MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-539H22
Chromosome	12 (Build37)
Map Location	105,312,891 - 105,313,553
singlet/doublet	singlet
Overlap gene	none
Upstream gene	9030205A07Rik, Prima1, EG544888, Asb2, Otub2, Ddx24, D12Ertd647e, Ifi27, 1810023F06Rik, 8430415E04Rik, Serpina10, Serpina6, Gm46, Serpina1f, EG435316, Serpina1b, Serpina1d, LOC667951, LOC628801, Serpina1a, LOC667954, Serpina1c, Serpina1e, Serpina11, Serpina9, Serpina12
Downstream gene	Serpina4-ps1, Serpina5, Serpina3a, Serpina3b, Serpina3c, LOC435318, LOC628883, Serpina3f, LOC667997, Serpina3g, Serpina3h, EG628900, EG238395, Serpina3k, EG628916, Serpina3m, Serpina3n, Gsc, Dicer1, Clmn, 4831426I19Rik, Snhg10, Glrx5
Link	Open Mouse BAC browser

Click to get alignment info.

name	9030205A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217843 MGI:2684729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prima1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170952 MGI:1926097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544888 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544888 MGI:3647570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	Asb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65256 MGI:1929743
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otub2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68149 MGI:1915399
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27225 MGI:1351337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D12Ertd647e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52668 MGI:1277180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 5 mRNAs

name	Ifi27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76933 MGI:1924183
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810023F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217845 MGI:1916390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	8430415E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74521 MGI:1921771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:217847 MGI:2667725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12401 MGI:88278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194604 MGI:2684892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Serpina1f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68348 MGI:1915598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG435316 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435316 MGI:3648024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Serpina1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20701 MGI:891970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina1d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20703 MGI:891968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 262 ESTs, 50 Proteins pseudo : _no_value

name	LOC628801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Serpina1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20700 MGI:891971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667954 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Serpina1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20702 MGI:891969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina1e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20704 MGI:891967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380780 MGI:2685741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71907 MGI:1919157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68054 MGI:1915304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina4-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321018 MGI:2448363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Serpina5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268591 MGI:107817
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74069 MGI:1921319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins

name	Serpina3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271047 MGI:2182835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16625 MGI:102848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC435318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins pseudo : _no_value

name	LOC628883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Serpina3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238393 MGI:2182838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins pseudo : _no_value

name	Serpina3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20715 MGI:105046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546546 MGI:2182839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628900 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628900 MGI:3643496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	EG238395 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238395 MGI:3645874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 36 Proteins

name	Serpina3k (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20714 MGI:98377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628916 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628916 MGI:3648113
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins pseudo : _no_value

name	Serpina3m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20717 MGI:98378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina3n (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20716 MGI:105045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14836 MGI:95841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dicer1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192119 MGI:2177178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clmn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4831426I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212073 MGI:2442408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Snhg10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69434 MGI:1916684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glrx5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73046 MGI:1920296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9030205A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486611 GeneID:217843 MGI:2684729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9030205A07 Gene transcript_id : NM_001081017.1

name	Prima1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872179 GeneID:170952 MGI:1926097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich membrane anchor 1 transcript_id : NM_133364.2

name	EG544888 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393107 GeneID:544888 MGI:3647570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : predicted gene, EG544888 transcript_id : XM_619025.3

name	Asb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956121 GeneID:65256 MGI:1929743
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 2 transcript_id : NM_023049.1

name	Otub2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801789 GeneID:68149 MGI:1915399
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain, ubiquitin aldehyde binding 2 transcript_id : NM_026580.2

name	Ddx24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328252 GeneID:27225 MGI:1351337
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 transcript_id : NM_020494.2

