MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-097E01
Chromosome	13 (Build37)
Map Location	3,314,405 - 3,315,229
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC667375, LOC544917, LOC236294, Speer6-ps1, LOC674228
Downstream gene	LOC667411, LOC100039182, 2810429I04Rik, Gdi2, Asb13, Calml3, Calm4, Calm5, LOC100039279, Net1, Tubal3, Ucn3, Akr1c14, Akr1c18, LOC100039262, Akr1c13, Akr1c19, Akr1c12
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	LOC544917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC236294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 259 ESTs, 19 Proteins pseudo : _no_value

name	Speer6-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73266 MGI:1920516
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC674228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 1299 ESTs, 8 Proteins pseudo : _no_value

name	LOC667411 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 10 Proteins pseudo : _no_value

name	LOC100039182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	2810429I04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76937 MGI:1924187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Gdi2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14569 MGI:99845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:142688 MGI:2145525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Calml3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70405 MGI:1917655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80796 MGI:1931464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:494124 MGI:3511177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039279 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Net1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56349 MGI:1927138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tubal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238463 MGI:3588215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83428 MGI:1932970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akr1c14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105387 MGI:2145458
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akr1c18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105349 MGI:2145420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039262 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Akr1c13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27384 MGI:1351662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akr1c19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432720 MGI:2653678
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akr1c12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622402 MGI:1351661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC544917 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263801 GeneID:544917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to spermatogenesis associated glutamate (E)-rich protein 4d transcript_id : XM_001472351.1

name	LOC100039182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263806 GeneID:100039182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to cyclin-dependent kinase 6 transcript_id : XM_001472410.1

name	2810429I04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149263808 GeneID:76937 MGI:1924187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 2810429I04 gene transcript_id : XM_001472430.1

name	Gdi2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089272 GeneID:14569 MGI:99845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanosine diphosphate (GDP) dissociation inhibitor 2 transcript_id : NM_008112.4

name	Asb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129855 GeneID:142688 MGI:2145525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 13 transcript_id : NM_178283.3

name	Asb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131078 GeneID:142688 MGI:2145525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 13 transcript_id : NM_080857.2

name	Calml3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347500 GeneID:70405 MGI:1917655
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin-like 3 transcript_id : NM_027416.2

name	Calm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351881 GeneID:80796 MGI:1931464
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin 4 transcript_id : NM_020036.3

name	Calm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56785417 GeneID:494124 MGI:3511177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmodulin 5 transcript_id : NM_001008706.1

name	LOC100039279 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263810 GeneID:100039279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039279 transcript_id : XM_001472575.1

name	Net1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145476 GeneID:56349 MGI:1927138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroepithelial cell transforming gene 1 transcript_id : NM_019671.2

name	Net1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145470 GeneID:56349 MGI:1927138
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroepithelial cell transforming gene 1 transcript_id : NM_001047159.1

name	Tubal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385159 GeneID:238463 MGI:3588215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, alpha-like 3 transcript_id : NM_001033879.2

name	Ucn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366005 GeneID:83428 MGI:1932970
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : urocortin 3 transcript_id : NM_031250.4

name	Akr1c14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527293 GeneID:105387 MGI:2145458
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member C14 transcript_id : NM_134072.1

name	Akr1c18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802036 GeneID:105349 MGI:2145420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member C18 transcript_id : NM_134066.2

name	Akr1c13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304878 GeneID:27384 MGI:1351662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member C13 transcript_id : NM_013778.1

name	Akr1c19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371628 GeneID:432720 MGI:2653678
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member C19 transcript_id : NM_001013785.2

name	Akr1c12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719329 GeneID:622402 MGI:1351661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldo-keto reductase family 1, member C12 transcript_id : NM_013777.2

name	LOC544917 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263802 GeneID:544917
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472401.1

name	LOC100039182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263807 GeneID:100039182
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472460.1

name	2810429I04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149263809 GeneID:76937 MGI:1924187
definition	codon_start : 1 product : hypothetical protein LOC76937 protein_id : XP_001472480.1

name	Gdi2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089273 GeneID:14569 MGI:99845
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IPI] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005097 - Rab GTPase activator activity [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IPI] codon_start : 1 note : RAB GDP dissociation inhibitor beta-2; guanosine diphosphate (GDP) dissociation inhibitor 3; GDI beta product : guanosine diphosphate (GDP) dissociation inhibitor 2 protein_id : NP_032138.3

