MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-372D06
Chromosome	12 (Build37)
Map Location	110,842,234 - 110,842,676
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Evl, Degs2, LOC668164, Yy1, Slc25a29, AI132487, Wars, Wdr25, BM948371, LOC668194, Dlk1, Gtl2, Rtl1, 6430411K18Rik
Downstream gene	B830012L14Rik, LOC100040715, LOC100040724, LOC675987, LOC100041509, LOC100040746, 3110009F21Rik, Dio3as, Dio3, EG629595, EG668245, LOC100040799, Ppp2r5c, 9430024F10Rik, Dync1h1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Evl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14026 MGI:1194884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Degs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70059 MGI:1917309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668164 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 512 ESTs, 3 Proteins pseudo : _no_value

name	Yy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22632 MGI:99150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214663 MGI:2444911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI132487 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104910 MGI:2144766
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22375 MGI:104630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212198 MGI:3045255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2 Proteins

name	BM948371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380785 MGI:3044626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 4 Proteins

name	LOC668194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Dlk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13386 MGI:94900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17263 MGI:1202886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs

name	Rtl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353326 MGI:2656842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430411K18Rik (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:76880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B830012L14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320085 MGI:2443332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100040724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC675987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041509 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 467 ESTs, 10 Proteins pseudo : _no_value

name	LOC100040746 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040746
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	3110009F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67280 MGI:1914530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST

name	Dio3as (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353504 MGI:2664395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dio3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107585 MGI:1306782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG629595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629595 MGI:3647486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 799 ESTs, 5 Proteins

name	EG668245 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668245 MGI:3647644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 4 Proteins pseudo : _no_value

name	LOC100040799 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs

name	Ppp2r5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26931 MGI:1349475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	9430024F10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77271 MGI:1924521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Dync1h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13424 MGI:103147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Evl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254643 GeneID:14026 MGI:1194884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ena-vasodilator stimulated phosphoprotein transcript_id : NM_007965.2

name	Degs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345826 GeneID:70059 MGI:1917309
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : degenerative spermatocyte homolog 2 (Drosophila), lipid desaturase transcript_id : NM_027299.3

name	Yy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130338 GeneID:22632 MGI:99150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : YY1 transcription factor transcript_id : NM_009537.3

name	Slc25a29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370761 GeneID:214663 MGI:2444911
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29 transcript_id : NM_181328.3

name	AI132487 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60097913 GeneID:104910 MGI:2144766
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI132487 transcript_id : NM_001012310.1

name	Wars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328205 GeneID:22375 MGI:104630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptophanyl-tRNA synthetase transcript_id : NM_011710.2

name	Wdr25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263513 GeneID:212198 MGI:3045255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2 Proteins product : WD repeat domain 25 transcript_id : XM_001474974.1

name	BM948371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263515 GeneID:380785 MGI:3044626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 4 Proteins product : expressed sequence BM948371, transcript variant 1 transcript_id : XM_354696.6

name	Dlk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802319 GeneID:13386 MGI:94900
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : delta-like 1 homolog (Drosophila) transcript_id : NM_010052.3

name	Rtl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46309584 GeneID:353326 MGI:2656842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retrotransposon-like 1 transcript_id : NM_184109.1

name	B830012L14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263544 GeneID:320085 MGI:2443332
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA B830012L14 gene transcript_id : XM_001476751.1

name	LOC100040715 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263518 GeneID:100040715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040715 transcript_id : XM_001475122.1

name	LOC100040724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263520 GeneID:100040724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100040724 transcript_id : XM_001475138.1

name	3110009F21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263547 GeneID:67280 MGI:1914530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST product : RIKEN cDNA 3110009F21 gene transcript_id : XM_001476790.1

name	Dio3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111494233 GeneID:107585 MGI:1306782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deiodinase, iodothyronine type III transcript_id : NM_172119.2

name	EG629595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393139 GeneID:629595 MGI:3647486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 795 ESTs, 5 Proteins product : predicted gene, EG629595 transcript_id : XM_894495.2

name	LOC100040799 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263525 GeneID:100040799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs product : hypothetical protein LOC100040799 transcript_id : XM_001475293.1

