MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-193H20
Chromosome	12 (Build37)
Map Location	105,891,636 - 105,892,108
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Serpina6, Gm46, Serpina1f, EG435316, Serpina1b, Serpina1d, LOC667951, LOC628801, Serpina1a, LOC667954, Serpina1c, Serpina1e, Serpina11, Serpina9, Serpina12, Serpina4-ps1, Serpina5, Serpina3a, Serpina3b, Serpina3c, LOC435318, LOC628883, Serpina3f, LOC667997, Serpina3g, Serpina3h, EG628900, EG238395, Serpina3k, EG628916, Serpina3m, Serpina3n, Gsc
Downstream gene	Dicer1, Clmn, 4831426I19Rik, Snhg10, Glrx5, LOC100040301, Tcl1b2, Tcl1b1, Tcl1b5, Tcl1b3, Tcl1b4, Tcl1, LOC100040310, 2810011L19Rik, LOC100040339, EG668081, D430019H16Rik, Bdkrb2, Bdkrb1, 2410024A21Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Serpina6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12401 MGI:88278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194604 MGI:2684892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Serpina1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68348 MGI:1915598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG435316 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435316 MGI:3648024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Serpina1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20701 MGI:891970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20703 MGI:891968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 262 ESTs, 50 Proteins pseudo : _no_value

name	LOC628801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Serpina1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20700 MGI:891971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Serpina1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20702 MGI:891969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20704 MGI:891967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380780 MGI:2685741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71907 MGI:1919157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68054 MGI:1915304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina4-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321018 MGI:2448363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Serpina5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268591 MGI:107817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74069 MGI:1921319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Serpina3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271047 MGI:2182835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16625 MGI:102848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins pseudo : _no_value

name	LOC628883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Serpina3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238393 MGI:2182838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins pseudo : _no_value

name	Serpina3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20715 MGI:105046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546546 MGI:2182839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628900 MGI:3643496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	EG238395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238395 MGI:3645874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 36 Proteins

name	Serpina3k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20714 MGI:98377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628916 MGI:3648113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins pseudo : _no_value

name	Serpina3m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20717 MGI:98378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3n (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20716 MGI:105045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14836 MGI:95841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dicer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192119 MGI:2177178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4831426I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212073 MGI:2442408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Snhg10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69434 MGI:1916684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glrx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73046 MGI:1920296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Tcl1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27381 MGI:1351609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27379 MGI:1351601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27382 MGI:1351635
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27378 MGI:1351600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27380 MGI:1351604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tcl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21432 MGI:1097166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040310 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2810011L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69952 MGI:1917202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	LOC100040339 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG668081 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668081 MGI:3645292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	D430019H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268595 MGI:2443127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 131 ESTs

name	Bdkrb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12062 MGI:102845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bdkrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12061 MGI:88144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410024A21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76559 MGI:1923809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131216 GeneID:12401 MGI:88278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 6 transcript_id : NM_007618.2

name	Gm46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393116 GeneID:194604 MGI:2684892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 46, (NCBI) transcript_id : XM_112098.3

name	Serpina1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404228 GeneID:68348 MGI:1915598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1f transcript_id : NM_026687.1

name	Serpina1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102380 GeneID:20701 MGI:891970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) preptidase inhibitor, clade A, member 1b transcript_id : NM_009244.4

name	Serpina1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102381 GeneID:20703 MGI:891968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1d transcript_id : NM_009246.3

name	Serpina1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102382 GeneID:20700 MGI:891971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1a transcript_id : NM_009243.3

name	Serpina1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881808 GeneID:20702 MGI:891969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1c transcript_id : NM_009245.2

name	Serpina1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881810 GeneID:20704 MGI:891967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1e transcript_id : NM_009247.2

name	Serpina11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556295 GeneID:380780 MGI:2685741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 transcript_id : NM_199314.1

name	Serpina9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130410 GeneID:71907 MGI:1919157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 transcript_id : NM_027997.2

name	Serpina12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129832 GeneID:68054 MGI:1915304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 transcript_id : NM_026535.2

name	Serpina5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385329 GeneID:268591 MGI:107817
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 5 transcript_id : NM_172953.2

name	Serpina3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393057 GeneID:74069 MGI:1921319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : serine (or cysteine) peptidase inhibitor, clade A, member 3A, transcript variant 1 transcript_id : XM_282560.6

