MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-093B01
Chromosome	12 (Build37)
Map Location	106,838,759 - 106,838,869
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Dicer1, Clmn, 4831426I19Rik, Snhg10, Glrx5, LOC100040301, Tcl1b2, Tcl1b1, Tcl1b5, Tcl1b3, Tcl1b4, Tcl1, LOC100040310, 2810011L19Rik, LOC100040339, EG668081, D430019H16Rik, Bdkrb2
Downstream gene	Bdkrb1, 2410024A21Rik, 4933433P14Rik, Ak7, Papola, Vrk1, LOC100040386, LOC100040404, LOC100040420, 1700121N20Rik, LOC100041191, LOC100040451
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dicer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192119 MGI:2177178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4831426I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212073 MGI:2442408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Snhg10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69434 MGI:1916684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glrx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73046 MGI:1920296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tcl1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27381 MGI:1351609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27379 MGI:1351601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27382 MGI:1351635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27378 MGI:1351600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27380 MGI:1351604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21432 MGI:1097166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040310 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2810011L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69952 MGI:1917202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC100040339 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG668081 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668081 MGI:3645292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D430019H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268595 MGI:2443127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 131 ESTs

name	Bdkrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12062 MGI:102845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bdkrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12061 MGI:88144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410024A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76559 MGI:1923809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933433P14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66787 MGI:1914037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ak7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78801 MGI:1926051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins

name	Papola (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18789 MGI:109301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vrk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22367 MGI:1261847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100040386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040404 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100040420 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	1700121N20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76639 MGI:1923889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041191 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041191
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040451 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040451
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Dicer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168270 GeneID:192119 MGI:2177178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dicer1, Dcr-1 homolog (Drosophila) transcript_id : NM_148948.2

name	Clmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816902 GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmin transcript_id : NM_001040682.1

name	Clmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816763 GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmin transcript_id : NM_053155.2

name	4831426I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607450 GeneID:212073 MGI:2442408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831426I19 gene transcript_id : NM_172500.2

name	4831426I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607452 GeneID:212073 MGI:2442408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831426I19 gene transcript_id : NM_001042699.1

name	Glrx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365117 GeneID:73046 MGI:1920296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaredoxin 5 homolog (S. cerevisiae) transcript_id : NM_028419.2

name	LOC100040301 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263495 GeneID:100040301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to T-cell leukemia protein Tcl1b3a transcript_id : XM_001474463.1

name	Tcl1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305554 GeneID:27381 MGI:1351609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 2 transcript_id : NM_013775.1

name	Tcl1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130857 GeneID:27379 MGI:1351601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 1 transcript_id : NM_013773.2

name	Tcl1b5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305560 GeneID:27382 MGI:1351635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 5 transcript_id : NM_013776.1

name	Tcl1b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305556 GeneID:27378 MGI:1351600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 3 transcript_id : NM_013772.1

name	Tcl1b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130858 GeneID:27380 MGI:1351604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 4 transcript_id : NM_013774.2

name	Tcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981970 GeneID:21432 MGI:1097166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell lymphoma breakpoint 1 transcript_id : NM_009337.2

name	LOC100040310 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263499 GeneID:100040310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040310 transcript_id : XM_001474482.1

name	2810011L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263531 GeneID:69952 MGI:1917202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2810011L19 gene transcript_id : XM_001476131.1

name	LOC100040339 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263501 GeneID:100040339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040339 transcript_id : XM_001474521.1

name	EG668081 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393126 GeneID:668081 MGI:3645292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668081 transcript_id : XM_994212.1

name	D430019H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263533 GeneID:268595 MGI:2443127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 131 ESTs product : RIKEN cDNA D430019H16 gene transcript_id : XM_001476158.1

name	Bdkrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560615 GeneID:12062 MGI:102845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bradykinin receptor, beta 2 transcript_id : NM_009747.2