name	Ppp2r5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346019 GeneID:26931 MGI:1349475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), gamma isoform transcript_id : NM_012023.2

name	Ppp2r5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346005 GeneID:26931 MGI:1349475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), gamma isoform transcript_id : NM_001081457.1

name	Ppp2r5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125346153 GeneID:26931 MGI:1349475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 2, regulatory subunit B (B56), gamma isoform transcript_id : NM_001081458.1

name	9430024F10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263527 GeneID:77271 MGI:1924521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 9430024F10 gene transcript_id : XM_001475368.1

name	Dync1h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288916 GeneID:13424 MGI:103147
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein cytoplasmic 1 heavy chain 1 transcript_id : NM_030238.2

name	Evl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254644 CCDS:CCDS26161.1 GeneID:14026 MGI:1194884
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017124 - SH3 domain binding [Evidence IDA] GO_process : GO:0030048 - actin filament-based movement [Evidence NAS]; GO:0045010 - actin nucleation [Evidence NAS]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0007411 - axon guidance [Evidence NAS]; GO:0051016 - barbed-end actin filament capping [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0007399 - nervous system development [Evidence ISS]; GO:0009887 - organ morphogenesis [Evidence ISS]; GO:0030168 - platelet activation [Evidence NAS] codon_start : 1 exception : mismatches in translation product : Ena-vasodilator stimulated phosphoprotein protein_id : NP_031991.2

name	Degs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754029 CCDS:CCDS26162.1 GeneID:70059 MGI:1917309
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016717 - oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water [Evidence IEA]; GO:0000170 - sphingosine hydroxylase activity [Evidence IDA] GO_process : GO:0006636 - fatty acid desaturation [Evidence IEA] codon_start : 1 product : sphingolipid delta 4 desaturase/C-4 hydroxylase protein_id : NP_081575.2

name	Yy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982421 CCDS:CCDS26163.1 GeneID:22632 MGI:99150
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0031519 - PcG protein complex [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP] [Evidence IGI]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : UCRBP transcription factor; delta transcription factor; Yin Yang 1 product : YY1 transcription factor protein_id : NP_033563.2

name	Slc25a29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044469 CCDS:CCDS26164.1 GeneID:214663 MGI:2444911
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0015227 - acyl carnitine transporter activity [Evidence IDA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006844 - acyl carnitine transport [Evidence IDA] codon_start : 1 product : solute carrier family 25, member 29 protein_id : NP_851845.1

name	AI132487 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60097914 CCDS:CCDS26165.1 GeneID:104910 MGI:2144766
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial hepatocellular carcinoma-downregulated carrier protein protein_id : NP_001012310.1

name	Wars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328206 CCDS:CCDS26166.1 GeneID:22375 MGI:104630
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004830 - tryptophan-tRNA ligase activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA]; GO:0006436 - tryptophanyl-tRNA aminoacylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tryptophanyl-tRNA synthetase protein_id : NP_035840.2

name	Wdr25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263514 GeneID:212198 MGI:3045255
definition	codon_start : 1 product : WD repeat domain 25 protein_id : XP_001475024.1

name	BM948371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263516 GeneID:380785 MGI:3044626
definition	codon_start : 1 product : similar to Brain-enriched guanylate kinase-associated protein isoform 1 protein_id : XP_354696.6

name	Dlk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816918 CCDS:CCDS26168.1 GeneID:13386 MGI:94900
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : delta-like 1 homolog protein_id : NP_034182.2

name	Rtl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46309585 CCDS:CCDS26170.1 GeneID:353326 MGI:2656842
definition	codon_start : 1 product : retrotransposon-like 1 protein_id : NP_908998.1

name	B830012L14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263545 GeneID:320085 MGI:2443332
definition	codon_start : 1 product : hypothetical protein LOC320085 protein_id : XP_001476801.1

name	LOC100040715 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263519 GeneID:100040715
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475172.1

name	LOC100040724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263521 GeneID:100040724
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475188.1

name	3110009F21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263548 GeneID:67280 MGI:1914530
definition	codon_start : 1 product : hypothetical protein LOC67280 protein_id : XP_001476840.1