name	Serpina3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387237 GeneID:271047 MGI:2182835
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3B transcript_id : NM_173024.2

name	Serpina3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130776 GeneID:16625 MGI:102848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3C transcript_id : NM_008458.2

name	Serpina3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368572 GeneID:238393 MGI:2182838
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3F transcript_id : NM_001033335.2

name	Serpina3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476055 GeneID:20715 MGI:105046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3G transcript_id : NM_009251.1

name	Serpina3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517725 GeneID:546546 MGI:2182839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3H transcript_id : NM_001034870.2

name	EG628900 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263490 GeneID:628900 MGI:3643496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : predicted gene, EG628900 transcript_id : XM_893705.2

name	EG238395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393122 GeneID:238395 MGI:3645874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 36 Proteins product : predicted gene, EG238395 transcript_id : XM_138240.6

name	Serpina3k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859635 GeneID:20714 MGI:98377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3K transcript_id : NM_011458.1

name	Serpina3m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678094 GeneID:20717 MGI:98378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3M transcript_id : NM_009253.1

name	Serpina3n (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130503300 GeneID:20716 MGI:105045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3N transcript_id : NM_009252.2

name	Gsc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754075 GeneID:14836 MGI:95841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : goosecoid transcript_id : NM_010351.1

name	Dicer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168270 GeneID:192119 MGI:2177178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dicer1, Dcr-1 homolog (Drosophila) transcript_id : NM_148948.2

name	Clmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816902 GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmin transcript_id : NM_001040682.1

name	Clmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816763 GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmin transcript_id : NM_053155.2

name	4831426I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607450 GeneID:212073 MGI:2442408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831426I19 gene transcript_id : NM_172500.2

name	4831426I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607452 GeneID:212073 MGI:2442408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831426I19 gene transcript_id : NM_001042699.1

name	Glrx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365117 GeneID:73046 MGI:1920296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaredoxin 5 homolog (S. cerevisiae) transcript_id : NM_028419.2

name	LOC100040301 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263495 GeneID:100040301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to T-cell leukemia protein Tcl1b3a transcript_id : XM_001474463.1

name	Tcl1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305554 GeneID:27381 MGI:1351609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 2 transcript_id : NM_013775.1

name	Tcl1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130857 GeneID:27379 MGI:1351601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 1 transcript_id : NM_013773.2

name	Tcl1b5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305560 GeneID:27382 MGI:1351635
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 5 transcript_id : NM_013776.1

name	Tcl1b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305556 GeneID:27378 MGI:1351600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 3 transcript_id : NM_013772.1

name	Tcl1b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130858 GeneID:27380 MGI:1351604
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell leukemia/lymphoma 1B, 4 transcript_id : NM_013774.2

name	Tcl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981970 GeneID:21432 MGI:1097166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-cell lymphoma breakpoint 1 transcript_id : NM_009337.2

name	LOC100040310 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263499 GeneID:100040310
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040310 transcript_id : XM_001474482.1

name	2810011L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263531 GeneID:69952 MGI:1917202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 2810011L19 gene transcript_id : XM_001476131.1

name	LOC100040339 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263501 GeneID:100040339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040339 transcript_id : XM_001474521.1

name	EG668081 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393126 GeneID:668081 MGI:3645292
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668081 transcript_id : XM_994212.1

name	D430019H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263533 GeneID:268595 MGI:2443127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 131 ESTs product : RIKEN cDNA D430019H16 gene transcript_id : XM_001476158.1

name	Bdkrb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560615 GeneID:12062 MGI:102845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bradykinin receptor, beta 2 transcript_id : NM_009747.2

name	Bdkrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83582803 GeneID:12061 MGI:88144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bradykinin receptor, beta 1 transcript_id : NM_007539.2

name	2410024A21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118197273 GeneID:76559 MGI:1923809
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410024A21 gene transcript_id : NM_029654.4

name	Serpina6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680856 CCDS:CCDS26135.1 GeneID:12401 MGI:88278
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : corticosteroid binding globulin product : serine (or cysteine) proteinase inhibitor, clade A, member 6 protein_id : NP_031644.1

name	Gm46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943105 GeneID:194604 MGI:2684892
definition	codon_start : 1 product : similar to serine proteinase inhibitor HongrES1 protein_id : XP_112098.2