name	Bdkrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582803 GeneID:12061 MGI:88144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bradykinin receptor, beta 1 transcript_id : NM_007539.2

name	2410024A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118197273 GeneID:76559 MGI:1923809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410024A21 gene transcript_id : NM_029654.4

name	4933433P14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292449 GeneID:66787 MGI:1914037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933433P14 gene transcript_id : NM_178613.3

name	Ak7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393130 GeneID:78801 MGI:1926051
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 2 Proteins product : adenylate kinase 7 transcript_id : XM_994344.1

name	Papola (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511060 GeneID:18789 MGI:109301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (A) polymerase alpha transcript_id : NM_011112.2

name	Vrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067123 GeneID:22367 MGI:1261847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vaccinia related kinase 1 transcript_id : NM_011705.3

name	Vrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067121 GeneID:22367 MGI:1261847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vaccinia related kinase 1 transcript_id : NM_001029843.1

name	Vrk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067119 GeneID:22367 MGI:1261847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vaccinia related kinase 1 transcript_id : NM_001029844.1

name	LOC100040404 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263503 GeneID:100040404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001474629.1

name	LOC100040420 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263505 GeneID:100040420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to reproductive homeobox on X chromosome 8 transcript_id : XM_001474648.1

name	1700121N20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393132 GeneID:76639 MGI:1923889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700121N20 gene transcript_id : XM_901257.2

name	LOC100040451 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263508 GeneID:100040451
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to gamma-aminobutyric acid A receptor, epsilon transcript_id : XM_001474698.1

name	Dicer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168271 GeneID:192119 MGI:2177178
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004525 - ribonuclease III activity [Evidence ISS] [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0035196 - miRNA-mediated gene silencing, production of miRNAs [Evidence IMP]; GO:0030422 - RNA interference, production of siRNA [Evidence IDA]; GO:0030423 - RNA interference, targeting of mRNA for destruction [Evidence ISS]; GO:0006396 - RNA processing [Evidence IDA]; GO:0019827 - stem cell maintenance [Evidence IMP] codon_start : 1 note : endoribonuclease Dicer product : dicer1 protein_id : NP_683750.2

name	Clmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816903 GeneID:94040 MGI:2136957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : calmin isoform b protein_id : NP_001035772.1

name	Clmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816764 GeneID:94040 MGI:2136957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : calmin isoform a protein_id : NP_444385.2

name	4831426I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607453 GeneID:212073 MGI:2442408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant 1 product : nesprin-3 isoform alpha protein_id : NP_001036164.1

name	4831426I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607451 GeneID:212073 MGI:2442408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant 2 product : nesprin-3 isoform beta protein_id : NP_766088.2

name	Glrx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312153 CCDS:CCDS26154.1 GeneID:73046 MGI:1920296
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : glutaredoxin 5 protein_id : NP_082695.1

name	LOC100040301 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263496 GeneID:100040301
definition	codon_start : 1 product : similar to T-cell leukemia protein Tcl1b3a protein_id : XP_001474513.1

name	Tcl1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305555 GeneID:27381 MGI:1351609
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 2 protein_id : NP_038803.1

name	Tcl1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305553 GeneID:27379 MGI:1351601
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 1 protein_id : NP_038801.1

name	Tcl1b5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305561 GeneID:27382 MGI:1351635
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 5 protein_id : NP_038804.1

name	Tcl1b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305557 GeneID:27378 MGI:1351600
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 3 protein_id : NP_038800.1

name	Tcl1b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305559 GeneID:27380 MGI:1351604
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 4 protein_id : NP_038802.1

name	Tcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678257 GeneID:21432 MGI:1097166
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0045120 - pronucleus [Evidence IDA] codon_start : 1 product : T-cell lymphoma breakpoint 1 protein_id : NP_033363.1

name	LOC100040310 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263500 GeneID:100040310
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474532.1