name	Dio3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26006467 CCDS:CCDS26171.1 GeneID:107585 MGI:1306782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0004800 - thyroxine 5'-deiodinase activity [Evidence IMP] GO_process : GO:0042446 - hormone biosynthesis [Evidence IEA]; GO:0040018 - positive regulation of body size [Evidence IMP]; GO:0042404 - thyroid hormone catabolism [Evidence IMP] codon_start : 1 product : deiodinase, iodothyronine type III protein_id : NP_742117.1 transl_except : (pos:111517949..111517951,aa:Sec)

name	EG629595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943174 GeneID:629595 MGI:3647486
definition	codon_start : 1 product : similar to hCG1640785 protein_id : XP_899588.1

name	LOC100040799 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263526 GeneID:100040799
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475343.1

name	Ppp2r5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346020 GeneID:26931 MGI:1349475
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; Band 8A product : gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform a protein_id : NP_036153.2

name	Ppp2r5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346006 GeneID:26931 MGI:1349475
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; Band 8A product : gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform b protein_id : NP_001074926.1

name	Ppp2r5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125346154 GeneID:26931 MGI:1349475
definition	GO_component : GO:0005634 - nucleus [Evidence TAS]; GO:0000159 - protein phosphatase type 2A complex [Evidence IEA] GO_function : GO:0008601 - protein phosphatase type 2A regulator activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; Band 8A product : gamma isoform of regulatory subunit B56, protein phosphatase 2A isoform c protein_id : NP_001074927.1

name	9430024F10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263528 GeneID:77271 MGI:1924521
definition	codon_start : 1 product : hypothetical protein LOC77271 protein_id : XP_001475418.1

name	Dync1h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288917 GeneID:13424 MGI:103147
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 note : dynein heavy chain, retrograde transport; legs at odd angle; cytoplasmic dynein heavy chain; region surrounding P-loop 1 product : dynein, cytoplasmic, heavy chain 1 protein_id : NP_084514.2

name	LOC668194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668194
definition	number : 1 pseudo : _no_value

name	LOC668194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668194
definition	number : 2 pseudo : _no_value

name	LOC675987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675987
definition	number : 1 pseudo : _no_value

name	LOC675987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675987
definition	number : 2 pseudo : _no_value

name	LOC675987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675987
definition	number : 3 pseudo : _no_value

name	LOC100040746 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040746
definition	number : 1 pseudo : _no_value

name	LOC100040746 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040746
definition	number : 2 pseudo : _no_value

name	LOC100040746 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040746
definition	number : 3 pseudo : _no_value

name	LOC668164 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263542 GeneID:668164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 512 ESTs, 3 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_032875.1

name	Gtl2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263543 GeneID:17263 MGI:1202886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 87 ESTs product : GTL2, imprinted maternally expressed untranslated mRNA transcript_id : XR_035483.1

name	6430411K18Rik (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:84872140 GeneID:76880
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430411K18 gene transcript_id : NR_002848.1

name	LOC100041509 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263546 GeneID:100041509
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 467 ESTs, 10 Proteins product : similar to QM protein pseudo : _no_value transcript_id : XR_032910.1

name	Dio3as (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872161 GeneID:353504 MGI:2664395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deiodinase, iodothyronine type III, antisense transcript_id : NR_002866.1

name	EG668245 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149263523 GeneID:668245 MGI:3647644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 4 Proteins product : predicted gene, EG668245 pseudo : _no_value transcript_id : XR_002158.2