name	Serpina1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404229 CCDS:CCDS26137.1 GeneID:68348 MGI:1915598
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epididymal serine protease inhibitor product : epsin protein_id : NP_080963.1

name	Serpina1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76881807 CCDS:CCDS26138.1 GeneID:20701 MGI:891970
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 2; alpha-1-antiproteinase; serine protease inhibitor 1-2 product : serine (or cysteine) proteinase inhibitor, clade A, member 1b protein_id : NP_033270.3

name	Serpina1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678085 CCDS:CCDS26139.1 GeneID:20703 MGI:891968
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1-antitrypsin 1-4; alpha-1 protease inhibitor 4; serine protease inhibitor 1-4 product : serine (or cysteine) proteinase inhibitor, clade A, member 1d protein_id : NP_033272.1

name	Serpina1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678079 CCDS:CCDS26140.1 GeneID:20700 MGI:891971
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 1; alpha-1-antiproteinase; serine protease inhibitor 1-1; alpha-1-antitrypsin 2 product : serine (or cysteine) proteinase inhibitor, clade A, member 1a protein_id : NP_033269.1

name	Serpina1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678083 CCDS:CCDS26141.1 GeneID:20702 MGI:891969
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : apha-1 protease inhibitor 3; serine protease inhibitor 1-3 product : serine (or cysteine) proteinase inhibitor, clade A, member 1c protein_id : NP_033271.1

name	Serpina1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678087 CCDS:CCDS26142.1 GeneID:20704 MGI:891967
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 5; alpha-1-antitrypsin 1-5; serine protease inhibitor 1-5 product : serine (or cysteine) proteinase inhibitor, clade A, member 1e protein_id : NP_033273.1

name	Serpina11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556296 CCDS:CCDS26143.1 GeneID:380780 MGI:2685741
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 protein_id : NP_955018.1

name	Serpina9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313654 CCDS:CCDS26144.1 GeneID:71907 MGI:1919157
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 protein_id : NP_082273.1

name	Serpina12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386038 CCDS:CCDS26145.1 GeneID:68054 MGI:1915304
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : vaspin; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 product : visceral adipose-specific SERPIN protein_id : NP_080811.1

name	Serpina5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370468 CCDS:CCDS26146.1 GeneID:268591 MGI:107817
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : protein C inhibitor; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 5 protein_id : NP_766541.1

name	Serpina3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263522 GeneID:74069 MGI:1921319
definition	codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade A, member 3A isoform 1 protein_id : XP_282560.6

name	Serpina3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370538 CCDS:CCDS26147.1 GeneID:271047 MGI:2182835
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : antitrypsin; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A, member 3B product : serine (or cysteine) peptidase inhibitor, clade A, member 3B protein_id : NP_766612.1

name	Serpina3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680586 CCDS:CCDS26148.1 GeneID:16625 MGI:102848
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : kallikrein binding protein; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3C product : serine (or cysteine) proteinase inhibitor, clade A, member 3C protein_id : NP_032484.1

name	Serpina3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701824 CCDS:CCDS26149.1 GeneID:238393 MGI:2182838
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : antitrypsin; alpha-1 antiproteinasin product : serine (or cysteine) peptidase inhibitor, clade A, member 3F protein_id : NP_001028507.1

name	Serpina3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476056 GeneID:20715 MGI:105046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor 2-1; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3G protein_id : NP_033277.1

name	Serpina3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517726 GeneID:546546 MGI:2182839
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3H product : serine (or cysteine) peptidase inhibitor, clade A, member 3H protein_id : NP_001030042.2

name	EG628900 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263491 GeneID:628900 MGI:3643496
definition	codon_start : 1 product : similar to Serpina3h protein protein_id : XP_898798.2

name	EG238395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20859253 GeneID:238395 MGI:3645874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_138240.1

name	Serpina3k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859636 GeneID:20714 MGI:98377
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor 2; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3K product : serine (or cysteine) proteinase inhibitor, clade A, member 3K protein_id : NP_035588.1

name	Serpina3m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678095 GeneID:20717 MGI:98378
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor-2 related sequence 1; contrapsin-like; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3M protein_id : NP_033279.1

name	Serpina3n (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130503301 CCDS:CCDS26152.1 GeneID:20716 MGI:105045
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : serine protease inhibitor 2-2; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3N protein_id : NP_033278.2

name	Gsc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754076 CCDS:CCDS26153.1 GeneID:14836 MGI:95841
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : goosecoid protein_id : NP_034481.1