name	Asb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252802 GeneID:142688 MGI:2145525
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : ankyrin repeat domain-containing SOCS box protein 13 product : ankyrin repeat and SOCS box-containing protein 13 protein_id : NP_543133.1

name	Asb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30231208 GeneID:142688 MGI:2145525
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : ankyrin repeat domain-containing SOCS box protein 13 product : ankyrin repeat and SOCS box-containing protein 13 protein_id : NP_840068.1

name	Calml3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386230 CCDS:CCDS26214.1 GeneID:70405 MGI:1917655
definition	codon_start : 1 product : calmodulin-like 3 protein_id : NP_081692.1

name	Calm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56785418 GeneID:494124 MGI:3511177
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : calmodulin 5 protein_id : NP_001008706.1

name	Calm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36796745 CCDS:CCDS26215.1 GeneID:80796 MGI:1931464
definition	GO_component : GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA] codon_start : 1 note : calmodulin-related factor; calcium binding gene, DD112 product : calmodulin 4 protein_id : NP_064420.2

name	LOC100039279 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263811 GeneID:100039279
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472625.1

name	Net1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145477 CCDS:CCDS26216.1 GeneID:56349 MGI:1927138
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Net1 homolog; guanine nucleotide regulatory protein (oncogene) product : neuroepithelial cell transforming gene 1 isoform 1 protein_id : NP_062645.2

name	Net1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145471 GeneID:56349 MGI:1927138
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Net1 homolog; guanine nucleotide regulatory protein (oncogene) product : neuroepithelial cell transforming gene 1 isoform 2 protein_id : NP_001040624.1

name	Tubal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794631 GeneID:238463 MGI:3588215
definition	GO_component : GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0051258 - protein polymerization [Evidence IEA] codon_start : 1 exception : mismatches in translation product : tubulin, alpha-like 3 protein_id : NP_001029051.1

name	Ucn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21492632 CCDS:CCDS26217.1 GeneID:83428 MGI:1932970
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IDA]; GO:0007218 - neuropeptide signaling pathway [Evidence TAS] codon_start : 1 note : Urocortin II; Urocortin III product : urocortin 3 protein_id : NP_112540.2

name	Akr1c14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527294 CCDS:CCDS26218.1 GeneID:105387 MGI:2145458
definition	GO_function : GO:0047042 - 3-alpha-hydroxysteroid dehydrogenase (B-specific) activity [Evidence IEA] codon_start : 1 note : 3-alpha-hydroxysteroid dehydrogenase type 1 product : aldo-keto reductase family 1, member C14 protein_id : NP_598833.1

name	Akr1c18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527284 CCDS:CCDS26219.1 GeneID:105349 MGI:2145420
definition	EC_number : 1.1.1.149 GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0047006 - 20-alpha-hydroxysteroid dehydrogenase activity [Evidence IDA] [Evidence IMP] [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0007567 - parturition [Evidence IMP]; GO:0006709 - progesterone catabolism [Evidence IMP] [Evidence IDA]; GO:0042448 - progesterone metabolism [Evidence ISS] codon_start : 1 note : 20-alpha-hydroxysteroid dehydrogenase; 20alpha-HSD product : aldo-keto reductase family 1, member C18 protein_id : NP_598827.1

name	Akr1c13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304879 CCDS:CCDS26220.1 GeneID:27384 MGI:1351662
definition	GO_function : GO:0004033 - aldo-keto reductase activity [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006805 - xenobiotic metabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : aldo-keto reductase AKR1C13 product : aldo-keto reductase family 1, member C13 protein_id : NP_038806.1

name	Akr1c19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000660 CCDS:CCDS26221.1 GeneID:432720 MGI:2653678
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : aldo-keto reductase family 1, member C19 protein_id : NP_001013807.1

name	Akr1c12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719330 CCDS:CCDS26222.1 GeneID:622402 MGI:1351661
definition	GO_function : GO:0004033 - aldo-keto reductase activity [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006805 - xenobiotic metabolism [Evidence TAS] codon_start : 1 note : aldo-keto reductase a product : aldo-keto reductase family 1, member C12 protein_id : NP_038805.2