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732710 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_026790.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732716 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194066.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732718 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194067.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732720 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194068.1

name	D12Ertd647e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34732722 GeneID:52668 MGI:1277180
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 12, ERATO Doi 647, expressed transcript_id : NM_194069.1

name	Ifi27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:44771123 GeneID:76933 MGI:1924183
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon, alpha-inducible protein 27 transcript_id : NM_029803.1

name	1810023F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703895 GeneID:217845 MGI:1916390
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810023F06 gene transcript_id : NM_145449.1

name	8430415E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803539 GeneID:74521 MGI:1921771
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 8430415E04 gene transcript_id : NM_028980.2

name	Serpina10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892606 GeneID:217847 MGI:2667725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 transcript_id : NM_144834.3

name	Serpina6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131216 GeneID:12401 MGI:88278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 6 transcript_id : NM_007618.2

name	Gm46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393116 GeneID:194604 MGI:2684892
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 46, (NCBI) transcript_id : XM_112098.3

name	Serpina1f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77404228 GeneID:68348 MGI:1915598
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1f transcript_id : NM_026687.1

name	Serpina1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102380 GeneID:20701 MGI:891970
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) preptidase inhibitor, clade A, member 1b transcript_id : NM_009244.4

name	Serpina1d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102381 GeneID:20703 MGI:891968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1d transcript_id : NM_009246.3

name	Serpina1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102382 GeneID:20700 MGI:891971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1a transcript_id : NM_009243.3

name	Serpina1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881808 GeneID:20702 MGI:891969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1c transcript_id : NM_009245.2

name	Serpina1e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76881810 GeneID:20704 MGI:891967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 1e transcript_id : NM_009247.2

name	Serpina11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556295 GeneID:380780 MGI:2685741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 transcript_id : NM_199314.1

name	Serpina9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130410 GeneID:71907 MGI:1919157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 transcript_id : NM_027997.2

name	Serpina12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129832 GeneID:68054 MGI:1915304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 transcript_id : NM_026535.2

name	Serpina5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385329 GeneID:268591 MGI:107817
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 5 transcript_id : NM_172953.2

name	Serpina3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393057 GeneID:74069 MGI:1921319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : serine (or cysteine) peptidase inhibitor, clade A, member 3A, transcript variant 1 transcript_id : XM_282560.6

name	Serpina3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387237 GeneID:271047 MGI:2182835
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3B transcript_id : NM_173024.2

name	Serpina3c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130776 GeneID:16625 MGI:102848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3C transcript_id : NM_008458.2

name	Serpina3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368572 GeneID:238393 MGI:2182838
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3F transcript_id : NM_001033335.2

name	Serpina3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476055 GeneID:20715 MGI:105046
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3G transcript_id : NM_009251.1

name	Serpina3h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517725 GeneID:546546 MGI:2182839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3H transcript_id : NM_001034870.2

name	EG628900 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263490 GeneID:628900 MGI:3643496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : predicted gene, EG628900 transcript_id : XM_893705.2

name	EG238395 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94393122 GeneID:238395 MGI:3645874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 36 Proteins product : predicted gene, EG238395 transcript_id : XM_138240.6

name	Serpina3k (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859635 GeneID:20714 MGI:98377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3K transcript_id : NM_011458.1

name	Serpina3m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678094 GeneID:20717 MGI:98378
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3M transcript_id : NM_009253.1

name	Serpina3n (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130503300 GeneID:20716 MGI:105045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 3N transcript_id : NM_009252.2

name	Gsc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754075 GeneID:14836 MGI:95841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : goosecoid transcript_id : NM_010351.1

name	Dicer1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117168270 GeneID:192119 MGI:2177178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Dicer1, Dcr-1 homolog (Drosophila) transcript_id : NM_148948.2

name	Clmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816902 GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmin transcript_id : NM_001040682.1

name	Clmn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100816763 GeneID:94040 MGI:2136957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmin transcript_id : NM_053155.2

name	4831426I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607450 GeneID:212073 MGI:2442408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831426I19 gene transcript_id : NM_172500.2

name	4831426I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111607452 GeneID:212073 MGI:2442408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4831426I19 gene transcript_id : NM_001042699.1

name	Glrx5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365117 GeneID:73046 MGI:1920296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaredoxin 5 homolog (S. cerevisiae) transcript_id : NM_028419.2