name	Dicer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168271 GeneID:192119 MGI:2177178
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004525 - ribonuclease III activity [Evidence ISS] [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0035196 - miRNA-mediated gene silencing, production of miRNAs [Evidence IMP]; GO:0030422 - RNA interference, production of siRNA [Evidence IDA]; GO:0030423 - RNA interference, targeting of mRNA for destruction [Evidence ISS]; GO:0006396 - RNA processing [Evidence IDA]; GO:0019827 - stem cell maintenance [Evidence IMP] codon_start : 1 note : endoribonuclease Dicer product : dicer1 protein_id : NP_683750.2

name	Clmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816903 GeneID:94040 MGI:2136957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : calmin isoform b protein_id : NP_001035772.1

name	Clmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816764 GeneID:94040 MGI:2136957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : calmin isoform a protein_id : NP_444385.2

name	4831426I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607453 GeneID:212073 MGI:2442408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant 1 product : nesprin-3 isoform alpha protein_id : NP_001036164.1

name	4831426I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607451 GeneID:212073 MGI:2442408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant 2 product : nesprin-3 isoform beta protein_id : NP_766088.2

name	Glrx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312153 CCDS:CCDS26154.1 GeneID:73046 MGI:1920296
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : glutaredoxin 5 protein_id : NP_082695.1

name	LOC100040301 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263496 GeneID:100040301
definition	codon_start : 1 product : similar to T-cell leukemia protein Tcl1b3a protein_id : XP_001474513.1

name	Tcl1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305555 GeneID:27381 MGI:1351609
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 2 protein_id : NP_038803.1

name	Tcl1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305553 GeneID:27379 MGI:1351601
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 1 protein_id : NP_038801.1

name	Tcl1b5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305561 GeneID:27382 MGI:1351635
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 5 protein_id : NP_038804.1

name	Tcl1b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305557 GeneID:27378 MGI:1351600
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 3 protein_id : NP_038800.1

name	Tcl1b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305559 GeneID:27380 MGI:1351604
definition	codon_start : 1 product : T-cell leukemia/lymphoma 1B, 4 protein_id : NP_038802.1

name	Tcl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678257 GeneID:21432 MGI:1097166
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0045120 - pronucleus [Evidence IDA] codon_start : 1 product : T-cell lymphoma breakpoint 1 protein_id : NP_033363.1

name	LOC100040310 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263500 GeneID:100040310
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474532.1

name	2810011L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263532 GeneID:69952 MGI:1917202
definition	codon_start : 1 product : hypothetical protein LOC69952 protein_id : XP_001476181.1

name	LOC100040339 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263502 GeneID:100040339
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474571.1

name	EG668081 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393127 GeneID:668081 MGI:3645292
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999306.1

name	D430019H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263534 GeneID:268595 MGI:2443127
definition	codon_start : 1 product : hypothetical protein LOC268595 protein_id : XP_001476208.1

name	Bdkrb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560616 GeneID:12062 MGI:102845
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : kinin B2 product : bradykinin receptor, beta 2 protein_id : NP_033877.2

name	Bdkrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671632 CCDS:CCDS26155.1 GeneID:12061 MGI:88144
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : kinin B1 product : bradykinin receptor, beta 1 protein_id : NP_031565.1

name	2410024A21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118197274 GeneID:76559 MGI:1923809
definition	codon_start : 1 product : hypothetical protein LOC76559 protein_id : NP_083930.5

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 5 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 4 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 3 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 2 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 1 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 4 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 3 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 2 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 1 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 6 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 5 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 4 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 3 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 2 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 1 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 4 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 3 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 2 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 1 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 7 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 6 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 5 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 4 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 3 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 2 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 1 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 1 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 2 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 3 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 4 pseudo : _no_value

name	LOC667951 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263517 GeneID:667951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 262 ESTs, 50 Proteins product : similar to Serine (or cysteine) peptidase inhibitor, clade A, member 1a pseudo : _no_value transcript_id : XR_032235.1

name	Serpina4-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872153 GeneID:321018 MGI:2448363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 4, pseudogene 1 pseudo : _no_value transcript_id : NR_002861.1

name	LOC667997 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263524 GeneID:667997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to developmentally regulated GTP binding protein 2 pseudo : _no_value transcript_id : XR_032399.1

