MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-102L08
Chromosome	13 (Build37)
Map Location	27,949,182 - 27,950,302
singlet/doublet	singlet
Overlap gene	OTTMUSG00000000651
Upstream gene	LOC100040945, LOC100040957, Prl, Prl3d1, Prl3d2, Prl3d3, Prl3c1, Prl3b1, Prl3a1, Prl6a1, Prl8a2, Prl2b1, Prl8a6, Prl8a8, Prl8a9, Prl8a1, Prl7b1, Prl7a1, Prl7a2, RP23-135A24.2-001, Prl7d1, Prl7c1, Prl2a1
Downstream gene	LOC666321, LOC195243, LOC100041036, Prl4a1, Prl5a1, LOC100042388, LOC100042393, LOC100042399, Ppia-ps13_297.1, LOC626683
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Prl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19109 MGI:97762
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18775 MGI:97606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215028 MGI:2660935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3d3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215029 MGI:2660938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27372 MGI:1351649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18776 MGI:97607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl3a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67000 MGI:1914250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl6a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19111 MGI:1206579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13529 MGI:894281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66392 MGI:1861444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19112 MGI:1332225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74188 MGI:1921438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67310 MGI:1914560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl8a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73244 MGI:1920494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75596 MGI:1922846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19113 MGI:1206572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19114 MGI:1206571
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	RP23-135A24.2-001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:494218
definition	note : prolactin pseudogene pseudo : _no_value

name	Prl7d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18814 MGI:97619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl7c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67505 MGI:1914755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56635 MGI:1861446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000000651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666317 MGI:3649927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC195243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:195243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins pseudo : _no_value

name	LOC100041036 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Prl4a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19110 MGI:1206587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prl5a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28078 MGI:106332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 2746 ESTs, 6 Proteins

name	LOC100042393 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042399 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ppia-ps13_297.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606729
definition	note : peptidylprolyl isomerase A pseudogene 13_297.1 pseudo : _no_value

name	LOC626683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 486 ESTs, 12 Proteins

name	Prl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755163 GeneID:19109 MGI:97762
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin transcript_id : NM_011164.1

name	Prl3d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109627657 GeneID:18775 MGI:97606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily d, member 1 transcript_id : NM_008864.2

name	Prl3d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26024346 GeneID:215028 MGI:2660935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily d, member 1 transcript_id : NM_172155.1

name	Prl3d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130084 GeneID:215029 MGI:2660938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily d, member 3 transcript_id : NM_172156.2

name	Prl3c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305406 GeneID:27372 MGI:1351649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily c, member 1 transcript_id : NM_013766.1

name	Prl3b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350123 GeneID:18776 MGI:97607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily b, member 1 transcript_id : NM_008865.3

name	Prl3a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373533 GeneID:67000 MGI:1914250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 3, subfamily a, member 1 transcript_id : NM_025896.2

name	Prl6a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755167 GeneID:19111 MGI:1206579
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 6, subfamily a, member 1 transcript_id : NM_011166.1

name	Prl8a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753689 GeneID:13529 MGI:894281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 2 transcript_id : NM_010088.1

name	Prl2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382490 GeneID:66392 MGI:1861444
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 2, subfamily b, member 1 transcript_id : NM_025532.2

name	Prl8a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892523 GeneID:19112 MGI:1332225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 6 transcript_id : NM_011167.2

name	Prl8a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377286 GeneID:74188 MGI:1921438
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 81 transcript_id : NM_023741.2

name	Prl8a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802878 GeneID:67310 MGI:1914560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family8, subfamily a, member 9 transcript_id : NM_023332.3

name	Prl8a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343582 GeneID:73244 MGI:1920494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 8, subfamily a, member 1 transcript_id : NM_028477.2

name	Prl7b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370056 GeneID:75596 MGI:1922846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily b, member 1 transcript_id : NM_029355.2

name	Prl7a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679470 GeneID:19113 MGI:1206572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily a, member 1 transcript_id : NM_008930.1

name	Prl7a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801384 GeneID:19114 MGI:1206571
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily a, member 2 transcript_id : NM_011168.3

name	Prl7d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755101 GeneID:18814 MGI:97619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily d, member 1 transcript_id : NM_011120.1