name	9030205A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486612 GeneID:217843 MGI:2684729
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC217843 protein_id : NP_001074486.1

name	Prima1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872180 CCDS:CCDS26127.1 GeneID:170952 MGI:1926097
definition	GO_component : GO:0031226 - intrinsic to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA] GO_function : GO:0019899 - enzyme binding [Evidence IPI]; GO:0043495 - protein anchor [Evidence IPI] GO_process : GO:0051649 - establishment of cellular localization [Evidence IDA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 note : acetylcholinesterase membrane anchor product : proline rich membrane anchor 1 precursor protein_id : NP_579942.2

name	EG544888 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94393108 GeneID:544888 MGI:3647570
definition	codon_start : 1 product : hypothetical protein protein_id : XP_619025.3

name	Asb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956122 CCDS:CCDS26128.1 GeneID:65256 MGI:1929743
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ankyrin repeat-containing SOCS box protein 2 product : ankyrin repeat and SOCS box-containing protein 2 protein_id : NP_075536.1

name	Otub2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386070 GeneID:68149 MGI:1915399
definition	GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : OTU domain, ubiquitin aldehyde binding 2 protein_id : NP_080856.1

name	Ddx24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328253 CCDS:CCDS26129.1 GeneID:27225 MGI:1351337
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 13 (RNA helicase A) product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 24 protein_id : NP_065240.2

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732711 GeneID:52668 MGI:1277180
definition	codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC52668 isoform 1 protein_id : NP_081066.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732717 GeneID:52668 MGI:1277180
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC52668 isoform 2 protein_id : NP_919042.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732719 CCDS:CCDS26130.1 GeneID:52668 MGI:1277180
definition	codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : hypothetical protein LOC52668 isoform 3 protein_id : NP_919043.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732721 CCDS:CCDS26131.1 GeneID:52668 MGI:1277180
definition	codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : hypothetical protein LOC52668 isoform 4 protein_id : NP_919044.1

name	D12Ertd647e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34732723 CCDS:CCDS26132.1 GeneID:52668 MGI:1277180
definition	codon_start : 1 note : isoform 5 is encoded by transcript variant 5 product : hypothetical protein LOC52668 isoform 5 protein_id : NP_919045.1

name	Ifi27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:44771124 GeneID:76933 MGI:1924183
definition	GO_process : GO:0007568 - aging [Evidence IDA]; GO:0009615 - response to virus [Evidence IDA] codon_start : 1 note : interferon stimulated gene 12 product : interferon stimulated gene 12(b1) protein_id : NP_084079.1

name	1810023F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703896 CCDS:CCDS26133.1 GeneID:217845 MGI:1916390
definition	codon_start : 1 product : interferon stimulated gene 12(b2) protein_id : NP_663424.1

name	8430415E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794170 GeneID:74521 MGI:1921771
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HEAT-like repeat-containing protein protein_id : NP_083256.1

name	Serpina10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981720 CCDS:CCDS26134.1 GeneID:217847 MGI:2667725
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : protein Z-dependent protease inhibitor product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 protein_id : NP_659083.2

name	Serpina6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680856 CCDS:CCDS26135.1 GeneID:12401 MGI:88278
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : corticosteroid binding globulin product : serine (or cysteine) proteinase inhibitor, clade A, member 6 protein_id : NP_031644.1

name	Gm46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82943105 GeneID:194604 MGI:2684892
definition	codon_start : 1 product : similar to serine proteinase inhibitor HongrES1 protein_id : XP_112098.2

name	Serpina1f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77404229 CCDS:CCDS26137.1 GeneID:68348 MGI:1915598
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epididymal serine protease inhibitor product : epsin protein_id : NP_080963.1

name	Serpina1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76881807 CCDS:CCDS26138.1 GeneID:20701 MGI:891970
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 2; alpha-1-antiproteinase; serine protease inhibitor 1-2 product : serine (or cysteine) proteinase inhibitor, clade A, member 1b protein_id : NP_033270.3