name	Snhg10 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141803286 GeneID:69434 MGI:1916684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA host gene (non-protein coding) 10 transcript_id : NR_003145.2

clone name	MSMg01-370H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-154A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190H02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-193H20.T7 (MSMg01no193_h20.b1)	MSMg01-193H20.TJ (MSMg01no193_h20.g1)
ACC	AG382773	AG382774
length	746	747
length of high quality (start - end)	---	476 (77 - 552)
definition	CHROMAT_FILE: MSMg01no193_h20.b1 PHD_FILE: MSMg01no193_h20.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:11:56 2005	CHROMAT_FILE: MSMg01no193_h20.g1 PHD_FILE: MSMg01no193_h20.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:11:56 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATGCGAACTGATTCCCTATGAGTTTCAGTGCGGCCTTACTTCTTGATCT CGATCCTGTGATACAACTATGATGTATAGAAGTGAAAGGAATCAATGCAG AACTGTCTCAAAAGCTTTGGTATGGAACACTGACTCTTGCAACTGATATT TCTTCGTTAAACTTTGTCTACTAAGCGAATCATCTCACCCCTTCTGAACT GCATGGCATACGCGTTACTAAGCTGAGTAACACTCCTGAACTGGCCTTAG GCATATACATCCTGTGTGACTAACAGCTATACACAACTCAGTAGATACTA TCAGCTGTGAACACAGCATAATCTCTGGATAGAAACTACTCGTTTCATGT TGTCCGCATCCCTGCTTCCACCCAGTCCTGGAGCATCATCATGAACTGAT GAGCTGATTGCTGAGCTTTCTCTGGGCAATGATTCTGTTCAGCGGACAAG CACCACGGCTTCTGCTGCACAGAAACTGTCCATGCTGAATGAATATAGTT ACCCTCATCCAGACAGCATCCCTCCCACTCTGCTGCAAATCAAGTGTCAT TGATCTGTCCCAGACGGGGCATGTACTAAGAAGAGGTATCTCATGCCTAT GCTGCTCTGTGCAACGTGTGACAGCAAGACTTACTCTCTATGCTTACGAG ATGCGCTCTCAGCTTGGTCTTCAAGCTGAAGCAGTAGACACGAGTG	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXTTTGCTTTCCAACACGCATGTGCT CAGCTGAGCAGCAATCCTAACTCCCCTGTGCAGGAACTCTCTGTCTGCAC TCACAGGTTTTCTGTTTGTAGCAAGAGGCCTAGGGCTTGGGACAAGGCAG GCAGGAGGTTCACTCAACAAGGGGCTGCCACAAAACTCCATCGGTGACAA GCATGGTATCTTAAAACAGAGCAGAGCCAAAGGGAGGCCCCACTTGTATG TAGATTTGTGAGGGACTCATCAGGAGCCTCTGCCATGGAACTGAGGAGGC CAAGAGCTCCCACTATTTCAGAGGGGTGAGCTGAGAAGAGCTGTGATGTC ATTAGATCCCTGACCAATAGGGCGGGAGCTGGGACCAGGTGGGCAATATA TGCCCTGGAAAGAGAAGGCCAGCAAATCTGGGGCTCCACTACTTACATCA TAAGAAGGAAAAAGAATTTCACCTCAAAGAGTGGGAGAGGAGGGAGGGAA GGGAGGTATCTNCNNNNTTTGTTTGTTNTCTGTGGGTGCCAGCTTCTCTG CTGTGCTGCGTGCTCTGGCGCCACGACGGCTACCCTTGGCTAGGACCTAC CATTTCTAGAAGGCCTATGTGTAATGTAGAATTCCTGTACCTTAACAAAA CAGCTCTCTCTTTATTTTGTACACAATGTCTTGATGCACCTGCCTGA
quality values	Open. Hide. 8 8 8 8 8 8 8 17 34 30 37 37 37 31 31 30 30 30 30 33 37 37 37 39 43 30 28 28 28 28 30 35 23 18 9 9 9 9 22 23 19 19 12 17 17 30 33 53 33 26 10 13 12 13 10 10 19 17 20 16 13 10 10 9 10 12 10 8 8 8 11 13 14 14 10 15 8 8 8 8 12 12 12 12 21 21 24 18 12 12 12 12 12 15 11 15 15 19 12 12 12 11 11 11 11 12 16 11 9 9 9 9 9 10 15 11 13 11 10 10 10 10 10 11 18 16 20 20 24 15 14 16 13 15 10 11 11 11 11 11 11 11 11 11 12 10 10 16 12 12 10 19 19 29 18 23 23 23 24 20 31 20 20 20 28 28 41 28 18 8 8 8 8 8 10 11 12 16 18 22 15 13 13 15 18 28 24 27 12 21 18 21 19 24 15 8 8 8 8 12 20 32 30 16 14 14 13 32 26 19 14 11 11 10 8 8 8 8 8 12 24 32 32 22 24 17 14 10 20 10 10 10 10 10 10 18 23 11 11 13 15 18 15 11 11 16 12 10 10 14 19 19 23 12 10 10 12 12 8 8 8 8 8 8 8 10 15 10 13 10 10 11 11 10 10 10 10 10 10 18 19 19 12 18 21 23 20 16 14 14 13 19 11 11 12 15 26 28 33 29 36 32 15 12 12 15 18 22 36 32 17 12 12 12 11 9 9 11 9 11 11 12 16 18 18 14 14 14 24 18 14 12 12 10 14 8 8 8 12 8 8 8 10 16 18 32 20 20 20 38 36 32 32 16 14 