clone name	MSMg01-319D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-104F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-308I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-434P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491J05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-532C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-372D06.T7 (MSMg01no372_d06.b1)	MSMg01-372D06.TJ (MSMg01no372_d06.g1)
ACC	AG478522	AG478523
length	826	763
length of high quality (start - end)	46 (69 - 114)	443 (74 - 516)
definition	CHROMAT_FILE: MSMg01no372_d06.b1 PHD_FILE: MSMg01no372_d06.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:10:53 2005	CHROMAT_FILE: MSMg01no372_d06.g1 PHD_FILE: MSMg01no372_d06.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:10:54 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	AAATTTGCCGCGCTAAACGACTCACATATCCACAAAACCGCGGAATTCCA CCTGCCTCCCTCCCAAGTGTTGAGATTAAAGGCCTGCAGCACCACACCCA GCTGTGTGTGTGTCTCATCTGTGTCTGTCTGTGTGTGTCTGTCTGTGTGT CTCTCCAACCACACAAAAACAAAACCCAAACAAAAACAAACCCCAACACC ACACCACCAACACCACCACACCCTACACCACCTACAAACACACACCCCAC AAAAAAAAAACACAAAAACCCAACACAATAAAAAAACCAAAACCCCCCCC CAACCCCAAAATTCTTCCACCAACACAAAAAAAAAACACACACCCCAACA TAAACATCCCCCACCCCCCAAAACCCACAACCAAAACCCCTAAATCCCAA CCAAAACCAAAACCCCCACCACAAAAAAACCCACAACAACTAAAAACCCA TACCCCCACCCCCCCCCACCATACCCACCAACACCCCATCACACCCCAAT AACACCCCCCCCATCCCCCCTATATCCTTCCCCTCAACCACCCCCCCTCT TACCCCTCTAAAACCCCCAACACTAACACCCCACCACCAAAAAATAACAC ACCAAAAATACCCCCCAACCCAAAACCCTAATCCCCACACACAACACACC CCCTATAACACACACATCCCCATCACACCACAATACCCCCATACAACAAC TGTCCCCTAACCCATACCCACCACCACCAAAATAACACCACCCCCCAACA CCAAAAAAACATACAACAAACAACAAATCACCACAAATAAAAACACACAC AAACCACCCAAAACACAAAACAACAG	ATAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXCAAAATCCTGAGAAGGCCTTATAAATG AGTCCAGAGGATTAAGATCCTCAAACAGCCACCTTTGCAAGGGGCAAGGA CTCTCCCTCTCCACCAGGTATTGTCGCTTTTCTATTTCAGATTTACCGGG GCATTGCTTCCCTGATCTTACCGAGGGGGTTAGTAGCTATAGTTAGGGTT CTAAGATCTTCTCCCTCCTAAAAGGGCATTATTCTGCTCTCCCTGTGCCT CTAGTCCCCATCAGGGGCATCATGATGATCAGCATCCTCTCTGCAGGTAA CTAAGTCTTCCTTAGTTACACACAGAGAGACAAGGATGCCAGCTTATTAA GGCTGTGTGACCTCCACTCCTCTAGGAAGCCCCTTACCCTTAAAAGAACA AAGTACAAGAGAGATGGGCTTACCTGCCTGGCAGGGCACTGATTCTGGTC TGCTGGTTCTCCATGGTGACTTAAGACAATTCACCCTGGAAGGGGACAGG GCTCCCTCAGGAATCACCAGCCCCCTGTCCCCTGAGGGGNAGTGAGCCCT ATTTGTAAAATGAAAATCTCCAGTTAGTTCCATTTCTGGGAAAACCCTGG TAATTTGCCAGTTCTCCCCAACTAAAATTTCTAAATAGTCAAAAAAATTT TCCCTAGAACTTTTTTTCCCGGAGCTTTTTCGCCACTTATTTTTTTTCCT TTCTTGGGAAAAG
quality values	Open. Hide. 11 11 9 9 14 9 10 12 9 9 9 8 7 9 9 17 19 11 10 18 19 9 8 13 13 10 8 8 8 8 11 9 11 11 11 11 15 17 9 19 27 20 10 10 9 9 10 23 25 30 23 21 12 8 8 6 6 6 7 10 11 9 17 23 23 11 11 11 16 25 25 42 25 25 11 23 25 32 41 20 20 15 16 20 12 12 25 16 23 23 34 34 53 53 53 53 53 27 26 11 11 17 12 12 14 21 21 41 23 23 15 13 9 10 10 9 9 9 10 10 10 11 11 11 11 10 10 9 9 9 9 12 12 12 11 11 10 10 15 10 13 10 11 11 11 11 12 11 11 11 15 10 10 9 9 9 10 10 8 8 8 8 8 8 6 6 9 9 11 11 11 11 18 12 14 11 16 11 9 9 8 7 7 8 8 8 8 8 10 6 6 8 8 9 9 10 10 9 9 9 9 7 7 9 10 10 8 8 8 8 8 11 11 10 10 10 10 8 6 6 8 10 8 8 8 8 10 10 12 18 28 13 17 12 18 11 10 10 10 8 9 9 9 8 8 8 8 8 8 8 8 8 13 13 14 16 15 10 10 10 9 9 11 11 11 13 8 8 8 8 10 14 12 8 8 8 8 7 7 7 8 8 8 