MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-536F22
Chromosome	12 (Build37)
Map Location	17,754,805 - 17,755,049
singlet/doublet	singlet
Overlap gene	Hpcal1
Upstream gene	Greb1, E2f6, Rock2, Pqlc3, 2410004P03Rik, EG668514, Kcnf1, LOC100043299, Pdia6, Atp6v1c2, Nol10, LOC672501, Odc1, LOC100042522, LOC100042528
Downstream gene	EG668525, LOC673341, EG245297, LOC100042573, LOC668539, LOC100043324, LOC636282, EG632781, LOC668541, LOC673160, 5730507C01Rik, EG668553, LOC668558
Link	Open Mouse BAC browser

Click to get alignment info.

name	Greb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268527 MGI:2149712
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50496 MGI:1354159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rock2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19878 MGI:107926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pqlc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217430 MGI:2444067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410004P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73667 MGI:1920917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	EG668514 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668514 MGI:3644934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Kcnf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382571 MGI:2687399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 816 ESTs, 6 Proteins pseudo : _no_value

name	Pdia6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71853 MGI:1919103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v1c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68775 MGI:1916025
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217431 MGI:2684913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672501 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Odc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18263 MGI:97402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042522 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Hpcal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53602 MGI:1855689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668525 MGI:3647701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	LOC673341 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins pseudo : _no_value

name	EG245297 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245297 MGI:3646928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC668539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins pseudo : _no_value

name	LOC100043324 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 230 ESTs, 7 Proteins

name	LOC636282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG632781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632781 MGI:3648655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC668541 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 146 ESTs, 6 Proteins pseudo : _no_value

name	LOC673160 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	5730507C01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236366 MGI:1917882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668553 MGI:3645302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 23 Proteins pseudo : _no_value

name	LOC668558 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins pseudo : _no_value

name	Greb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348314 GeneID:268527 MGI:2149712
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene regulated by estrogen in breast cancer protein transcript_id : NM_015764.2

name	E2f6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15149490 GeneID:50496 MGI:1354159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 6 transcript_id : NM_033270.1

name	Rock2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134949012 GeneID:19878 MGI:107926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho-associated coiled-coil containing protein kinase 2 transcript_id : NM_009072.2

name	Pqlc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369809 GeneID:217430 MGI:2444067
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PQ loop repeat containing transcript_id : NM_172574.1

name	2410004P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392419 GeneID:73667 MGI:1920917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : RIKEN cDNA 2410004P03 gene, transcript variant 1 transcript_id : XM_126830.7

name	EG668514 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94392421 GeneID:668514 MGI:3644934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG668514 transcript_id : XM_001001921.1

name	Kcnf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348935 GeneID:382571 MGI:2687399
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily F, member 1 transcript_id : NM_201531.2

name	Pdia6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382008 GeneID:71853 MGI:1919103
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein disulfide isomerase associated 6 transcript_id : NM_027959.2

name	Atp6v1c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526869 GeneID:68775 MGI:1916025
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V1 subunit C2 transcript_id : NM_133699.1

name	Nol10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606026 GeneID:217431 MGI:2684913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 10 transcript_id : NM_001008421.1

name	LOC672501 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262787 GeneID:672501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC672501 transcript_id : XM_001478358.1

name	Odc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888588 GeneID:18263 MGI:97402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine decarboxylase, structural 1 transcript_id : NM_013614.2

name	LOC100042522 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262789 GeneID:100042522
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042522 transcript_id : XM_001478374.1

name	Hpcal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354525 GeneID:53602 MGI:1855689
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hippocalcin-like 1 transcript_id : NM_016677.2

name	EG668525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149262791 GeneID:668525 MGI:3647701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : predicted gene, EG668525 transcript_id : XM_001004778.2

name	EG245297 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392588 GeneID:245297 MGI:3646928
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG245297 transcript_id : NM_001018086.2

name	LOC100042573 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262793 GeneID:100042573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to development and differentiation enhancing factor 2 transcript_id : XM_001478449.1

name	LOC100043324 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262876 GeneID:100043324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 230 ESTs, 7 Proteins product : similar to BNIP3L protein transcript_id : XM_001480439.1