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 7 pseudo : _no_value

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 6 pseudo : _no_value

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 5 pseudo : _no_value

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 4 pseudo : _no_value

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 3 pseudo : _no_value

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 2 pseudo : _no_value

name	LOC100039262 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039262
definition	number : 1 pseudo : _no_value

name	LOC667375 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263800 GeneID:667375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to COX11 homolog, cytochrome c oxidase assembly protein (yeast) pseudo : _no_value transcript_id : XR_030658.1

name	LOC236294 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263803 GeneID:236294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 259 ESTs, 19 Proteins product : similar to Polypyrimidine tract binding protein 1 pseudo : _no_value transcript_id : XR_030680.1

name	Speer6-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:142364245 GeneID:73266 MGI:1920516
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermatogenesis associated glutamate (E)-rich protein 6, pseudogene 1 pseudo : _no_value transcript_id : NR_001581.2

name	LOC674228 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263805 GeneID:674228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 1299 ESTs, 8 Proteins product : similar to ribosomal protein S4, X-linked pseudo : _no_value transcript_id : XR_030696.1

name	LOC667411 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149263804 GeneID:667411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 10 Proteins product : similar to ribonucleotide reductase M2 B (TP53 inducible) pseudo : _no_value transcript_id : XR_030665.1

clone name	MSMg01-133H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535E13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-144M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367K14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-405H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-133L22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-146E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062J06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-511H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125M24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-117A13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-102D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137E20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-517P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062D24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-392E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091M11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-097E01.b	B6Ng01-097E01.g
ACC	DH907676	DH907677
length	825	1,140
definition	DH907676\|Mus musculus domesticus DNA, BAC clone: B6Ng01-097E01, 5' end.	DH907677\|Mus musculus domesticus DNA, BAC clone: B6Ng01-097E01, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctctcattagatggggctgaattttccttcctaacttgaagcac tgtttctggattttcatacatgaggactgcacaggaagtgactctcgggt ctatatttcaggattttacagaacacttaatgaagcttccaggtcaccca acaaacttagttttgcccaggattgcttcacctccttttgttcctcaaac cagaagaaatgtctagaaggagcctgtagagtaggaattctcaacctgtg ggtctcaaccccttgggcattgaatgacccattcacctgagtcgcctaag agcatcgtaaaacagatatttacattaagatttgtaacagtagcaaaatt atagctatgaagtagcaacgaaaataattttatggttgagggtcaccaca ccattaggaactgtatcaaagtgtcacagtgttaggacagttcagaaccc gtggtgtagagcaaagacagctctgctaaataaggcaggggttctgtctc acactaaccctctccatggctctaccagtttctctctcattctttcactc aaaagctgttaaaaccccaaatattctaggaagctggtcatcagagcctg aggctcaccacctaagagggagacaaattgctctctacacttgttcctcc agccctggacccccatctgcttaacactccaaatgagcaaatgcccaata ggtaattaatgagctgtgaaatgccttcacagtcaggtgtcttctctctg tcatagaggccctcccaacgcactcctttctggaaggaataaaaagttga gctggagggaggggtgggagggagg	gaattcacctggaccagagaatatcagctagcctttgaaactctcaaaaa ggcactgctgcaggctctggcattggccctgccagatttaaacaaacctt tcaccctgtacattgatgaaagaaatggagtggcaaggggagtccttacc caggttttgggaccatggaagtgcccggtagcctacttatcaaagaaact ggaccctgtgcccagtggatggccctcctgcctgtgagcgatagcagcca tggctgtgctagtaagagatgctgacaaactgactatgggccagaatgtt accatagtggccccacactctcttgagagcatcgtcaggcaaccaccgga ccactggatgaccaacgcccaaatgacgcactaccagagcctattgctga