name	2810011L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263532 GeneID:69952 MGI:1917202
definition	codon_start : 1 product : hypothetical protein LOC69952 protein_id : XP_001476181.1

name	LOC100040339 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263502 GeneID:100040339
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474571.1

name	EG668081 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393127 GeneID:668081 MGI:3645292
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999306.1

name	D430019H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263534 GeneID:268595 MGI:2443127
definition	codon_start : 1 product : hypothetical protein LOC268595 protein_id : XP_001476208.1

name	Bdkrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560616 GeneID:12062 MGI:102845
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : kinin B2 product : bradykinin receptor, beta 2 protein_id : NP_033877.2

name	Bdkrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671632 CCDS:CCDS26155.1 GeneID:12061 MGI:88144
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : kinin B1 product : bradykinin receptor, beta 1 protein_id : NP_031565.1

name	2410024A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118197274 GeneID:76559 MGI:1923809
definition	codon_start : 1 product : hypothetical protein LOC76559 protein_id : NP_083930.5

name	4933433P14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115292450 GeneID:66787 MGI:1914037
definition	codon_start : 1 product : hypothetical protein LOC66787 protein_id : NP_848728.2

name	Ak7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393131 GeneID:78801 MGI:1926051
definition	codon_start : 1 product : adenylate kinase 7 protein_id : XP_999438.1

name	Papola (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21914853 GeneID:18789 MGI:109301
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0004652 - polynucleotide adenylyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : poly (A) polymerase alpha protein_id : NP_035242.1

name	Vrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755985 GeneID:22367 MGI:1261847
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : vaccinia related kinase 1 isoform a protein_id : NP_035835.1

name	Vrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067122 CCDS:CCDS26157.1 GeneID:22367 MGI:1261847
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : vaccinia related kinase 1 isoform b protein_id : NP_001025014.1

name	Vrk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067120 CCDS:CCDS26158.1 GeneID:22367 MGI:1261847
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046777 - protein amino acid autophosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : isoform c is encoded by transcript variant 3 product : vaccinia related kinase 1 isoform c protein_id : NP_001025015.1

name	LOC100040404 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263504 GeneID:100040404
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474679.1

name	LOC100040420 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263506 GeneID:100040420
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474698.1

name	1700121N20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943147 GeneID:76639 MGI:1923889
definition	codon_start : 1 product : hypothetical protein LOC76639 protein_id : XP_906350.1

name	LOC100040451 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263509 GeneID:100040451
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474748.1

name	LOC100040386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040386
definition	number : 2 pseudo : _no_value

name	LOC100040386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040386
definition	number : 1 pseudo : _no_value

name	LOC100041191 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041191
definition	number : 1 pseudo : _no_value

name	Snhg10 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141803286 GeneID:69434 MGI:1916684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA host gene (non-protein coding) 10 transcript_id : NR_003145.2