12 12 8 8 8 8 8 8 11 16 11 10 15 12 15 15 18 8 8 8 8 8 8 10 8 8 10 9 6 6 8 8 10 10 8 6 6 8 8 11 8 10 9 8 13 8 10 10 16 10 9 10 10 10 8 8 8 12 8 8 8 9 10 8 10 10 8 8 8 8 8 10 9 9 9 13 10 6 6 6 6 6 7 12 15 10 8 8 8 8 8 8 8 6 8 8 8 11 11 16 12 11 12 9 8 10 6 6 6 11 8 9 6 8 6 6 6 7 11 11 15 15 11 16 10 9 9 10 10 10 10 8 8 10 8 8 8 8 6 6 8 8 13 19 22 19 11 9 8 8 6 6 6 6 8 8 8 8 8 6 6 9 10 10 14 8 8 8 9 9 9 12 13 11 11 11 10 10 9 9 9 8 8 8 10 8 8 8 8 8 6 7 13 16 10 9 8 8 8 10 13 10 9 10 8 8 6 6 8 8 12 16 23 10 10 8 8 8 10 6 6 8 8 9 9 9 9 9 10 9 10 10 13 10 13 8 10 8 8 8 6 6 6 7 7 8 8 11 12 11 9 9 9 9 10 10 10 10 10 10 10 12 9 10 10 8 8 9 10 12 9 10 9 10 10 10 10 13 19 10 8 8 13 16 6 8 6 6 8 8 9 11 9 9 10 19 12 10 8 8 8 10 7 7 8 8 11 10 11 11 8 8 8 8 10 8 8 8 11 12 19 19 11 13 10 10 10 13 16 18 12 8 8 8 8 8 15 15 10 9 9 7 7 8 10 13 13 19 15 17 11 11 7 7 8 8 8 6 6 8 8 6 6 6 6 10 10 10 8 11 6 6 6 6 8 7 7 8 8 8 8 10 8 8 8 9 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 8 9 14 10 10 9 8 8 8 10 10 8 8 8 8 6 6 7 7 8 8 10 8 8 8 6 6 8 8 8 8 9 10 8 8 7 6 11 8 8 9 8 8 8 8 10 8 9 8 8 8 8 8 8 8 8 8 8 7 6 8 6 8 8 8 8 8 8 9 10 17 21 21 15 12 8 7 7 8 10 10 6 6 6 6 11 15 13 8 8 8 16 10 8 8 10 8 10 10 10 10 9 10 13 10 11 10 11 9 9 9 7 15 8 11 9 8 8 6 6 8 7 6 6 6 9 8 8 8 8 8 8 12 14 15 15 10 6 6 6 6 6	Open. Hide. 6 8 8 6 6 8 19 17 9 9 9 11 11 27 27 23 23 27 23 37 44 39 39 44 44 30 27 13 8 6 6 6 8 8 13 9 10 10 29 22 37 36 36 37 39 47 47 47 47 47 44 44 39 37 37 23 15 9 9 9 9 9 15 13 18 18 28 23 33 33 33 36 36 50 50 50 50 57 57 53 53 57 57 57 53 57 57 57 57 57 68 68 68 68 68 68 51 51 47 47 50 68 50 50 50 50 50 50 50 50 50 50 50 51 68 68 68 57 57 57 57 57 57 57 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 54 54 54 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 59 68 68 68 68 68 57 57 43 35 35 35 41 35 35 42 44 52 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 68 68 68 68 68 68 68 59 59 57 54 59 59 59 59 59 59 59 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 59 59 59 68 68 68 68 68 59 59 59 59 59 59 59 68 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 57 57 54 54 54 54 57 57 57 59 59 59 57 57 68 57 57 57 59 48 48 48 46 39 43 43 43 39 43 43 47 47 47 47 48 48 48 48 48 41 41 41 41 41 41 39 32 28 32 35 32 37 37 43 59 37 39 46 46 39 37 36 25 19 13 19 11 20 16 25 18 33 19 32 28 30 27 33 36 36 19 19 14 14 12 19 21 13 9 9 7 7 6 7 9 15 15 22 24 17 15 17 17 25 22 9 9 9 9 16 16 21 17 17 20 18 21 22 28 28 27 30 30 26 28 19 15 8 12 8 8 8 8 8 15 19 22 20 19 32 31 15 13 8 8 8 12 11 12 14 14 18 20 17 19 3 0 3 8 8 8 13 10 9 8 10 10 10 11 14 14 21 22 22 11 15 10 10 10 9 9 8 8 8 9 8 8 8 8 8 8 10 9 9 9 8 10 9 9 9 9 11 10 19 15 15 22 19 16 16 9 9 6 6 8 6 7 8 8 8 8 8 9 11 10 14 17 20 11 10 9 9 9 8 10 10 10 10 13 13 11 12 10 12 12 12 12 12 11 11 8 6 6 6 8 8 8 8 8 8 19 12 9 9 10 10 17 10 10 9 10 10 10 10 10 10 10 13 20 26 29 17 10 10 8 8 8 8 10 8 8 8 10 10 10 6 6 6 6 10 8 10 10 8 7 6 6 6 6 8 10 17 17 16 11 11 8 10 6 6 6 8 8 8 8 8 8 8 7 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no372_d06.g1 MSMg01no372_d06.g1 CHROMAT_FILE:
MSMg01no372_d06.g1 PHD_FILE: MSMg01no372_d06.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:10:54 2005
         (443 letters)