name	LOC673160 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149262795 GeneID:673160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001478468.1

name	5730507C01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367376 GeneID:236366 MGI:1917882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730507C01 gene transcript_id : NM_001033157.2

name	E2f6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15149491 GeneID:50496 MGI:1354159
definition	GO_component : GO:0005662 - DNA replication factor A complex [Evidence IC]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0000083 - G1/S-specific transcription in mitotic cell cycle [Evidence IGI]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transcriptional repressor E2F6 product : E2F transcription factor 6 protein_id : NP_150373.1

name	Rock2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134949013 GeneID:19878 MGI:107926
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : Rho-associated coiled-coil forming kinage 2 product : Rho-associated coiled-coil forming kinase 2 protein_id : NP_033098.2

name	Pqlc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369810 CCDS:CCDS25824.1 GeneID:217430 MGI:2444067
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : PQ loop repeat containing 3 protein_id : NP_766162.1

name	2410004P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392420 GeneID:73667 MGI:1920917
definition	codon_start : 1 product : hypothetical protein LOC73667 isoform 1 protein_id : XP_126830.6

name	EG668514 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94392422 GeneID:668514 MGI:3644934
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001921.1

name	Kcnf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41462415 CCDS:CCDS25825.1 GeneID:382571 MGI:2687399
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence ISS]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage-gated channel, subfamily F, member 1 protein_id : NP_963289.1

name	Pdia6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037267 CCDS:CCDS25826.1 GeneID:71853 MGI:1919103
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0003756 - protein disulfide isomerase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 note : protein disulfide isomerase-related protein; thioredoxin domain containing 7 product : protein disulfide isomerase-associated 6 protein_id : NP_082235.1

name	Atp6v1c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526870 CCDS:CCDS25827.1 GeneID:68775 MGI:1916025
definition	GO_component : GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IDA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA] GO_process : GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, V1 subunit C, isoform 2 product : vacuolar H+ ATPase C2 protein_id : NP_598460.1

name	Nol10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606027 CCDS:CCDS25828.1 GeneID:217431 MGI:2684913
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : nucleolar protein 10 protein_id : NP_001008421.1

name	LOC672501 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262788 GeneID:672501
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478408.1

name	Odc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:131888589 CCDS:CCDS25829.1 GeneID:18263 MGI:97402
definition	EC_number : 4.1.1.17 GO_function : GO:0016831 - carboxy-lyase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004586 - ornithine decarboxylase activity [Evidence IEA] GO_process : GO:0001822 - kidney development [Evidence IMP]; GO:0006596 - polyamine biosynthesis [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP] codon_start : 1 product : ornithine decarboxylase, structural 1 protein_id : NP_038642.2

name	LOC100042522 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262790 GeneID:100042522
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478424.1

name	Hpcal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949055 CCDS:CCDS25830.1 GeneID:53602 MGI:1855689
definition	codon_start : 1 note : neural visinin-like protein 3; visinin like 3; neural visinin-like 3 product : hippocalcin-like 1 protein_id : NP_057886.1

name	EG668525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149262792 GeneID:668525 MGI:3647701
definition	codon_start : 1 product : predicted gene, EG668383 protein_id : XP_001004778.2

name	EG245297 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66348040 GeneID:245297 MGI:3646928
definition	codon_start : 1 product : hypothetical protein LOC245297 protein_id : NP_001018096.1

name	LOC100042573 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262794 GeneID:100042573
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478499.1

name	LOC100043324 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262877 GeneID:100043324
definition	codon_start : 1 product : similar to BNIP3L protein protein_id : XP_001480489.1

name	LOC673160 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149262796 GeneID:673160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478518.1

name	5730507C01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701598 GeneID:236366 MGI:1917882
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC236366 protein_id : NP_001028329.1

name	LOC100042528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042528
definition	number : 2 pseudo : _no_value

name	LOC100042528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042528
definition	number : 1 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 1 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 2 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 3 pseudo : _no_value

name	LOC673341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673341
definition	number : 4 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 1 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 2 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 3 pseudo : _no_value

name	LOC636282 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636282
definition	number : 4 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 1 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 2 pseudo : _no_value

name	EG632781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632781
definition	number : 3 pseudo : _no_value