name	Prl7c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801710 GeneID:67505 MGI:1914755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 7, subfamily c, member 1 transcript_id : NM_026206.2

name	Prl2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910513 GeneID:56635 MGI:1861446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 2, subfamily a, member 1 transcript_id : NM_019991.1

name	OTTMUSG00000000651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865900 GeneID:666317 MGI:3649927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000000651 transcript_id : NM_001045532.1

name	LOC100041036 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263925 GeneID:100041036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to dynein, axonemal, heavy chain 9 transcript_id : XM_001475685.1

name	Prl4a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364521 GeneID:19110 MGI:1206587
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 4, subfamily a, member 1 transcript_id : NM_011165.2

name	Prl5a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367178 GeneID:28078 MGI:106332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prolactin family 5, subfamily a, member 1 transcript_id : NM_023746.4

name	LOC100042388 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263956 GeneID:100042388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 2746 ESTs, 6 Proteins product : similar to ribosomal protein S18 transcript_id : XM_001478070.1

name	LOC100042399 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263958 GeneID:100042399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042399 transcript_id : XM_001478094.1

name	LOC626683 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149263927 GeneID:626683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 mRNAs, 486 ESTs, 12 Proteins product : similar to ribosomal protein L7a transcript_id : XM_891531.3

name	Prl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755164 CCDS:CCDS26389.1 GeneID:19109 MGI:97762
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence TAS] GO_process : GO:0007595 - lactation [Evidence IEA]; GO:0046425 - regulation of JAK-STAT cascade [Evidence IDA]; GO:0007262 - STAT protein nuclear translocation [Evidence IDA] codon_start : 1 exception : mismatches in translation product : prolactin protein_id : NP_035294.1

name	Prl3d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109627658 GeneID:18775 MGI:97606
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : placental lactogen-I alpha; prolactin-like 2 product : chorionic somatomammotropin hormone 1 protein_id : NP_032890.2

name	Prl3d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024347 GeneID:215028 MGI:2660935
definition	GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : PL-1 beta; placental lactogen-I beta product : prolactin family 3, subfamily d, member 1 protein_id : NP_742167.1

name	Prl3d3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024349 CCDS:CCDS26391.1 GeneID:215029 MGI:2660938
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : PL-1 gamma; placental lactogen I gamma product : prolactin family 3, subfamily d, member 3 protein_id : NP_742168.1

name	Prl3c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305407 CCDS:CCDS26392.1 GeneID:27372 MGI:1351649
definition	codon_start : 1 note : PLP I; prolactin-like protein J product : prolactin-like protein I protein_id : NP_038794.1

name	Prl3b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679363 CCDS:CCDS26393.1 GeneID:18776 MGI:97607
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : placental lactogen 2; prolactin-like; chorionic somatomammotropin hormone 2 product : prolactin family 3, subfamily b, member 1 protein_id : NP_032891.1

name	Prl3a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385390 CCDS:CCDS26394.1 GeneID:67000 MGI:1914250
definition	codon_start : 1 note : prolactin like protein I; prolactin-like protein I product : prolactin family 3, subfamily a, member 1 protein_id : NP_080172.1

name	Prl6a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755168 CCDS:CCDS26395.1 GeneID:19111 MGI:1206579
definition	codon_start : 1 function : secreted glycoprotein hormone note : prolactin-like protein B product : prolactin family 6, subfamily a, member 1 protein_id : NP_035296.1

name	Prl8a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753690 CCDS:CCDS26396.1 GeneID:13529 MGI:894281
definition	codon_start : 1 function : secreted glycoprotein hormone note : decidual/trophoblast prolactin-related protein product : prolactin family 8, subfamily a, member 2 protein_id : NP_034218.1

name	Prl2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313486 CCDS:CCDS26397.1 GeneID:66392 MGI:1861444
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : prolactin like protein k product : placental prolactin-like protein K protein_id : NP_079808.1

name	Prl8a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755170 CCDS:CCDS26398.1 GeneID:19112 MGI:1332225
definition	GO_function : GO:0005102 - receptor binding [Evidence ISS] codon_start : 1 note : prolactin-like protein C; prolactin-like protein C 1 product : prolactin family 8, subfamily a, member 6 protein_id : NP_035297.1