cagagtgagtaagttttgcacccccagccattctcaaccctgctacctta ctacctgaggctgatgaggcccctgcacataagtgtgaagaaatactggc agaagagactctgactaaaatagccttagaggcggcagaagtgattggac agccattctcccttctaccttgttcagggttcggaatacacctggacctc ttggcctaactccatttgaattaatgtatggggcgccgtcgcccattttt atgactgtaggggataagaatcacccggatgcgtctttctctccttcttc tagtattttggctcgattaaaagctctctaaatagtaagaaaagaggtct gggaacagctaaaagaaacctatgttgctggtgatacacaggtgccgtac cagtttgaagtaggagacgcagtcctggtgaggagacactgagcggggaa cctagagtcgaggtggaagggaccctacttgctgctactgacaacaccca ccgcggacaagtggaatccccacttgggtccacgcatcccatgtcaagag agcacccctggagtcagccatgatgagagacttggagagactactaaccc tctaagttgtgctgcttgtagaacgatccagaagacttcaccccatggtc tgttcaacatggaggtactcaatgaggggggtaggctgaagacaatcgct gaagtacaccccctctgtggactggtggcctgaaatctat
quality values	Open. Hide. 61 61 31 33 61 61 50 61 61 61 38 18 61 61 61 61 47 43 61 61 61 49 61 61 61 37 19 31 30 23 26 19 23 27 25 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 59 61 61 59 59 59 59 44 28 44 34 55 59 61 59 59 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 59 59 59 59 61 52 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 59 61 61 61 61 61 59 61 59 61 61 61 59 59 59 61 61 61 61 61 61 59 61 61 55 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 49 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 52 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 55 50 55 50 50 61 61 50 61 41 55 50 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 40 61 61 61 47 53 61 61 50 61 61 61 61 61 42 61 61 53 52 53 50 47 50 47 61 53 61 38 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 45 61 47 61 53 53 57 57 52 57 53 57 53 52 53 53 53 53 53 53 52 47 32 47 43 57 57 57 37 42 45 50 57 57 53 57 57 57 57 57 57 53 53 40 53 40 53 53 57 57 53 47 50 53 47 43 47 29 45 50 47 43 53 39 47 41 28 57 57 57 43 33 37 52 53 52 57 53 53 37 57 52 50 52 57 52 41 24 57 57 43 57 53 35 52 30 57 57 50 53 50 46 52 45 53 53 53 40 52 23 34 52 32 47 52 38 31 37 39 40 44 52 52 33 52 37 57 40 42 52 37 50 52 52 40 27 33 24 40 41 37 24 25 57 40 57 42 42 40 40 53 48 47 53 53 41 57 36 29 21 40 41 25 53 40 44 24 57 46 53 33 33 34 14 38 35 23 19 23 30 45 44 53 21 16 9 8 12 18 25 22 15 7 21 27 30 17 25 45 45 45 30 23 24 27 45 47 24 30 33 33 32 30 11 45 37 25 14 46 45 30 18 33 51 45 32 15 39 27 26 13 11	Open. Hide. 61 61 49 49 61 49 16 28 35 21 22 13 15 19 17 29 36 61 59 61 59 59 61 59 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 49 61 52 44 59 44 55 52 52 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 47 61 61 61 61 61 61 61 53 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 57 50 57 57 53 53 57 47 42 57 57 57 57 50 57 57 53 53 52 57 57 57 53 53 53 47 53 53 57 57 45 53 53 57 57 57 57 53 50 53 37 47 47 47 53 53 53 53 57 53 52 53 57 50 53 57 57 53 57 47 53 57 57 53 53 57 57 38 36 57 53 53 47 57 47 53 43 38 57 57 57 57 47 52 50 37 45 53 52 52 42 52 38 57 57 57 41 50 36 47 57 52 53 57 24 57 57 53 45 46 57 57 57 53 45 41 41 46 32 53 52 38 38 33 57 57 53 52 36 40 53 30 57 50 37 52 37 52 53 38 47 57 52 31 53 50 38 42 50 53 57 52 50 57 53 53 53 53 50 53 53 38 52 47 36 37 37 35 36 34 41 33 37 57 53 33 53 53 44 40 52 36 31 57 53 47 35 45 53 53 57 53 43 48 57 53 41 53 34 33 53 44 36 57 57 57 53 34 46 18 40 34 48 41 53 57 45 44 47 37 37 36 37 44 34 57 57 47 32 48 47 31 18 16 32 41 30 48 41 38 33 36 48 31 47 27 35 38 28 28 43 32 30 26 9 27 28 37 29 51 30 30 28 24 45 22 28 43 51 43 39 39 39 33 34 21 25 10 32 28 29 19 20 30 25 18 29 29 39 34 28 29 29 28 43 28 33 36 19 28 23 21 27 26 29 43 28 41 36 51 51 29 36 31 16 24 35 38 26 29 25 29 29 16 41 19 32 28 43 30 28 28 17 51 31 10 17 36 28 34 29 28 30 38 34 34 38 35 34 29 22 25 28 28 28 23 21 22 29 20 29 27 29 18 20 21 20 30 20 21 43 12 19 26 18 28 24 32 25 29 28 35 33 41 27 17 15 24 17 19 51 17 20 28 28 17 21 16 28 18 28 19 18 20 27 28 29 21 23 34 26 27 31 7 23 15 12 14 26 36 38 38 19 24 15 16 12 31 33 23 14 20 17 15 30 33 30 17 18 28 19 20 15 4 9 17 9 10 17 31 9 31 6 13 13 28 23 34 25 17 12 14 35 19 29 18 22 6 13 15 29 8 17 8 7 17 5 20 13 30 28 16 13 7 7 6 19 15 10 26 15 16 29 6 13 14 15 29 6 5 19 21 13 13 15 27 27 19 5 15 19 18 15 27 9 17 15 24 15 24 14 11 26 6 14 7 12 8 24 15 23 23 24 19 14 18 8 7 26 7 26 31 35 18 22 4 5 9 10 9 5 2 1 1 3 3 8 16 20 5 5 5 20 6 5 11 4 17 9 5 5 3 3 24 30 19 8 15 13 10 12 7 8 12 21 5 18 15 19 6 17 17 8 27 12 8 4 6 8 6 8 8 4 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_3314405_3315229
seq2: B6Ng01-097E01.b_48_872