name	LOC100043299 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262874 GeneID:100043299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 816 ESTs, 6 Proteins product : similar to ribosomal protein S23 pseudo : _no_value transcript_id : XR_034675.1

name	LOC668539 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262875 GeneID:668539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_034692.1

name	LOC668541 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262878 GeneID:668541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 146 ESTs, 6 Proteins product : similar to protein phosphatase 1cgamma pseudo : _no_value transcript_id : XR_034696.1

name	EG668553 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149262797 GeneID:668553 MGI:3645302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 23 Proteins product : predicted gene, EG668553 pseudo : _no_value transcript_id : XR_033730.1

name	LOC668558 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149262798 GeneID:668558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 12 Proteins product : similar to neural visinin-like Ca2+-binding protein type 3 pseudo : _no_value transcript_id : XR_033734.1

clone name	MSMg01-414K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486A23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-548H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366N01
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-215B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226E22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-536F22.T7 (MSMg01no536_f22.b1)	MSMg01-536F22.TJ (MSMg01no536_f22.g1)
ACC	AG603599	AG603600
length	765	752
length of high quality (start - end)	545 (57 - 601)	246 (58 - 303)
definition	CHROMAT_FILE: MSMg01no536_f22.b1 PHD_FILE: MSMg01no536_f22.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:14:27 2005	CHROMAT_FILE: MSMg01no536_f22.g1 PHD_FILE: MSMg01no536_f22.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:14:27 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NTAAAAAAATTCTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXCGCGGAATTCAGTACTGCCCCTGGTATTACACTATCACTTTGAG TAAAAGTTAGATCACCTCCCTTCACAGGAATCTACCATCACCAAGGAAGA AAGAAGTTTCTGACCGTAGGAGAAACCAGAGTAGATACTTAGAACTATAG CTGAGTTACACCCATATACAGGAATTTACAATGGTTTAGGAAGTAGATCC GTCTGTGGTTTTAGAGTATTGCATTATTCATGAGATGGTTAGCTAGAACG GAACTCCCTAGTTAGAACCATGACTTGGGTGTGAAAGCCCTTGCCCTAGG AGTGAAAAGATCTCACACCTGGTTTCTAAGACTATAGCTGACCTTAGATA GGGCTGTCTCAGTTATTTTATTGCCCAGTCCCTGCCAGTCTTTGCGTTTT CATTCCTCTGTTCTGTATAAGAGTCATTAAGCATCCGGTTACCTCATTTG TACCTTGTGGGTATGTCACCCAACTTCCTTATTGTCTTCTGCATAAAAAG TCTGATGTTCGATTTGACAAAATACATTCAGATCCAACACAACCTCTCCT GTGTGCATCTGTCTGTCAATTCATCCTACGCTTTGCCCACCCAAGACTAG AGACCTGTTCCACGAAGACAAAGGGGCCCAGAGGGTCTGCGGCAACCTAC ATTCACTGGATCACTTGCCCATCACACACAACCAATCCCTTGCATAAAAC TTAATCACCACGGAA	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXACTAAGCAGGAGGTGTAGGCTACAATCTGTCCTGTCTCCACGC CTACACTCCCTTGGGAGGCTGAGATAGATTTGAGGGTACTTGCGGGCTTT GATCAGAGGCCAGAGCTGAGGAGGGGCAGTTGTCTGTGTGTGTGAGGAAG GCAGAGAGCATGAGTCCAGCATTCATTCCTGTCTCATGCCCTTTGAGACA CTCAAGGCAAAGCGGTTAGGGAAGGACACAAATTGTACTTTTTTTTTTTG GTACACAAATTGCCTTTTNTTTTTTTTTTTTTTTTTTTTTTTTGGGGGGG GGCTGTTGGGACAGATTCCAATACCGAAGTGGCAATCCGACCTGGATGTC CGCCCCGCATTTTCCTCTTAACAGCTGTGTGACCTTGGACAGCTATCCCA TCTCCCGAATTTTCTTTCTTCCTAAGAATGGACAGGGTCACCCCCTCCCA CTGAGTCCAAACAGCAAGCCACACTCTCTGGTAACAAAGCTACTGAGCAC CAAGGCGCCCAAACAGCTGCCTTGGCTGCCCTGGTTTATATCTTATTAAC CCACACACACACTCTTACACACACACACTCACACTCACACACCCTCACAC CCGAGTCAACTAGAAATCCTGCAATTATAAATCCGGGAAAGTAATGCTAA GTGATAAATATTCTTTTTGCGTAACCCCCTTTTTCCCTAAATTTTAAATG TT