name	Prl8a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21699034 CCDS:CCDS26399.1 GeneID:74188 MGI:1921438
definition	codon_start : 1 note : PLP-C gamma2; prolactin-like protein C 3 product : prolactin family 8, subfamily a, member 81 protein_id : NP_076230.1

name	Prl8a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526757 CCDS:CCDS26400.1 GeneID:67310 MGI:1914560
definition	codon_start : 1 note : prolactin-like protein C 2 product : prolactin-like protein C beta precursor protein_id : NP_075821.1

name	Prl8a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312124 CCDS:CCDS26401.1 GeneID:73244 MGI:1920494
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : prolactin like protein C delta; prolactin-like protein C 4 product : placental prolactin-like protein C delta protein_id : NP_082753.1

name	Prl7b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037423 CCDS:CCDS26402.1 GeneID:75596 MGI:1922846
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : prolactin-like protein N product : placental prolactin-like protein N protein_id : NP_083631.1

name	Prl7a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679471 CCDS:CCDS26403.1 GeneID:19113 MGI:1206572
definition	codon_start : 1 function : secreted glycoprotein hormone note : prolactin-like protein G; prolactin-like protein E product : prolactin family 7, subfamily a, member 1 protein_id : NP_032956.1

name	Prl7a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755172 CCDS:CCDS26404.1 GeneID:19114 MGI:1206571
definition	codon_start : 1 note : prolactin-like protein F product : prolactin family 7, subfamily a, member 2 protein_id : NP_035298.1

name	Prl7d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755102 CCDS:CCDS26405.1 GeneID:18814 MGI:97619
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : proliferin related protein product : prolactin family 7, subfamily d, member 1 protein_id : NP_035250.1

name	Prl7c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385714 CCDS:CCDS26406.1 GeneID:67505 MGI:1914755
definition	codon_start : 1 note : prolactin like protein O; prolactin-like protein O product : placental prolactin-like protein O protein_id : NP_080482.1

name	Prl2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910514 CCDS:CCDS26407.1 GeneID:56635 MGI:1861446
definition	codon_start : 1 note : prolactin-like protein M product : prolactin family 2, subfamily a, member 1 protein_id : NP_064375.1

name	OTTMUSG00000000651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865901 GeneID:666317 MGI:3649927
definition	codon_start : 1 note : mitogen regulated protein, proliferin 4-like product : hypothetical protein LOC666317 protein_id : NP_001038997.1

name	LOC100041036 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263926 GeneID:100041036
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475735.1

name	Prl4a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755166 CCDS:CCDS26409.1 GeneID:19110 MGI:1206587
definition	GO_function : GO:0005148 - prolactin receptor binding [Evidence ISS] GO_process : GO:0001666 - response to hypoxia [Evidence IMP] codon_start : 1 function : secreted glycoprotein hormone product : prolactin-like protein A protein_id : NP_035295.1

name	Prl5a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963813 CCDS:CCDS26410.1 GeneID:28078 MGI:106332
definition	codon_start : 1 note : prolactin-like protein L product : prolactin family 5, subfamily a, member 1 protein_id : NP_076235.1

name	LOC100042388 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263957 GeneID:100042388
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478120.1

name	LOC100042399 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149263959 GeneID:100042399
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478144.1

name	LOC626683 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82949769 GeneID:626683
definition	codon_start : 1 product : hypothetical protein protein_id : XP_896624.1

name	LOC100040945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040945
definition	number : 3 pseudo : _no_value

name	LOC100040945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040945
definition	number : 2 pseudo : _no_value

name	LOC100040945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040945
definition	number : 1 pseudo : _no_value

name	LOC100040957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040957
definition	number : 2 pseudo : _no_value

name	LOC100040957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040957
definition	number : 1 pseudo : _no_value

name	LOC666321 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666321
definition	number : 1 pseudo : _no_value

name	LOC195243 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:195243
definition	number : 1 pseudo : _no_value

name	LOC100042393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042393
definition	number : 6 pseudo : _no_value

name	LOC100042393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042393
definition	number : 5 pseudo : _no_value

name	LOC100042393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042393
definition	number : 4 pseudo : _no_value

name	LOC100042393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042393
definition	number : 3 pseudo : _no_value

name	LOC100042393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042393
definition	number : 2 pseudo : _no_value