name	Serpina1d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678085 CCDS:CCDS26139.1 GeneID:20703 MGI:891968
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1-antitrypsin 1-4; alpha-1 protease inhibitor 4; serine protease inhibitor 1-4 product : serine (or cysteine) proteinase inhibitor, clade A, member 1d protein_id : NP_033272.1

name	Serpina1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678079 CCDS:CCDS26140.1 GeneID:20700 MGI:891971
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 1; alpha-1-antiproteinase; serine protease inhibitor 1-1; alpha-1-antitrypsin 2 product : serine (or cysteine) proteinase inhibitor, clade A, member 1a protein_id : NP_033269.1

name	Serpina1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678083 CCDS:CCDS26141.1 GeneID:20702 MGI:891969
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : apha-1 protease inhibitor 3; serine protease inhibitor 1-3 product : serine (or cysteine) proteinase inhibitor, clade A, member 1c protein_id : NP_033271.1

name	Serpina1e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678087 CCDS:CCDS26142.1 GeneID:20704 MGI:891967
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1 protease inhibitor 5; alpha-1-antitrypsin 1-5; serine protease inhibitor 1-5 product : serine (or cysteine) proteinase inhibitor, clade A, member 1e protein_id : NP_033273.1

name	Serpina11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556296 CCDS:CCDS26143.1 GeneID:380780 MGI:2685741
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 protein_id : NP_955018.1

name	Serpina9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313654 CCDS:CCDS26144.1 GeneID:71907 MGI:1919157
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 protein_id : NP_082273.1

name	Serpina12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386038 CCDS:CCDS26145.1 GeneID:68054 MGI:1915304
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : vaspin; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 product : visceral adipose-specific SERPIN protein_id : NP_080811.1

name	Serpina5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370468 CCDS:CCDS26146.1 GeneID:268591 MGI:107817
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : protein C inhibitor; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 5 protein_id : NP_766541.1

name	Serpina3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263522 GeneID:74069 MGI:1921319
definition	codon_start : 1 product : serine (or cysteine) proteinase inhibitor, clade A, member 3A isoform 1 protein_id : XP_282560.6

name	Serpina3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370538 CCDS:CCDS26147.1 GeneID:271047 MGI:2182835
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : antitrypsin; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A, member 3B product : serine (or cysteine) peptidase inhibitor, clade A, member 3B protein_id : NP_766612.1

name	Serpina3c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680586 CCDS:CCDS26148.1 GeneID:16625 MGI:102848
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : kallikrein binding protein; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3C product : serine (or cysteine) proteinase inhibitor, clade A, member 3C protein_id : NP_032484.1

name	Serpina3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701824 CCDS:CCDS26149.1 GeneID:238393 MGI:2182838
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : antitrypsin; alpha-1 antiproteinasin product : serine (or cysteine) peptidase inhibitor, clade A, member 3F protein_id : NP_001028507.1

name	Serpina3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476056 GeneID:20715 MGI:105046
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004869 - cysteine protease inhibitor activity [Evidence IEA]; GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND]; GO:0006955 - immune response [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor 2-1; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3G protein_id : NP_033277.1

name	Serpina3h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517726 GeneID:546546 MGI:2182839
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3H product : serine (or cysteine) peptidase inhibitor, clade A, member 3H protein_id : NP_001030042.2

name	EG628900 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263491 GeneID:628900 MGI:3643496
definition	codon_start : 1 product : similar to Serpina3h protein protein_id : XP_898798.2

name	EG238395 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20859253 GeneID:238395 MGI:3645874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_138240.1

name	Serpina3k (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859636 GeneID:20714 MGI:98377
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor 2; alpha-1 antiproteinase; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3K product : serine (or cysteine) proteinase inhibitor, clade A, member 3K protein_id : NP_035588.1

name	Serpina3m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678095 GeneID:20717 MGI:98378
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : serine protease inhibitor-2 related sequence 1; contrapsin-like; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3M protein_id : NP_033279.1