clone name	MSMg01-436K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281C23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-093B01.T7 (MSMg01no093_b01.b1)	MSMg01-093B01.TJ (MSMg01no093_b01.g1)
ACC	AG310603	AG310604
length	1,183	1,369
length of high quality (start - end)	115 (36 - 150)	68 (60 - 127)
definition	CHROMAT_FILE: MSMg01no093_b01.b1 PHD_FILE: MSMg01no093_b01.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:47:12 2005	CHROMAT_FILE: MSMg01no093_b01.g1 PHD_FILE: MSMg01no093_b01.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:47:12 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	GCCCGGCGGTTGGTGTTGAAACCCCGATCAGAACACAAGGAGAGAGCCAA CCCACTTACTTGCTGGGGGACCTCACACTTAGTCAGGGGGCAGCCAGCGA GAGCTAACACGTGAGTGTAGAACACATGGAAAGTGGCAGGCAGAACGAAG AGCCAGGAAGCCAGTGAGGAGGTTGGAGAAGAAGCTCCCAAAATGTCCCC ATCTCCAGACACTTTGCTGGGAACAGAAAGATCTGACTGTTTTGAGCGCG TGGCTTTCCTGTTCAGGCTGCTCTAGCAAGAGGTTACTGTCTTTCCTCAG GCTCTGCCGCGATTTTTTTTTTTCCCTCTGACTCGGTCGAGGATTTTTGG TTGTATGCTCCCCCGCCTTGTTCTCTCCCCTCTTCTTTGTTTTTTTTTTT CTCTTCTTCTAGACTTTGTTTTCTCTTTCCTTTTCTTTCTTTTCTCTATC TCCCTTACTCTTTTCTTTTCTCTCCTTTCTCCTTTTTTTTTTCTTTGTCT ACTTTTTTTTTCTTCTCTTTCTTTTCCCTTTTTCCCCTTTTCTTTTTTTC CTTTTTTCTTCTTTTTCTCTTTTTCTTTCTCTCCCCTTCTCTTTCCTTTT TCTCTTATTCTTCTCTCTTCTTCTTTTTCTCTTTCTCTATTTTTTTTTTT CTACTTTTCTTCTTTTTTCTCTTCTTTTCCTTTCATTCTCTTTTCTCACT CTCTCCTTCTTTTCCTTTTTTACTCCTCTTTCTTTCTTCTTTCTTTCTTC CTTTCTTCTTTTTTTCTTCTATTTTTTCTTCCTCCCCCTATACCATTTTT TTTTTATTTTTTTTATTTTTTTTCTCTCTCCTTCTTTTTTTTTCTCTTTT TCCCCCCTTATTTTCTTTTTTCCCTTCTCTTTCTTCCTCTTTTTTTTTTT CTTTATCCCCCTATATTTTTTATTTTTTTCTTTGTTCCCTTTTTATCATT TATATATATTTTTTTCTCTTTTTCTCCCTTATTTTCGTTTTCTTTATCTT CCTCCTCTTCTCTTTTGTCTTCTCTTTCTTCCTTATCCTTCTTCTCCTTC CTATTCTCCTTCTCATCTTCCTTGTCTTTTTTCTTTCTCTCTCTCTTCCT CCTCTTCTACCACTCTTCTCTCTTATTCCTCATCTCGTCCTTCTCTCTTT CTACTGCTCACTTTTTATCTTCTTTCTCTTTTT	TACTAGGTAGCGGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXCCCTTCTGTAGATCAGGCTGGCCCCGAACTCAGAAATTTGC CCCTTTCTGCCTCCCAAGTGCTAGGATCAAAGGCGTGTGCCACCACGCCC AGCCGTTATTTTATTTTTACTTATGCCTGTGGGATGGTAGATATGTGCAT GTGTGTTTTTTTGTTTGTTTATATCACTTTATTTTCTTTTTTTCTCTTTT TCTCTTATTTTCACTTCCTTGTTTTCCTTTTTCTTTCTCTTTTTTTCTCT TTTTCTTCTTCTTTTTCCTTTTTTCTCTTTCTTTTTCTTTTTTTTTTCTT CTTTTTTTTTTTTTTTCTTTTTTTTTTTTTCTCCTCTTTTTTTTTTTTTT