9 9 9 9 10 9 13 10 9 9 9 19 19 15 15 11 24 15 18 15 24 24 24 20 15 19 12 10 12 13 13 14 24 18 20 32 21 15 13 15 14 14 14 30 19 21 14 18 12 12 12 13 28 21 30 30 18 23 14 18 18 19 15 18 24 21 21 12 12 12 12 12 12 22 20 31 20 20 23 32 23 25 14 11 14 13 11 11 12 12 11 13 12 13 13 16 16 16 13 10 14 16 16 19 20 17 14 9 6 8 8 11 16 24 26 21 18 15 12 11 11 11 11 17 18 25 17 17 17 18 15 12 12 19 22 21 15 10 10 9 13 8 8 8 10 10 11 9 8 8 8 10 8 9 12 22 23 19 12 12 12 12 12 15 16 13 11 10 10 10 10 11 11 12 12 22 12 11 11 16 15 11 11 11 13 13 29 25 28 12 12 12 11 11 11 13 21 19 18 16 15 13 11 12 11 12 10 10 9 9 10 17 21 23 28 28 28 21 21 9 9 9 9 9 18 21 21 21 11 11 11 11 11 12 12 12 12 11 12 12 18 24 15 21 18 22 18 19 18 24 15 12 12 19 19 12 12 11 12 11 11 11 11 11 11 11 15 15 15 12 12 12 6 6 6 6 8 8 8 9 10 10 11 15 15 23 19 9 9 9 11 12 21 23 28 20 15 15 12 12 12 12 12 11 12 12 8 8 9 10 10 10 11 12 15 10 10 13 14 14 14 15 19 12 14 10 10 9 9 11 16 19 15 16 12 19 22 12 8 8 6 6 6 6 8 8 12 11 12 16 19 17 12 8 8 8 8 8 15 19 15 17 18 19 17 17 10 9 9 9 9 9 9 9 10 10 16 9 9 8 8 8 8 9 9 9 9 9 10 10 10	Open. Hide. 7 7 7 13 13 8 8 8 8 15 23 37 37 37 41 43 48 59 53 57 57 57 57 57 53 53 53 57 57 53 43 35 21 13 13 15 15 14 26 19 33 33 48 32 68 68 68 68 53 51 50 50 50 50 51 68 68 68 68 57 35 26 17 26 23 28 24 24 24 32 25 41 50 50 50 50 57 57 57 59 59 48 57 47 48 42 46 41 41 37 50 35 35 35 50 50 43 43 41 50 50 57 57 54 38 38 14 14 14 32 32 52 57 57 57 57 44 38 21 20 20 20 38 27 43 18 18 11 24 27 43 57 57 57 57 57 57 57 57 57 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 52 57 57 57 57 52 52 43 43 41 44 43 52 52 57 59 57 52 52 52 59 43 43 35 43 62 52 52 62 62 52 47 62 62 62 62 62 62 62 43 39 39 39 62 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 43 39 43 35 35 62 62 62 52 62 52 62 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 43 39 39 43 43 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 43 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 39 39 39 43 43 52 52 62 62 62 52 62 62 62 62 62 62 62 62 62 43 62 41 43 43 62 62 62 52 52 52 52 62 62 62 62 62 62 62 52 43 43 31 43 43 38 26 12 12 12 18 26 28 35 20 20 35 38 39 43 43 43 43 44 59 57 39 39 43 43 52 52 59 59 59 59 52 45 45 45 43 44 43 44 43 43 43 57 57 57 57 68 68 57 57 59 57 35 35 31 35 32 44 19 19 17 24 24 21 15 11 13 11 24 24 38 38 52 59 59 57 59 59 59 59 50 57 52 52 52 52 59 50 43 43 23 43 43 57 57 57 54 50 57 50 44 37 43 43 57 57 48 48 48 48 57 57 57 57 59 59 57 59 44 57 43 57 57 57 57 68 59 57 57 57 57 57 54 48 48 48 48 48 48 48 59 48 48 48 48 48 59 57 54 54 54 54 54 48 48 48 43 43 36 32 32 39 39 48 59 47 47 43 41 41 43 47 59 59 50 50 41 41 39 39 16 11 12 12 11 18 23 22 22 8 8 8 8 8 3 0 3 0 0 0 0 3 17 17 9 9 9 9 15 9 3 0 3 8 8 6 6 6 6 8 8 13 16 18 11 12 15 11 13 10 10 15 8 7 9 6 8 6 6 8 10 10 10 10 10 10 9 9 9 9 9 9 9 10 10 9 10 9 9 9 14 13 15 19 12 10 9 8 8 8 8 8 8 10 16 15 12 10 10 9 8 8 11 10 11 11 8 8 8 8 8 8 8 10 10 10 10 8 8 8 8 8 8 10 10 10 16 10 9 11 8 7 7 10 12 15 16 11 10 10 10 9 9 8 8 8 8 6 6 8 10 11 7 6 6 6 8 6 6 6 8 8 10 8 10 10 10 10 8 8 9 9 6 8 8 8 8 8 10 11 11 16 15 11 8 8 8 8 8 8 8 10 10 8 8 8 9 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no193_h20.g1 MSMg01no193_h20.g1 CHROMAT_FILE:
MSMg01no193_h20.g1 PHD_FILE: MSMg01no193_h20.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:11:56 2005
         (476 letters)