name	Serpina3n (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130503301 CCDS:CCDS26152.1 GeneID:20716 MGI:105045
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : serine protease inhibitor 2-2; antitrypsin; alpha-1 antiproteinase product : serine (or cysteine) proteinase inhibitor, clade A, member 3N protein_id : NP_033278.2

name	Gsc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754076 CCDS:CCDS26153.1 GeneID:14836 MGI:95841
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : goosecoid protein_id : NP_034481.1

name	Dicer1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117168271 GeneID:192119 MGI:2177178
definition	GO_component : GO:0005622 - intracellular [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004525 - ribonuclease III activity [Evidence ISS] [Evidence IDA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0035196 - miRNA-mediated gene silencing, production of miRNAs [Evidence IMP]; GO:0030422 - RNA interference, production of siRNA [Evidence IDA]; GO:0030423 - RNA interference, targeting of mRNA for destruction [Evidence ISS]; GO:0006396 - RNA processing [Evidence IDA]; GO:0019827 - stem cell maintenance [Evidence IMP] codon_start : 1 note : endoribonuclease Dicer product : dicer1 protein_id : NP_683750.2

name	Clmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816903 GeneID:94040 MGI:2136957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : calmin isoform b protein_id : NP_001035772.1

name	Clmn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100816764 GeneID:94040 MGI:2136957
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : calmin isoform a protein_id : NP_444385.2

name	4831426I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607453 GeneID:212073 MGI:2442408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant 1 product : nesprin-3 isoform alpha protein_id : NP_001036164.1

name	4831426I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607451 GeneID:212073 MGI:2442408
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant 2 product : nesprin-3 isoform beta protein_id : NP_766088.2

name	Glrx5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312153 CCDS:CCDS26154.1 GeneID:73046 MGI:1920296
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : glutaredoxin 5 protein_id : NP_082695.1

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 5 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 4 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 3 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 2 pseudo : _no_value

name	EG435316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435316
definition	number : 1 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 4 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 3 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 2 pseudo : _no_value

name	LOC628801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628801
definition	number : 1 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 6 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 5 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 4 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 3 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 2 pseudo : _no_value

name	LOC667954 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667954
definition	number : 1 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 4 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 3 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 2 pseudo : _no_value

name	LOC435318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435318
definition	number : 1 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 7 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 6 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 5 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 4 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 3 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 2 pseudo : _no_value

name	LOC628883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628883
definition	number : 1 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 1 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 2 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 3 pseudo : _no_value

name	EG628916 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628916
definition	number : 4 pseudo : _no_value

name	LOC667951 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263517 GeneID:667951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 262 ESTs, 50 Proteins product : similar to Serine (or cysteine) peptidase inhibitor, clade A, member 1a pseudo : _no_value transcript_id : XR_032235.1

name	Serpina4-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872153 GeneID:321018 MGI:2448363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A, member 4, pseudogene 1 pseudo : _no_value transcript_id : NR_002861.1

name	LOC667997 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263524 GeneID:667997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 11 Proteins product : similar to developmentally regulated GTP binding protein 2 pseudo : _no_value transcript_id : XR_032399.1

name	Snhg10 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141803286 GeneID:69434 MGI:1916684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA host gene (non-protein coding) 10 transcript_id : NR_003145.2