TCTCCCTTTTTTTCTTTTTCTTTTTTTTTCCTCTTTATATAATTTTTTTT TTTTTTTTCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTTTATAAAAAAAC TTGGGTTTGGTTTTTTTTTCATCTTTTTTTATTTTCTCTCTTTTTCTCTT TTTTATTTCTTCTTCTCTCTTTTTTTTCTCCTTCTTTTCTTTTTTTCTCT TTCTTTTTTCTTCCTTTTTTTCTTCTATCTTTTTCTATCCTTTTTCTTCT CTTCTTTCCCTTTCTCTATTTTTTTTTCTTTTCTTTTTTTTTATTTTTTC TCTCTTCTTTCTCTTTTTTCTTTCTTTTCTTTCTTTCTTTTTTCATTCTT TTTTCTTTTTCCTATTTTTCTTTCTCTTTTTTTTTTTTTTCCTTCTTTTC TTTTTTTTTTTTTTTTCTTCTTTTTTTTCTTTCTTTTGTTCTCTTTTTCA TTCTTTTTTCTTTTCTTTTTTCTTCTTTCTTCTCTTCTCTTCTTTTTTTC TCTTTTTCTTTCCTTCCTTTCTTTTTTTTTTCTTTCTTTCTTTCTCTCTT TCTTTTTCTCTTTACTTCTCTCTCTTTCTCTACTTTTTTTATCTTTTTCT CTTTTTCCTTCTCCTCTTATTTTATTTTTTTTTTTTTTTTTTTTTTTCTT TTTTTCTTCTTTTCTTCTCTTTTCTCCTCCTCTTTTTCTTTTGTTTCATT TTTATTTATCTTTCTATCCTTTTTTTCTCTCTTTTATTTTCTCTTTTCTT TCTCTTCTTCTCTTCTTCTTTCTCTTTCTTTTTTTTTTACTCCGCTTCTT TCTTCTTTACTTCCTCTATCCCCTTTACTTCTTTATCTCTTTTGTTCTTT ACTTGCATTTCCATTCTTCTCCTCTTCTTCCTTCTATATTTCTATTTCTC ACTTTTTCTCTTATTCTTCTTTTACTCTCCTCTCATCTCTTTTTTCTCCC TTCTTCTTCTTTCCTATTC
quality values	Open. Hide. 8 8 8 6 6 8 8 8 8 8 10 22 17 24 19 24 16 15 14 10 9 9 10 10 10 10 10 10 7 6 8 8 12 10 23 20 22 28 22 37 31 37 28 25 10 12 9 9 9 13 18 31 30 31 31 37 37 37 40 40 43 43 39 37 33 28 30 25 25 25 37 37 43 42 31 24 23 23 24 26 17 19 20 20 33 33 36 37 37 32 32 23 24 23 18 16 10 10 10 16 24 41 39 43 43 42 42 30 24 19 13 13 15 32 41 32 32 32 32 32 32 32 32 27 27 24 32 18 23 23 32 32 35 43 32 32 32 35 35 32 28 27 27 27 43 41 41 28 20 15 12 12 12 13 13 18 18 19 15 13 12 11 10 9 9 9 12 18 41 32 30 28 25 25 28 28 28 24 19 13 13 13 18 18 27 28 28 24 18 18 18 17 21 21 13 13 13 12 21 13 17 17 30 23 17 11 11 11 17 18 17 17 21 28 19 18 15 25 25 14 14 14 25 19 20 15 15 11 9 8 8 8 8 12 10 11 10 10 10 8 8 8 12 15 12 12 15 12 12 12 12 10 10 13 17 17 23 14 10 10 8 8 8 8 13 12 12 13 13 26 20 8 8 8 8 8 8 9 9 9 10 10 10 9 9 9 15 18 11 11 10 10 9 10 10 10 9 9 9 9 13 13 13 15 16 11 11 11 11 9 11 11 13 17 16 16 19 19 13 10 6 6 6 6 8 8 10 12 10 10 11 8 10 8 10 10 10 10 10 11 8 9 8 8 12 8 8 8 8 8 8 9 9 9 8 8 6 6 6 6 8 10 14 8 8 8 8 10 10 10 10 9 9 8 8 8 8 8 10 8 8 8 10 8 8 8 10 10 6 6 8 8 9 9 9 9 11 13 10 10 10 9 9 9 10 12 11 10 8 8 6 6 6 6 13 11 10 10 10 9 9 13 14 14 15 