCATCATTGCCTAAGACTCTGAGCTCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGACTCCTGCCCTGCTCTGGATCATCATTGCCTAAGACTCTGAGCTCA  400

seq1  AACACACCCAGACAAAGCCATTCCTTCCCCAGTCTCCCAGACACTCTGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACACCCAGACAAAGCCATTCCTTCCCCAGTCTCCCAGACACTCTGAA  450

seq1  CACAACAGAGTTCATGAGCAGCACATTGGTTTGACCTGGCCTGACAAAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAACAGAGTTCATGAGCAGCACATTGGTTTGACCTGGCCTGACAAAAT  500

seq1  GGCCTTTTTTTTTTTTCCGAGAGGACACAAGAGTGACGATCTATCTACAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTTTTTTTTTTTTCCGAGAGGACACAAGAGTGACGATCTATCTACAA  550

seq1  GAGTGTTTTTAATATGATCAAATGGCAGACAAGAAGATGGGGACCAAGTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGTTTTTAATATGATCAAATGGCAGACAAGAAGATGGGGACCAAGTT  600

seq1  TTGGGGCTGAAGGAGGAAGAAGTGAAGGAGTTCGTTGCATCCTAGAAATC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGGCTGAAGGAGGAAGAAGTGAAGGAGTTCGTTGCATCCTAGAAATC  650

seq1  AATAGATCCTGGTCTCTCTCATGCATAGGCTCCACTGAGACCCAAGGGAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAGATCCTGGTCTCTCTCATGCATAGGCTCCACTGAGACCCAAGGGAA  700

seq1  CAACTGCTCAAGAATCTGTTCTCACGGGAGGGCCAAGAAGGACTGTCCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGCTCAAGAATCTGTTCTCACGGGAGGGCCAAGAAGGACTGTCCTT  750

seq1  CTTGCCCAGGGCTGGGTTCTGGCCAGGGTCCCACTGGAGTTCCTATAGGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCCCAGGGCTGGGTTCTGGCCAGGGTCCCACTGGAGTTCCTATAGGT  800

seq1  TAGTTGTGCATAAGCCTATGATTGATAAGCCTCGCTCCATTGACCCCTTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTGTGCATAAGCCTATGATTGATAAGCCTCGCTCCATTGACCCCTTA  850

seq1  CCCATCAGTAGGCTTCTCTTCGCCCTTCAAAGCCCTTT--CTTACACAAT  898
      ||||||||||||||||||||||||||||||||||||||   |||||||||
seq2  CCCATCAGTAGGCTTCTCTTCGCCCTTCAAAGCCCTTTTCTTTACACAAT  900

seq1  CATCTGGGATAAGCTGTCCCTACAGCCCAACTTGAGCTTCTTGGCCTCAT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTGGGATAAGCTGTCCCTACAGCCCAACTTGAGCTTCTTGGCCTCAT  950

seq1  TGCTGCTTCTTCACCTTGGAAATATTCCTCTTTGAGGCAAGTTCCCTGCT  998
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  TGCTGCTTCTTCA-CTTGGAAATATTCCTCTTTGAGGCAAGTTCCCTGCT  999

seq1  GTTTTATACTATCTGTCCCCTCACAGGAGCTGTAGGTGTCTGGGGCAGAC  1048
      |||| ||||||||||||||||||||||||||||| |||||| ||||||||
seq2  GTTTAATACTATCTGTCCCCTCACAGGAGCTGTA-GTGTCT-GGGCAGAC  1047

seq1  AAGTAGATGGTG-AGCGTTGTATTCATCCTGAGCAGGGACACGGTGTTGA  1097
      |||||||||||| |||||||||||||| |||||||||   ||||||||||
seq2  AAGTAGATGGTGAAGCGTTGTATTCAT-CTGAGCAGGACAACGGTGTTGA  1096

seq1  CAGCT-ATAGGAAGCTTATTAGCCATACGAC-AGGCAAG-ACAAGGGG-T  1143
       |||| |||| ||||||||||| |||||||| || |||| |||||||| |
seq2  AAGCTAATAGAAAGCTTATTAGGCATACGACAAGCCAAGAACAAGGGGTT  1146

seq1  CAACAAG-CTTAAATGATGTACCCAGCATCCAAC  1176
      ||||||| ||||||||||||||||||||||||||
seq2  CAACAAGCCTTAAATGATGTACCCAGCATCCAAC  1180

seq1: chr12_104632654_104633666
seq2: B6Ng01-328D13.g_91_1103 (reverse)