name	LOC100042393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042393
definition	number : 1 pseudo : _no_value

clone name	MSMg01-127L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-178B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350P11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-131D05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-265N06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458O18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-211C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-208F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-458E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-456B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-445D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-436P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143P03
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-094B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033L03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-102L08.b	B6Ng01-102L08.g
ACC	DH911521	DH911522
length	1,260	1,102
definition	DH911521\|Mus musculus domesticus DNA, BAC clone: B6Ng01-102L08, 5' end.	DH911522\|Mus musculus domesticus DNA, BAC clone: B6Ng01-102L08, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccacataaaacgagagacattgaaatttatagaggagaaagtggg gaaaatcctcaaagatatgggcacaggggggaaaatcctaaacagaacag caatggcctgtgctcaaagatcaggaatcgacaaatgggacctcataaaa ttgcaaagcttgtgtagggcaaaagatactgtcaataagacaaaaaggcc accaacagattgggaaagaatttttaccaatcctaaatctgatagaggac taatatccaatatatacaaagagctcaagaagctgaattccagaaattca aataaccccattaaaatggggtacagagctaaacaaagaattttcaacta aggaataccgaagggctgagaagcacttagaaaaatattcaacatcctta atcttcagagaaatgcaaatcaaaacattgctgagattccacctcacacc agtcagaatggccagtatcaaaaattcacatgagagcagatactggcgag gatgtggagaaagaggaacactcctccattgctcgtgggattgcaagctg gtacaaccactttggaaatcagtctggcggttcctcagaaaattgtacat agcactactggtagatccagcaatacctctcctggacatatactcagaag atgttccaactgggtataatgacacatgctccactatgttcatagcagcc ctatttataataggcagaagctggaaagaactcagatgtccctcaacaca ggaatggatatggaaaatgtggtacttttacacaatgtagttctactcag ctattaaaaatgatgaatttaagaaattttttggcaaatggatgtatctg gaggatatcacaaaagaagtcacttgatatgcgctcattgataagtggat attagcccagaaaagtagaatacccaaggtacaacttctaaacacaataa aatcaaggatgaccaatgtgtggatacttgattcctccctagaataggaa ataaaatatccatggaaggagttgcagagacaaagtttggagctagcgaa atgatggatcatccatggactgtctcacctgggcgtcatcccataatcag ccacgaaccagaaactatgcttgcagcatcattcgctgagcttcctgaaa tagctgtcttcttgtgagctatgcaaggcctggcaatacgaatgaatgtt ctccacgtcatctaaggattgaccatggcctcagggggagagagctcaca ggcaagatat	gaattcagatgactatgtttgaagaagattttaaagaaattaagacccat tcaattattgtgttctgaggggttttaaacatttttaaatttttcaaata tttggggattgtgcataataatcataatcatattggctttcagtactctg caagttgtgtgatcagtagtgtctgtctttcattgtctttcattaattat