12 9 9 10 10 11 11 13 15 15 8 8 7 7 13 15 14 8 8 8 7 6 6 8 10 15 10 8 6 6 8 8 8 8 10 9 9 13 8 8 8 8 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 8 9 9 11 13 16 12 16 11 8 8 8 8 10 8 8 8 10 8 9 10 12 9 9 11 8 8 8 8 8 8 8 8 8 6 6 8 8 9 9 8 14 6 7 10 11 9 8 8 8 12 8 8 13 12 10 9 6 8 8 9 10 17 15 10 9 9 10 10 10 8 8 8 7 7 8 9 15 8 8 8 12 8 8 11 9 8 6 6 6 8 8 10 8 8 6 7 10 6 9 8 8 8 8 7 7 8 10 9 10 10 10 10 9 9 9 9 9 9 10 10 11 8 8 8 8 10 10 8 8 8 8 8 8 8 8 8 8 8 9 10 13 13 15 12 9 9 8 8 8 8 7 6 8 8 9 9 10 12 13 10 10 11 14 11 8 8 8 8 12 12 19 10 10 10 11 10 9 9 9 9 8 10 8 8 8 10 10 8 10 8 10 6 6 8 8 8 8 9 6 8 10 8 8 8 10 8 10 9 6 8 6 6 8 8 8 6 6 8 8 11 13 19 21 28 23 24 21 10 10 10 8 9 13 13 8 8 8 8 8 10 8 8 8 8 8 10 8 10 8 8 8 8 10 12 16 10 10 10 8 8 8 8 8 8 9 8 8 6 8 8 8 10 15 16 11 11 10 8 8 8 8 10 10 8 8 8 8 8 11 10 10 10 13 11 10 10 10 9 6 6 6 6 6 6 6 6 6 7 7 11 12 10 10 10 23 10 13 8 8 8 8 10 10 21 21 8 8 8 8 8 8 10 10 10 9 8 8 8 8 8 8 8 6 6 8 8 7 7 8 11 13 15 10 11 11 15 9 9 9 10 10 12 12 9 11 10 21 12 15 18 12 10 8 6 6 8 10 8 12 8 8 8 10 8 6 6 6 6 8 8 8 8 8 8 8 11 11 8 6 6 7 6 8 9 9 8 10 8 8 8 10 9 10 21 21 8 8 8 8 8 8 23 14 14 9 9 12 12 9 9 10 12 10 8 8 8 9 8 9 8 12 10 8 9 8 10 8 6 6 8 10 15 16 16 15 15 12 9 9 8 8 7 7 8 8 6 6 6 6 6 8 8 16 15 13 10 10 10 8 8 8 6 6 8 8 12 14 14 8 6 6 6 6 8 8 8 8 8 8 8 8 8 15 13 15 11 12 11 12 9 9 15 10 10 8 8 6 6 8 10 10 8 8 8 17 11 10 8 8 8 8 8 12 10 8 8 8 8 8 8 7 7 10 8 10 8 10 9 9 9 10 11 11 11 9 10 11 11 10 12 8 8 8 8 10 9 9 9 10 8 8 8 8 10 10 10 8 8 8 8 10 10 16 11 11 11 9 9 9 12 11 13 18 16 16 15 12 9 6 6 8 8 6 7 8 6 8 8 8 11 10 10 10 10 10 6 6 8 8 8 8 8 8 8 8 6 6 6 6 6 8 10 10 6 6 8 10 8 8 8 10 11 8 8 8 8 8 13 13 8 8 8 8 8 6 6 6 7 10 10 10 8 8 8 8 10 12 11 10 9 8 8 6 6 7 6 10 8 16 11 11 11 10 9 12 11 10 10 8 8 8 8 11 8 9 9 9	Open. Hide. 6 6 6 6 7 6 6 6 6 13 8 7 7 13 11 10 10 13 9 7 9 9 14 14 25 29 28 28 33 33 33 33 36 34 28 28 28 34 37 37 34 34 34 39 39 39 50 50 48 48 41 41 39 37 37 37 37 22 21 11 11 12 18 13 12 10 13 13 20 18 22 37 37 37 37 36 36 35 39 35 36 44 44 53 53 53 50 50 47 47 39 39 48 48 47 59 59 43 27 25 10 10 10 10 10 10 20 20 24 21 29 29 30 36 50 36 35 35 35 36 36 36 29 27 12 8 8 8 8 8 25 34 24 15 15 20 24 29 31 32 32 