quality values	Open. Hide. 0 3 18 19 21 15 6 6 6 6 6 6 8 11 11 11 11 10 10 19 10 10 11 16 16 22 30 23 18 16 18 31 28 33 41 59 30 30 30 30 20 19 25 12 15 12 10 10 12 18 26 22 24 28 24 27 24 47 47 44 22 21 16 19 23 23 30 33 33 33 33 15 15 15 20 28 28 28 32 29 37 39 50 57 50 50 50 50 50 53 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 50 50 50 50 51 68 68 68 68 68 68 68 68 68 51 68 50 50 50 50 50 50 68 68 68 68 68 68 68 68 68 68 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 50 68 68 68 68 57 57 57 59 57 57 57 57 57 50 57 57 57 52 52 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 57 57 54 54 54 57 57 57 59 59 57 57 57 57 57 57 57 57 57 57 57 57 59 59 59 59 57 57 57 52 52 52 43 47 57 57 57 57 57 57 59 57 57 57 52 52 52 59 59 57 54 54 59 59 59 59 59 59 59 59 59 52 52 52 43 43 38 50 50 57 44 50 37 37 32 38 32 50 43 57 50 59 50 50 43 43 43 50 50 43 43 43 57 59 48 48 41 41 28 28 28 37 37 31 28 28 44 44 57 57 43 43 43 43 43 43 57 57 47 47 37 37 37 47 44 47 35 35 35 44 44 43 43 39 39 39 47 47 35 35 35 42 36 31 32 23 23 19 41 18 20 20 34 32 35 35 39 37 37 30 30 30 37 37 47 47 46 41 41 39 30 30 17 17 17 30 30 39 34 30 25 25 34 41 59 59 37 37 30 30 28 27 26 28 28 25 22 22 34 34 35 31 31 37 30 30 28 22 25 34 37 37 39 40 34 32 31 20 20 32 32 24 23 14 14 14 24 26 30 25 24 25 26 36 36 35 31 21 25 11 11 11 11 11 15 15 31 28 28 13 13 12 23 11 11 11 18 20 24 22 22 25 22 26 32 37 37 37 37 37 32 30 30 22 15 19 12 12 9 14 8 8 8 11 16 18 18 18 18 14 21 21 24 19 26 15 11 10 12 10 12 18 17 17 11 11 9 12 12 16 17 22 25 26 30 21 20 14 11 10 10 15 15 15 23 18 23 12 12 12 11 11 15 14 14 13 14 10 9 9 9 10 10 12 17 28 22 19 22 18 18 24 28 19 24 23 15 15 13 12 12 11 11 11 12 11 11 12 15 18 21 12 11 11 11 8 9 8 10 8 9 6 7 7 6 6 8 8 8 8 8 10 10 8 8 8 11 11 9 11 9 12 12 12	Open. Hide. 12 12 25 25 32 37 37 41 37 37 44 41 37 43 27 22 11 11 12 22 17 10 11 11 16 21 33 39 39 39 25 21 18 19 19 25 22 37 37 37 37 43 32 29 32 30 30 30 46 46 46 33 33 36 36 38 36 42 42 42 59 50 53 50 50 50 53 53 53 50 50 50 68 68 68 68 68 48 48 41 41 41 42 48 68 68 68 68 68 68 68 68 68 50 57 47 47 47 57 57 57 57 57 54 42 43 43 57 57 57 57 68 68 68 68 68 68 68 68 68 68 51 51 47 50 50 51 57 50 50 51 68 68 68 68 68 57 57 57 57 68 68 68 68 68 68 68 68 68 50 50 50 50 50 50 57 57 57 57 57 57 57 57 57 57 68 57 57 47 47 47 57 57 68 68 68 68 68 68 68 68 59 59 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 54 54 54 57 57 57 57 54 54 54 54 48 57 59 59 59 43 44 39 39 39 43 47 48 57 57 57 59 59 48 48 48 46 41 37 39 31 31 31 34 34 39 41 41 43 46 40 41 48 48 40 40 46 59 37 37 32 29 29 32 31 31 20 20 20 32 32 39 35 35 35 37 43 43 59 59 59 59 59 59 59 43 34 30 22 23 23 20 19 17 17 17 30 21 21 17 16 15 16 15 17 3 0 3 27 27 41 41 43 59 47 35 35 35 39 39 48 48 50 50 47 47 44 39 25 18 12 18 22 27 23 19 18 13 19 10 9 10 9 10 10 11 16 20 15 12 11 11 11 12 12 15 14 15 15 17 17 12 14 13 14 14 20 18 16 12 11 11 12 15 12 11 11 9 12 12 15 15 18 18 18 12 12 11 12 12 18 27 31 32 22 20 20 23 23 27 18 19 18 20 15 16 11 11 11 11 11 12 11 16 12 14 14 14 14 15 14 13 15 15 21 12 18 15 19 15 15 12 12 12 12 12 20 21 19 13 15 15 13 13 18 11 15 13 20 19 22 22 21 22 12 14 12 16 12 11 18 19 19 11 11 11 11 18 11 13 13 19 15 20 13 18 11 11 11 19 27 17 17 17 12 12 9 9 9 16 11 11 11 11 11 15 15 21 15 15 12 12 11 11 12 12 12 9 9 9 11 11 15 11 11 12 17 11 11 11 11 11 15 17 17 15 10 10 10 10 10 14 11 11 11 12 12 12 12 10 10 6 6 6 6 7 7 14 18 24 13 11 11 13 11 10 10 10 10 10 11 14 14 10 15 10 10 10 9 8 8 8 7 7 7 10 10 15 12 15 10 10 8 8 8 11 8 8 8 8 10 15 20 13 13 13 18 21 15 11 17 13 13 13 11 11 11 12 15 10 19 17 27 12 12 7 7 8 15 15 19 10 13 11 11 11 16 10 11 8 8 8 8 9 10 16 18 13 12 9 12 12 12 13 13 8 6 8 6 6 6 8 8 10 12 12 9 9 9 9 9 8 8 8 8 8 8 9 11 8 7 7 6 6 6 12 10 10 9 10 9 8 8 8 8 6 6 9 9 9 9 9 9 11 14 8 8 8 8 8 8 12 12 11 15 6 6 6 6 8 6 10 10 14 12 11 11 18 11 9 14 12 11 11 11 13 10 10 11 11 13 11 10 9 8 6 6 6 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no536_f22.g1 MSMg01no536_f22.g1 CHROMAT_FILE:
MSMg01no536_f22.g1 PHD_FILE: MSMg01no536_f22.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 21:14:27 2005
         (246 letters)