clone name	MSMg01-547E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504M02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-154A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-188J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-107C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-539H22.T7 (MSMg01no539_h22.b1)	MSMg01-539H22.TJ (MSMg01no539_h22.g1)
ACC	AG605974	AG605975
length	767	786
length of high quality (start - end)	662 (68 - 729)	617 (72 - 688)
definition	CHROMAT_FILE: MSMg01no539_h22.b1 PHD_FILE: MSMg01no539_h22.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:18:28 2005	CHROMAT_FILE: MSMg01no539_h22.g1 PHD_FILE: MSMg01no539_h22.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:18:28 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ACCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCG GAATTCTCAGGTTTCCACAAAGGGATTAAAACGGCCTCTTGCAGAAGGCT TCTATTCCCTGGCTCTGCGGGGGAGGCTCTGTTTGGAGGGGATGGACCCT CTGTGGTGTGGCCAGGGCTCTGTCTCTCACTGAGCCCAGACTTAGCAGCT TCTATCCTTCTCCGTAGGAAGAGGTGTTTGGTTAGGTTGTGGCTTTGGCA TTGTCAGAAGAGCAAAGGGCCTTATAAGACAGCTCAACAGGTGGAGGGGC TTGTCAGATAAGCCTGGAGACTGGAGTTTTATCCCTGGACCCCCTATAAC TGATTCCAAGGATTGTGCTCTGACCCCTCTCCCTTGCACACTAATCAACC AATCAACCAATCAGCCAACCCATTGATTTAAAACTGAGCTGAGCAGAGAG CCAGGTGAATTCCCCAAACCTCAAATCTCCCCTTTCACTCAAAGCCCTAG GATAAGGTCTAAGATCATCCCAGGGCACAAGAGCTGTGCCACCCTGAGGC TGAGTTATCAAGCTGATCCCCAGGTACTTATCCTGAGATAACTGGACAGA TCTCTCGAATTGGGAGCTTCTCCACAGCTCTTTGCCCCTCCTAATCATCC TGAGCTAGGAGACTTGGAGGAAGCTTGTGCTTCCTGCCTTTGCATAAGGA CCCTCTTTTGGAGACTCTGGGGCTACACTTTGGAGAAAGCTGATCTGGGG GCAGAATCAACTGGATG	ATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXTGTATGTACTGAAGTTGAGTGTGGGCTGT ACATGGCTGAGAGTCCCCAGCACAAATATGCAGAGGACAGTAGACCTGAC CTGCTTTTTCAGAGGAGAGCTGGGTAGCAGGGCTTAGCTAGGTAGACAGG GTTAGTGTTCAGGGTGAGGGTCAAAACAACCTCTCATCTGCTGTTTAATA CACTCTCCAGCCTCAGTTTCCCTTCCTGCCTCCTCTCTGCTCCAGCATGA CATGTAGGTCACATTTAGTGACACACACACATACTGAGTAAGTAGAAAAT TGAGACAGCCACCCTCTTCTGGTTTCCCTTTCTGCACAGCACATTGTGGA CGCCTGCTGCTCATTCCTGGGACTGACATGCCTTGTGTCTAGGGAGCTCC ATGGCTGTTAAGTCATGTCCTACCTGTGCATCCTGTGGGCTCTGGTGCTT TTAACACTATGATTGCAGGTTGTATATCAATCTAGTGATGGAGAATATCA GTCAGTATGACCTGATACTTGGATGCAGAAAAAGGAGTTTGTATTTTAGG GAAGAGGATAAACCTTAACCATTTCATCCCTGGTCCTTCCTCAGCCTATT TGGGTTAGGGATGTAATAAAAGTGACCTGGCGGACTAAGTGTANAGAGGA GTGTGTGAGCCAAGTGTCCTGTTCTTCCTGCTATTCTTGGCAGCAGGCCT ACACACACACACACACACACACTCACATTCCCTATC
quality values	Open. Hide. 6 6 6 8 8 6 8 8 23 28 37 33 32 37 30 31 37 41 33 33 33 37 33 33 48 48 30 28 24 20 20 13 15 10 14 14 10 12 17 24 20 12 12 16 12 11 12 24 41 34 36 36 31 31 33 31 28 25 23 23 17 21 12 11 11 9 12 12 20 31 33 39 33 33 33 33 36 36 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 48 54 57 57 57 54 57 57 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 68 68 68 68 68 59 50 47 47 47 50 50 57 57 57 57 57 57 68 57 59 57 57 57 59 59 59 57 52 52 52 57 57 68 68 68 68 68 68 68 68 59 57 57 52 52 57 57 57 57 57 57 57 57 57 52 52 57 57 57 57 59 59 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 59 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 43 43 20 23 23 35 43 43 52 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 43 39 41 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 52 62 62 62 68 68 68 