cacaaatacttcaacttttatcaccagtaaatttcctgaaaacaccagtt cttttttgtttgtttgtttgtttcttttgttttgttttgttttgttttgt tttgttttgagacagggtttctctgtagagccctggctatcctggaactc actttgtagatcaggctggcctcaaactcagaattcaccttcctctgcct cccaagtgctgggattaaaggtgtgtgccaccatcgcccagtgaaaacac cagttcttgattcctacaaattgacaagtaataaaatgtctgaaggaatt aattagttacaaaatgtgttggttgcacatctaacttcaactacttgtga agtatttgattgaaacatgttggtggtatagataggtgttttatgaaagt cacaattgaaattttgactaattccccattgagacttttatatttctgag agccactttttatttttaaatgagtcaacaacaaattcaaaagatacaaa tttaaaggatgctacatgatatttcagaagcagagcacatgaaagaagta tcagcagttatctatttttaacatgtaacacttcagacgttgagataaat atcaaccttcttaaagtcattgtctaggcagctgatcatgccatatgaag aacgaatgcgagtatcttcattgtcagattgcaagagtggcagtctggac caggcagggttcttcttttcttcatctccattctgagctaatcatcaaaa atatatcactatcagtttattataatattttggtgcctaaatgctaataa tttgtagaggtagattttcaaacagctagtgtatggatttcatgatgtgg tgaggtagctaaaagagagattggtgcacttgtcttttttgtctgatcag tc
quality values	Open. Hide. 61 61 35 38 61 61 43 14 61 37 61 61 61 61 61 49 47 55 61 61 61 49 52 61 59 61 27 18 19 18 23 31 30 18 31 24 37 55 55 59 59 59 61 59 61 61 59 61 61 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 52 52 59 36 30 37 34 37 44 44 59 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 55 55 61 61 59 59 59 59 61 59 55 61 61 61 61 59 61 61 61 61 61 59 43 61 61 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 29 50 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 42 40 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 57 57 57 57 53 57 57 53 57 57 53 53 57 47 52 57 53 47 57 57 53 53 57 57 47 47 40 57 57 53 57 57 50 57 57 57 53 53 57 57 53 57 57 57 53 53 57 53 53 50 53 57 53 53 57 47 53 53 53 47 57 57 57 53 53 57 53 57 47 53 45 52 53 53 53 57 53 57 52 38 45 57 57 39 43 20 46 36 52 53 52 34 57 53 57 43 41 57 50 43 45 38 57 50 57 47 53 45 53 50 57 57 53 53 50 52 37 47 53 53 43 53 53 53 50 40 53 39 39 53 53 30 46 38 46 52 42 50 57 42 42 50 37 53 40 47 39 52 27 50 28 57 46 30 52 53 53 41 35 57 45 37 42 40 33 53 44 42 24 52 28 40 35 27 46 41 53 40 35 35 52 34 47 36 20 52 42 40 33 38 40 37 36 40 37 57 53 48 57 57 53 34 53 32 53 44 29 29 37 40 57 57 33 27 35 24 44 29 33 30 45 27 48 32 30 41 34 38 35 34 34 35 35 33 48 35 32 18 29 28 51 51 51 30 32 33 30 28 30 33 32 28 51 32 29 37 26 41 51 21 23 46 46 51 51 44 32 18 24 29 51 29 30 38 23 25 28 39 28 23 34 29 29 29 30 27 25 17 28 17 25 29 30 20 29 25 43 51 29 28 46 29 26 30 34 31 35 38 29 38 34 35 24 27 30 28 28 35 36 34 27 43 30 36 27 31 26 31 28 25 36 29 38 28 25 20 29 35 24 29 39 31 20 28 39 51 51 32 21 33 34 25 40 23 21 29 24 39 36 14 10 14 17 15 18 29 16 27 33 30 39 28 27 41 51 30 23 27 19 14 23 35 29 51 51 27 27 21 21 25 33 22 34 24 30 35 19 26 11 17 19 29 16 15 11 16 25 9 13 10 16 14 