>mm_chr12_17754605_17755249
          Length = 645

 Score =  468 bits (242), Expect = e-136
 Identities = 245/246 (99%), Gaps = 1/246 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   actaagcaggaggtgtaggctacaatctgtcctgtctccacgcctacactcccttgggag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 actaagcaggaggtgtaggctacaatctgtcctgtctccacgcctacactcccttgggag 260

                                                                       
Query: 61  gctgagatagatttgagggtacttgcgggctttgatcagaggccagagctgaggaggggc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gctgagatagatttgagggtacttgcgggctttgatcagaggccagagctgaggaggggc 320

                                                                       
Query: 121 agttgtctgtgtgtgtgaggaaggcagagagcatgagtccagcattcattcctgtctcat 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 agttgtctgtgtgtgtgaggaaggcagagagcatgagtccagcattcattcctgtctcat 380

                                                                       
Query: 181 gccctttgagacactcaaggcaaagcggttagggaaggacacaaattgtacttttttttt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 gccctttgagacactcaaggcaaagcggttagggaaggacacaaattgtacttttttttt 440

                 
Query: 241 ttggta 246
           | ||||
Sbjct: 441 t-ggta 445


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 15
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 246
Length of database: 645
Length adjustment: 9
Effective length of query: 237
Effective length of database: 636
Effective search space:   150732
Effective search space used:   150732
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information