seq1  TTCATATATATATATACATATATATATACACACACACATATATGTGTGTG  50
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATATTTATATATACATATATATATACACACACACATATATGTGTGTG  50

seq1  TATATAACTGATATATATTACCCATATATATATTACACATATATATGTGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATAACTGATATATATTACCCATATATATATTACACATATATATGTGT  100

seq1  GCATATGTGTGTATGTATATATATATATGGATGCATATGTAAGTGTATAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATATGTGTGTATGTATATATATATATGGATGCATATGTAAGTGTATAT  150

seq1  ATATGTATATATACATATATTCATATATGAATATCCATATCTGAATATTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGTATATATACATATATTCATATATGAATATCCATATCTGAATATTC  200

seq1  ATATATACATATATACAAATTTATGTTTATACATATATACATGCATACAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATACATATATACAAATTTATGTTTATACATATATACATGCATACAT  250

seq1  GTATATATATATATATGTTTATATGTAATTCATATATGTGTGTATATATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATATATATATATATGTTTATATGTAATTCATATATGTGTGTATATATG  300

seq1  TATATGTGTGTATATATATATGTATATATATATATAGAGAGAGAGAGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATGTGTGTATATATATATGTATATATATATATAGAGAGAGAGAGAGA  350

seq1  ATGAGAGAGAGAGAGAGAGATTTGGGTGTATGTGTGTTGTGTATCCCTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGAGAGAGAGAGAGAGATTTGGGTGTATGTGTGTTGTGTATCCCTGT  400

seq1  GTATGTATGTGTTCATAATAGAGGATTGTACCAACCTGTGCACGAGTGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTATGTGTTCATAATAGAGGATTGTACCAACCTGTGCACGAGTGTA  450

seq1  GAGGCCAGACATTGACATCATATACCTTCCTCTATCGTTTTTCTTTTAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCCAGACATTGACATCATATACCTTCCTCTATCGTTTTTCTTTTAAA  500

seq1  AATTTAGCGCATGCATGTGTGTGAGGTATGCATATGAACCTGCCTCCTAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTAGCGCATGCATGTGTGTGAGGTATGCATATGAACCTGCCTCCTAA  550

seq1  GTAGGTGGGCACACATGTATGTGGATTTGCATGCACATGTGTTTCTGCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGTGGGCACACATGTATGTGGATTTGCATGCACATGTGTTTCTGCAT  600

seq1  GCGGATGTCAGGAGGTGGTGACACTGGGTGTCTTCCTTGTTCTCTGCTTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGATGTCAGGAGGTGGTGACACTGGGTGTCTTCCTTGTTCTCTGCTTA  650

seq1  TTTAGACAGGGTCTCTTGCTGAGCCTGGAGGTTGTCGATTCTGGGTGGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGACAGGGTCTCTTGCTGAGCCTGGAGGTTGTCGATTCTGGGTGGTC  700

seq1  TAGCTAGCTAGCTGGCTGCAGGGATCCATCTCTGCCTCCTGAGGGCTAAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTAGCTAGCTGGCTGCAGGGATCCATCTCTGCCTCCTGAGGGCTAAG  750

seq1  TTTACAGGTAGCTGCCACACATCCGTTCTGGGGATCTGAACTCTTGTCTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACAGGTAGCTGCCACACATCCGTTCTGGGGATCTGAACTCTTGTCTC  800

seq1  CCTTGGGGAGCAAGCGCCTTGCTCACTGAGGCCTCTCCCTAACTCGTCTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTGGGGAGCAAGCGCCTTGCTCACTGAGGCCTCTCCCTAACTCGTCTA  850

seq1  ATTTCCGAGATGGTGTCTCTCCACTGAACCTGCAGCTCACTCACTGGCTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCGAGATGGTGTCTCTCCACTGAACCTGCAGCTCACTCACTGGCTG  900

seq1  GATTGGCCAGTCACCAGTCCGGAGAGCTGGCTGTCTCTAAATCTCCGTCC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGGCCAGTCACCAGTCCGGAGAGCTGGCTGTCTCTAAATCTCCGTCC  950

seq1  AGTGCTGAGGTATGGGTGCATGGCAGGGGCAGGTTACACAGTTGCTGTGT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTGAGGTATGGGTGCATGGCAGGGGCAGGTTACACAGTTGCTGTGT  1000

seq1  TACAAAACTTGGG  1013
      |||||||||||||
seq2  TACAAAACTTGGG  1013

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information