62 62 44 43 31 31 43 43 39 39 43 43 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 59 59 59 57 57 57 57 57 57 57 57 57 57 59 68 57 57 57 57 57 57 59 57 57 57 57 68 68 68 57 57 59 59 59 59 59 50 50 41 41 59 59 50 39 38 50 50 52 52 52 57 57 57 57 57 57 59 59 57 57 57 68 68 68 57 57 57 57 57 57 59 68 68 68 68 68 59 59 59 68 68 68 68 68 68 57 57 57 57 57 57 68 68 57 57 54 54 54 57 57 54 54 48 44 43 43 39 44 44 57 54 57 57 48 48 48 57 48 54 54 57 57 57 48 48 48 57 43 46 46 46 48 59 48 48 48 59 59 50 48 48 48 46 46 46 41 39 39 30 25 25 39 43 59 41 41 41 41 43 48 48 48 48 59 59 59 59 48 48 48 59 59 57 48 48 48 57 57 57 59 57 57 48 59 57 48 48 48 48 48 48 48 48 48 57 57 48 48 48 37 37 37 37 40 40 39 41 41 41 37 32 32 32 37 37 43 43 43 43 47 47 41 30 26 22 28 28 34 36 40 40 47 47 59 59 41 37 37 43 43 47 47 46 41 41 39 59 36 36 35 32 32 37 37 30 30 30 37 37 29 32 23 23 23 28 24 31 34 36 41 31 31 36 31 41 41 34 34 23 23 23 34 25 32 32 26 26 30 26 26 24 24 20 25 28 28 24 26 19 17 17 25 19 31 28 32 35 31 31 36 31 14 14 10 10 10 10 12 29 30 31 28 34 32 32 25 25 17 17 17 28 28 28 17 17 15 15 18 25 19 24 24 16 21 19 22 22 13 9 9 9 9 9 18 25 14 11 10 11 14 15 17 26 18 18 18 25 25 20	Open. Hide. 9 11 10 8 8 8 17 18 12 11 10 10 19 27 37 39 39 39 37 37 37 32 32 37 44 39 39 25 18 9 9 8 6 6 6 10 10 11 19 19 32 29 31 37 32 33 33 37 33 33 48 50 50 50 50 46 37 19 19 8 8 8 10 15 30 25 28 26 26 28 29 39 47 47 38 47 50 50 50 50 53 50 50 50 57 57 57 57 50 50 68 68 68 68 68 68 68 68 68 50 50 54 54 50 51 57 57 57 57 57 54 54 57 48 57 57 57 43 43 57 57 68 68 68 68 68 50 51 51 51 50 57 57 57 57 57 68 57 57 57 57 54 57 57 57 57 68 68 68 68 68 68 68 68 68 68 57 57 57 52 52 57 57 68 68 68 57 57 57 57 57 57 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 52 52 45 57 57 68 68 57 57 57 57 57 59 57 68 68 68 68 68 68 59 57 57 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 54 54 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 59 68 59 59 59 59 68 68 68 68 68 68 68 68 68 59 59 57 59 48 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 68 68 59 68 68 68 68 59 59 59 59 59 59 59 68 68 68 59 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 57 50 50 59 48 47 47 47 41 41 41 37 34 31 37 37 39 39 47 47 47 59 48 48 48 48 59 59 57 59 43 37 43 43 43 44 57 48 48 57 57 57 48 43 43 43 59 43 46 43 59 59 57 57 57 57 48 48 48 50 50 50 48 48 48 48 48 41 40 39 37 31 37 39 36 36 39 39 35 37 41 41 32 37 41 41 41 41 40 41 39 39 39 35 36 41 41 39 39 35 29 29 32 32 29 29 32 31 31 37 44 37 37 37 37 44 43 40 39 40 40 40 41 59 42 32 32 20 20 18 28 32 41 37 31 34 28 22 22 24 19 27 35 31 31 37 43 37 31 31 31 32 28 25 26 30 30 28 28 24 24 32 28 31 37 37 30 27 25 23 19 15 19 18 22 28 24 27 28 32 21 17 11 11 11 17 17 3 0 3 15 15 24 22 19 15 15 12 12 11 12 12 15 15 11 9 9 9 9 9 9 12 12 12 12 11 11 11 23 17 29 29 16 20 11 11 11 18 14 13 14 8 9 9 9 8 10 10 11 9 10 9 9 9 8 10 9 10 10 10 22 14 15 17 30 30 28 18 12 12 13 13 15 16 19 16 16 11 10 11 11 11 11 16 16 9 12 8 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no539_h22.b1 MSMg01no539_h22.b1 CHROMAT_FILE:
MSMg01no539_h22.b1 PHD_FILE: MSMg01no539_h22.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 21:18:28 2005
         (662 letters)