seq1  GAATTCCTCTCATTAGATGGGGCTGAATTTTCCTTCCTAACTTGAAGCAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTCTCATTAGATGGGGCTGAATTTTCCTTCCTAACTTGAAGCAC  50

seq1  TGTTTCTGGATTTTCATACATGAGGACTGCACAGGAAGTGACTCTCGGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTCTGGATTTTCATACATGAGGACTGCACAGGAAGTGACTCTCGGGT  100

seq1  CTATATTTCAGGATTTTACAGAACACTTAATGAAGCTTCCAGGTCACCCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATATTTCAGGATTTTACAGAACACTTAATGAAGCTTCCAGGTCACCCA  150

seq1  ACAAACTTAGTTTTGCCCAGGATTGCTTCACCTCCTTTTGTTCCTCAAAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACTTAGTTTTGCCCAGGATTGCTTCACCTCCTTTTGTTCCTCAAAC  200

seq1  CAGAAGAAATGTCTAGAAGGAGCCTGTAGAGTAGGAATTCTCAACCTGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGAAATGTCTAGAAGGAGCCTGTAGAGTAGGAATTCTCAACCTGTG  250

seq1  GGTCTCAACCCCTTGGGCATTGAATGACCCATTCACCTGAGTCGCCTAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTCAACCCCTTGGGCATTGAATGACCCATTCACCTGAGTCGCCTAAG  300

seq1  AGCATCGTAAAACAGATATTTACATTAAGATTTGTAACAGTAGCAAAATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCATCGTAAAACAGATATTTACATTAAGATTTGTAACAGTAGCAAAATT  350

seq1  ATAGCTATGAAGTAGCAACGAAAATAATTTTATGGTTGAGGGTCACCACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCTATGAAGTAGCAACGAAAATAATTTTATGGTTGAGGGTCACCACA  400

seq1  CCATTAGGAACTGTATCAAAGTGTCACAGTGTTAGGACAGTTCAGAACCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTAGGAACTGTATCAAAGTGTCACAGTGTTAGGACAGTTCAGAACCC  450

seq1  GTGGTGTAGAGCAAAGACAGCTCTGCTAAATAAGGCAGGGGTTCTGTCTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTGTAGAGCAAAGACAGCTCTGCTAAATAAGGCAGGGGTTCTGTCTC  500

seq1  ACACTAACCCTCTCCATGGCTCTACCAGTTTCTCTCTCATTCTTTCACTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTAACCCTCTCCATGGCTCTACCAGTTTCTCTCTCATTCTTTCACTC  550

seq1  AAAAGCTGTTAAAACCCCAAATATTCTAGGAAGCTGGTCATCAGAGCCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGCTGTTAAAACCCCAAATATTCTAGGAAGCTGGTCATCAGAGCCTG  600

seq1  AGGCTCACCACCTAAGAGGGAGACAAATTGCTCTCTACACTTGTTCCTCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTCACCACCTAAGAGGGAGACAAATTGCTCTCTACACTTGTTCCTCC  650

seq1  AGCCCTGGACCCCCATCTGCTTAACACTCCAAATGAGCAAATGCCCAATA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCTGGACCCCCATCTGCTTAACACTCCAAATGAGCAAATGCCCAATA  700

seq1  GGTAATTAATGAGCTGTGAAATGCCTTCACAGTCAGGTGTCTTCTCTCTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAATTAATGAGCTGTGAAATGCCTTCACAGTCAGGTGTCTTCTCTCTG  750

seq1  TCATAGAGGCCCTCCCAACGCACTCCTTTCTGGAAGGAATAAAAAGTTGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATAGAGGCCCTCCCAACGCACTCCTTTCTGGAAGGAATAAAAAGTTGA  800

seq1  GCTGGAGGGAGGGGTGGGAGGGAGG  825
      |||||||||||||||||||||||||
seq2  GCTGGAGGGAGGGGTGGGAGGGAGG  825

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information