>mm_chr12_105891436_105892311
          Length = 876

 Score =  907 bits (469), Expect = 0.0
 Identities = 472/473 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   tttgctttccaacacgcatgtgctcagctgagcagcaatcctaactcccctgtgcaggaa 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tttgctttccaacacgcatgtgctcagctgagcagcaatcctaactcccctgtgcaggaa 260

                                                                       
Query: 61  ctctctgtctgcactcacaggttttctgtttgtagcaagaggcctagggcttgggacaag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 ctctctgtctgcactcacaggttttctgtttgtagcaagaggcctagggcttgggacaag 320

                                                                       
Query: 121 gcaggcaggaggttcactcaacaaggggctgccacaaaactccatcggtgacaagcatgg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 gcaggcaggaggttcactcaacaaggggctgccacaaaactccatcggtgacaagcatgg 380

                                                                       
Query: 181 tatcttaaaacagagcagagccaaagggaggccccacttgtatgtagatttgtgagggac 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 tatcttaaaacagagcagagccaaagggaggccccacttgtatgtagatttgtgagggac 440

                                                                       
Query: 241 tcatcaggagcctctgccatggaactgaggaggccaagagctcccactatttcagagggg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 441 tcatcaggagcctctgccatggaactgaggaggccaagagctcccactatttcagggggg 500

                                                                       
Query: 301 tgagctgagaagagctgtgatgtcattagatccctgaccaatagggcgggagctgggacc 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 tgagctgagaagagctgtgatgtcattagatccctgaccaatagggcgggagctgggacc 560

                                                                       
Query: 361 aggtgggcaatatatgccctggaaagagaaggccagcaaatctggggctccactacttac 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 aggtgggcaatatatgccctggaaagagaaggccagcaaatctggggctccactacttac 620

                                                                
Query: 421 atcataagaaggaaaaagaatttcacctcaaagagtgggagaggagggaggga 473
           |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 atcataagaaggaaaaagaatttcacctcaaagagtgggagaggagggaggga 673


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 25
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 476
Length of database: 876
Length adjustment: 10
Effective length of query: 466
Effective length of database: 866
Effective search space:   403556
Effective search space used:   403556
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information