>mm_chr12_105312691_105313753
          Length = 1063

 Score = 1266 bits (655), Expect = 0.0
 Identities = 661/663 (99%), Gaps = 1/663 (0%)
 Strand = Plus / Plus

                                                                       
Query: 1   caaagggattaaaacggcctcttgcagaaggcttctattccctggctctgcgggggaggc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 caaagggattaaaacggcctcttgcagaaggcttctattccctggctctgcgggggaggc 260

                                                                       
Query: 61  tctgtttggaggggatggaccctctgtggtgtggccagggctctgtctctcactgagccc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tctgtttggaggggatggaccctctgtggtgtggccagggctctgtctctcactgagccc 320

                                                                       
Query: 121 agacttagcagcttctatccttctccgtaggaagaggtgtttggttaggttgtggctttg 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 agacttagcagcttctatccttctccgtaggaagaggtgtttggttaggttgtggctttg 380

                                                                       
Query: 181 gcattgtcagaagagcaaagggccttataagacagctcaacaggtggaggggcttgtcag 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 381 gcattgtcagaagagcaaagggccttataagacagctcaacaggtggaggggcttgtcat 440

                                                                       
Query: 241 ataagcctggagactggagttttatccctggaccccctataactgattccaaggattgtg 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 ataagcctggagactggagttttatccctggaccccctataactgattccaaggattgtg 500

                                                                       
Query: 301 ctctgacccctctcccttgcacactaatcaaccaatcaaccaatcagccaacccattgat 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 ctctgacccctctcccttgcacactaatcaaccaatcaaccaatcagccaacccattgat 560

                                                                       
Query: 361 ttaaaactgagctgagcagagagccaggtgaattccccaaacctcaaatctcccctttca 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 561 ttaaaactgagctgagcagagagccaggtgaattccccaaacctcaaatctcccctttca 620

                                                                       
Query: 421 ctcaaagccctaggataaggtctaagatcatcccagggcacaagagctgtgccaccctga 480
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 621 ctcaaagccctaggataaggtctaagatcatcccagggcacaagagctgtgccaccctga 680

                                                                       
Query: 481 ggctgagttatcaagctgatccccaggtacttatcctgagataactggacagatctctcg 540
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 681 ggctgagttatcaagctgatccccaggtacttatcctgagataactggacagatctctcg 740

                                                                       
Query: 541 aattgggagcttctccacagctctttgcccctcctaatcatcctgagctaggagacttgg 600
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 aattgggagcttctccacagctctttgcccctcctaatcatcctgagctaggagacttgg 800

                                                                       
Query: 601 aggaagcttgtgcttcctgcctttgcataaggaccctcttttgga-gactctggggctac 659
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 801 aggaagcttgtgcttcctgcctttgcataaggaccctcttttggaagactctggggctac 860

              
Query: 660 act 662
           |||
Sbjct: 861 act 863


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 33
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 662
Length of database: 1063
Length adjustment: 10
Effective length of query: 652
Effective length of database: 1053
Effective search space:   686556
Effective search space used:   686556
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information