>mm_chr12_110842034_110842876
          Length = 843

 Score =  849 bits (439), Expect = 0.0
 Identities = 442/443 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   caaaatcctgagaaggccttataaatgagtccagaggattaagatcctcaaacagccacc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 643 caaaatcctgagaaggccttataaatgagtccagaggattaagatcctcaaacagccacc 584

                                                                       
Query: 61  tttgcaaggggcaaggactctccctctccaccaggtattgtcgcttttctatttcagatt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 583 tttgcaaggggcaaggactctccctctccaccaggtattgtcgcttttctatttcagatt 524

                                                                       
Query: 121 taccggggcattgcttccctgatcttaccgagggggttagtagctatagttagggttcta 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 523 taccggggcattgcttccctgatcttaccgagggggttagtagctatagttagggttcta 464

                                                                       
Query: 181 agatcttctccctcctaaaagggcattattctgctctccctgtgcctctagtccccatca 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 463 agatcttctccctcctaaaagggcattattctgctctccctgtgcctctagtccccatca 404

                                                                       
Query: 241 ggggcatcatgatgatcagcatcctctctgcaggtaactaagtcttccttagttacacac 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 403 ggggcatcatgatgatcagcatcctctctgcaggtaactaagtcttccttagttacacac 344

                                                                       
Query: 301 agagagacaaggatgccagcttattaaggctgtgtgacctccactcctctaggaagcccc 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 agagagacaaggatgccagcttattaaggctgtgtgacctccactcctctaggaagcccc 284

                                                                       
Query: 361 ttacccttaaaagaacaaagtacaagagagatgggcttacctgcctggcagggcactgat 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 ttacccttaaaagaacaaagtacaagagagatgggcttacctgcctggcagggcactgat 224

                                  
Query: 421 tctggtctgctggttctccatgg 443
           ||||| |||||||||||||||||
Sbjct: 223 tctgggctgctggttctccatgg 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 20
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 443
Length of database: 843
Length adjustment: 10
Effective length of query: 433
Effective length of database: 833
Effective search space:   360689
Effective search space used:   360689
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information