20 28 29 17 21 29 29 24 14 51 30 10 12 14 27 8 22 12 23 16 33 39 14 10 19 44 44 14 19 23 27 16 28 14 30 19 29 9 7 16 5 6 16 29 29 29 22 12 12 22 9 10 15 9 38 31 18 27 44 12 33 13 22 11 18 16 23 8 16 15 12 36 15 24 29 26 29 19 26 11 7 24 8 24 19 29 5 4 7 22 15 24 17 19 13 10 8 6 6 6 20 10 16 42 20 9 9 12 21 14 22 16 30 20 9 14 15 19 8 10 24 16 17 13 9 7 7 14 6 4 4 4 4 5 7 5 10 14 5 6 5 2 2 2 5 25 6 7 19 19 23 13 12 18 11 6 7 13 7 5 12 3 7 5 6 7 17 5 16 8 20 6 10 13 13 20 8 5 5 5 4 6 19 6 7 18 7 8 13 20 6 5 3 4 3 9 5 4 3 3 6 20 5 8 7 3 4 3 4 3 6 4 1 13 4 13 7 4 4 8 4 4 7 5 12 4 12 4 10 4 6 8 4 7 16 5 3 7 5 5 4 3 17 13 6 7 3 1 3 8 4 13 4 18 4 4 3 5 8 9 4 5 7 6 5 4 7 4 4 4 4 6 3 3 6 19 5 6 8 2 3 3	Open. Hide. 59 61 61 59 61 59 12 13 37 22 26 26 22 28 27 39 61 61 61 61 59 61 61 61 61 61 61 59 49 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 37 55 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 53 61 61 61 61 61 52 61 61 61 50 61 53 61 61 61 61 61 61 61 61 61 43 61 61 61 61 61 61 61 61 53 61 61 61 61 53 52 53 57 57 57 53 47 57 57 57 57 57 53 52 57 57 47 57 57 47 50 57 46 42 53 50 57 57 57 47 57 47 42 52 57 53 57 57 52 53 37 47 53 53 57 53 53 53 53 53 38 57 57 57 57 47 47 53 53 57 42 53 53 53 52 53 43 50 53 52 37 46 38 33 32 52 57 57 53 45 52 39 47 47 57 53 53 50 45 41 57 47 53 53 39 53 37 57 38 46 41 32 53 50 57 57 57 39 38 32 57 57 57 52 38 57 53 50 52 53 45 53 45 35 37 52 34 52 46 27 41 47 53 53 42 28 57 57 53 42 48 40 36 36 27 41 52 50 57 53 36 57 34 47 53 42 32 34 39 38 25 50 36 50 45 40 31 36 42 57 52 42 31 24 51 41 24 40 31 34 57 24 40 32 31 32 41 43 52 57 57 20 52 52 29 37 28 34 39 41 31 53 40 37 29 48 36 40 40 40 32 40 57 57 57 47 31 30 35 24 40 41 29 29 43 37 37 34 40 39 39 6 8 10 20 28 32 48 33 39 34 39 28 38 51 38 30 29 37 36 29 29 30 44 32 28 37 32 31 30 51 39 28 33 36 31 31 29 47 28 39 29 37 35 30 28 31 32 29 29 37 35 31 29 22 29 29 17 20 17 33 31 34 34 34 33 25 36 34 28 34 36 29 24 38 30 18 36 22 22 20 26 35 31 33 34 23 29 32 36 20 34 30 15 41 15 33 29 23 22 21 11 36 7 14 23 39 20 28 27 30 33 29 28 33 27 14 30 17 23 19 26 15 27 51 30 26 20 33 33 30 31 21 44 44 15 12 9 39 28 10 16 27 29 21 29 16 33 25 28 20 23 36 10 28 34 20 25 27 28 23 33 34 30 51 51 51 25 12 17 21 12 25 16 32 15 22 20 24 24 27 15 38 51 28 7 5 38 26 28 31 31 12 19 22 51 35 23 21 15 15 30 21 31 26 24 39 14 19 34 23 22 30 29 7 16 39 13 39 11 19 13 33 10 28 12 13 30 17 12 25 16 42 37 21 7 26 42 19 21 31 14 29 20 29 9 6 12 5 8 11 17 23 22 20 30 12 27 6 22 21 23 12 8 20 15 6 9 11 22 17 29 5 12 8 22 15 14 30 30 7 8 24 5 16 3 8 16 24 11 5 15 9 14 9 12 16 4 7 5 6 9 27 36 35 27 5 9 3 4 10 24 10 4 6 9 9 5 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_27949182_27950302
seq2: B6Ng01-102L08.g_69_1170 (reverse)