32 28 30 30 33 39 43 43 59 59 48 57 59 47 43 43 43 50 50 42 42 38 38 36 36 33 33 33 33 27 22 15 10 10 12 12 18 9 22 23 34 34 23 34 28 35 35 39 39 43 43 43 39 32 28 20 20 28 21 24 20 20 16 19 12 11 11 11 11 13 10 11 11 8 8 10 8 8 8 8 8 8 7 8 8 8 8 10 8 10 11 23 20 10 10 10 8 8 8 8 8 8 8 8 12 12 10 10 10 8 8 8 8 8 8 10 11 15 12 8 8 6 6 8 8 8 8 8 8 8 8 8 10 10 10 10 21 19 18 19 14 24 22 30 18 18 16 15 11 10 10 13 11 12 9 9 9 9 9 9 9 9 9 11 12 10 10 8 8 6 6 8 8 8 7 6 7 9 13 16 10 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 8 9 11 18 10 14 15 14 16 10 9 8 8 8 8 8 8 13 13 13 12 9 9 10 8 8 6 10 7 7 12 11 20 15 19 14 13 23 12 11 8 8 6 6 8 8 9 10 10 12 11 16 16 25 26 39 24 24 20 18 11 8 8 8 6 6 8 8 6 7 8 8 10 10 8 10 6 6 8 8 8 13 15 14 10 10 13 11 12 13 10 13 15 10 10 13 11 8 8 8 8 8 8 13 10 9 10 9 10 10 12 16 28 29 28 18 19 10 9 9 10 10 10 15 10 11 9 19 21 16 13 11 10 13 12 14 20 20 20 20 19 10 8 8 8 8 8 17 17 12 13 11 9 9 9 10 9 9 9 13 10 10 11 11 10 9 9 9 12 9 8 8 6 6 8 13 24 24 30 17 15 8 6 7 8 12 8 8 8 25 17 23 11 11 11 18 10 9 8 8 8 8 8 8 15 17 16 17 9 9 9 10 14 10 10 10 9 10 8 10 8 8 8 10 10 10 8 8 9 11 11 23 15 15 10 10 13 12 12 10 10 10 8 8 15 8 8 8 10 13 10 11 8 11 8 9 12 10 10 10 8 8 8 8 8 10 13 15 12 10 10 11 15 13 9 9 9 9 14 16 10 10 10 10 10 8 8 8 7 9 9 10 10 10 15 15 10 10 8 8 8 8 8 8 8 10 17 17 11 8 8 8 7 7 8 10 9 9 9 9 8 8 6 6 12 10 11 13 15 8 8 8 12 13 18 37 37 35 12 12 7 7 7 7 12 14 11 13 10 8 8 10 8 8 8 8 8 8 9 11 11 15 15 16 18 13 12 12 12 13 12 18 18 13 11 10 10 10 10 13 15 11 10 8 8 8 8 8 12 12 23 24 14 11 11 11 11 15 11 13 12 13 15 9 10 8 8 6 6 6 6 8 8 18 11 12 10 10 8 12 15 15 13 10 10 9 9 9 12 12 12 8 8 9 12 12 13 13 10 10 15 13 18 11 10 10 14 10 19 16 22 14 9 9 9 9 9 9 11 15 12 9 9 9 10 12 12 17 15 13 14 14 13 10 10 10 15 12 8 7 6 12 10 8 8 8 10 10 12 15 11 10 13 11 10 6 6 8 8 8 8 8 9 9 8 8 8 9 9 10 8 9 8 8 13 13 10 13 12 14 20 20 20 20 12 15 11 6 6 10 10 12 15 10 7 7 8 8 9 10 10 15 15 10 10 13 13 13 11 10 10 14 19 10 8 8 8 10 11 13 21 8 8 8 8 8 15 12 9 10 7 6 8 8 8 10 10 8 8 8 11 12 10 23 13 13 12 10 14 11 15 19 9 9 12 7 8 7 6 8 8 9 11 8 8 6 6 6 8 12 19 11 10 8 8 8 11 10 21 13 9 9 9 9 8 8 8 8 8 8 8 8 10 8 10 8 8 8 11 9 8 8 8 7 7 8 9 16 15 21 18 11 8 8 8 7 6 10 8 14 8 6 7 6 8 13 15 10 8 6 6 10 11 10 10 10 10 10 7 7 6 6 6 6 8 6 6 8 8 10 11 11 11 17 18 11 11 12 13 13 12 8 8 10 10 14 14 12 12 13 10 11 13 11 13 10 10 8 8 8 10 6 7 12 12 8 6 6 8 6 6 8 8 10 10 8 10 8 8 8 8 11 9 8 8 8 10 8 19 10 10 9 8 10 8 8 8 11 8 12 12 10 10 10 10 8 8 8 9 15 8 8 6 7 10 8 8 8 8 8 8 8 10 21 15 15 15 11 13 13 15 8 10 9 9 8 8 8 10 10 10 10 11 12 12 13 12 21 13 11 7 7 8 8 8 10 15 12 14 14 12 14 12 12 9 9 12 12 10 10 6 6 10 8 8 9 9 10 18 23 14 8 12 9 9 8 8 10 9 8 7 6 8 6 6 6 6 8 10 8 8 8 10 9 8 8 8 8 8 8 8 8 6 7 8 8 8 8 8 7 7 7 11 10 8 11 12 8 8 8 8 8 8 10 12 11 8 8 8 8 8 8 8 8 10 8 10 8 8 8 8 11 9 10 10 9 7 7 7 8 8 8 8 10 10 9 8 8 8 8 12 8 10 10 13 10 8 9 9 9 9 6 8 6 6 10 10 10 9 9 9 9 8 10 8 8 8 10 15 16 11 8 8 9 9 10 10 9 9 9 10 9 9 8 8 8 8 8 8 8 8 8 6 8 13 8 7 7 8 8 10 11 8 6 6 6 8 6 6 7 6 6 6 6 6 10 10 6 6 6 6 8 10 10 9 9 9 12 9 9 11 9 9 13 10 8 6 6 6 8 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no093_b01.b1 MSMg01no093_b01.b1 CHROMAT_FILE:
MSMg01no093_b01.b1 PHD_FILE: MSMg01no093_b01.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:47:12 2005
         (115 letters)



>mm_chr12_106838559_106839069
          Length = 511

 Score =  180 bits (93), Expect = 2e-50
 Identities = 108/115 (93%), Gaps = 4/115 (3%)
 Strand = Plus / Plus

                                                                       
Query: 1   caaggagagagccaacccacttacttgctgggggacctcacacttagtcagggggcagcc 60
           |||||||||||  ||||||||||||||||||||||||||||||||||||||||||    |
Sbjct: 201 caaggagagaggaaacccacttacttgctgggggacctcacacttagtcaggggg----c 256

                                                                  
Query: 61  agcgagagctaacacgtgagtgtagaacacatggaaagtggcaggcagaacgaag 115
           || ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 257 agtgagagctaacacgtgagtgtagaacacatggaaagtggcaggcagaacgaag 311


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 3
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 115
Length of database: 511
Length adjustment: 8
Effective length of query: 107
Effective length of database: 503
Effective search space:    53821
Effective search space used:    53821
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information