seq1  GACTGATCAGACAAAAAAGACAAGTGCAACAAATCCTTCTCTTTTAGCTA  50
      ||||||||||||||||||||||||||| || ||||  |||||||||||||
seq2  GACTGATCAGACAAAAAAGACAAGTGC-ACCAATC--TCTCTTTTAGCTA  47

seq1  CCCTCACCAACATCATGGAAATCCATACACTTAGCTTGTTTTGAAAATTC  100
       ||||||| ||||||| ||||||||||||| |||||   |||||||| ||
seq2  -CCTCACC-ACATCAT-GAAATCCATACAC-TAGCT--GTTTGAAAA-TC  90

seq1  TAACCTCTTACAAATTTATTTAGCATTTAGGCACCAAAATATTATAATAA  150
      | ||||| ||||||||   ||||||||||||||||||||||||||||| |
seq2  T-ACCTC-TACAAATT--ATTAGCATTTAGGCACCAAAATATTATAAT-A  135

seq1  AACTGATAGTTGAATATATTTTTGATGATTAGCTTCAGAATGGAGATGAA  200
      ||||||||||   |||||||||||||||||||| ||||||||||||||||
seq2  AACTGATAGT--GATATATTTTTGATGATTAGC-TCAGAATGGAGATGAA  182

seq1  GAAAAGAAGAACCCTGCCTGGTCCAGACTGCCACTCTTGCAATCTGACAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAGAAGAACCCTGCCTGGTCCAGACTGCCACTCTTGCAATCTGACAA  232

seq1  TGAAGATACTCGCATTCGTTCTTCATATGGCATGATCAGCTGCCTAGACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGATACTCGCATTCGTTCTTCATATGGCATGATCAGCTGCCTAGACA  282

seq1  ATGACTTTAAGAAGGTTGATATTTATCTCAACGTCCTGAAGTGTTACATG  350
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  ATGACTTTAAGAAGGTTGATATTTATCTCAACGT-CTGAAGTGTTACATG  331

seq1  TTAAAAATAGATAACTGCTGATACTTCTTTCATGTGCTCTGCTTCTGAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAATAGATAACTGCTGATACTTCTTTCATGTGCTCTGCTTCTGAAA  381

seq1  TATCATGTAGCATCCTTTAAATTTGTATCTTTTGAATTTGTTGTTGACTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCATGTAGCATCCTTTAAATTTGTATCTTTTGAATTTGTTGTTGACTC  431

seq1  ATTTAAAAATAAAAAGTGGCTCTCAGAAATATAAAAGTCTCAATGGGGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAAAAATAAAAAGTGGCTCTCAGAAATATAAAAGTCTCAATGGGGAA  481

seq1  TTAGTCAAAATTTCAATTGTGACTTTCATAAAACACCTATCTATACCACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTCAAAATTTCAATTGTGACTTTCATAAAACACCTATCTATACCACC  531

seq1  AACATGTTTCAATCAAATACTTCACAAGTAGTTGAAGTTAGATGTGCAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATGTTTCAATCAAATACTTCACAAGTAGTTGAAGTTAGATGTGCAAC  581

seq1  CAACACATTTTGTAACTAATTAATTCCTTCAGACATTTTATTACTTGTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACACATTTTGTAACTAATTAATTCCTTCAGACATTTTATTACTTGTCA  631

seq1  ATTTGTAGGAATCAAGAACTGGTGTTTTCACTGGGCGATGGTGGCACACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGTAGGAATCAAGAACTGGTGTTTTCACTGGGCGATGGTGGCACACA  681

seq1  CCTTTAATCCCAGCACTTGGGAGGCAGAGGAAGGTGAATTCTGAGTTTGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTAATCCCAGCACTTGGGAGGCAGAGGAAGGTGAATTCTGAGTTTGA  731

seq1  GGCCAGCCTGATCTACAAAGTGAGTTCCAGGATAGCCAGGGCTCTACAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGCCTGATCTACAAAGTGAGTTCCAGGATAGCCAGGGCTCTACAGA  781

seq1  GAAACCCTGTCTCAAAACAAAACAAAACAAAACAAAACAAAACAAAAGAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACCCTGTCTCAAAACAAAACAAAACAAAACAAAACAAAACAAAAGAA  831

seq1  ACAAACAAACAAACAAAAAAGAACTGGTGTTTTCAGGAAATTTACTGGTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAAACAAACAAAAAAGAACTGGTGTTTTCAGGAAATTTACTGGTG  881

seq1  ATAAAAGTTGAAGTATTTGTGATAATTAATGAAAGACAATGAAAGACAGA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAGTTGAAGTATTTGTGATAATTAATGAAAGACAATGAAAGACAGA  931

seq1  CACTACTGATCACACAACTTGCAGAGTACTGAAAGCCAATATGATTATGA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTACTGATCACACAACTTGCAGAGTACTGAAAGCCAATATGATTATGA  981

seq1  TTATTATGCACAATCCCCAAATATTTGAAAAATTTAAAAATGTTTAAAAC  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTATGCACAATCCCCAAATATTTGAAAAATTTAAAAATGTTTAAAAC  1031

seq1  CCCTCAGAACACAATAATTGAATGGGTCTTAATTTCTTTAAAATCTTCTT  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCAGAACACAATAATTGAATGGGTCTTAATTTCTTTAAAATCTTCTT  1081

seq1  CAAACATAGTCATCTGAATTC  1121
      |||||||||||||||||||||
seq2  CAAACATAGTCATCTGAATTC  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information