MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-221O21
Chromosome	13 (Build37)
Map Location	58,970,692 - 59,092,831
singlet/doublet	doublet
Overlap gene	Ntrk2
Upstream gene	Spock1, Klhl3, Hnrpa0, 5133401N09Rik, Ubqln1, LOC671252, Gkap1, Kif27, Hnrpk, Rmi1, LOC100041086, Slc28a3, LOC100041510, LOC435361
Downstream gene	LOC100041533, Agtpbp1, Mak10, Golph2, 4921517D22Rik, 1700013B16Rik, EG238662, 4932411G14Rik, Isca1, Zcchc6
Link	Open Mouse BAC browser

Click to get alignment info.

name	Spock1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20745 MGI:105371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl3 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 19 Proteins

name	Hnrpa0 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77134 MGI:1924384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 244 ESTs, 50 Proteins

name	5133401N09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75731 MGI:1922981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ubqln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56085 MGI:1860276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC671252 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 2 Proteins pseudo : _no_value

name	Gkap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56278 MGI:1891694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75050 MGI:1922300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15387 MGI:99894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rmi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74386 MGI:1921636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Slc28a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114304 MGI:2137361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041510 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC435361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Ntrk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18212 MGI:97384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041533 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Agtpbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67269 MGI:2159437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mak10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78689 MGI:1925939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Golph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105348 MGI:1917329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4921517D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70900 MGI:1918150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72219 MGI:1919469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG238662 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238662 MGI:3646080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	4932411G14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238663 MGI:3045260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69046 MGI:1916296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214290 MGI:2387179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spock1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50053937 GeneID:20745 MGI:105371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 transcript_id : NM_009262.2

name	Klhl3 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264250 GeneID:627648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 19 Proteins product : kelch-like 3 (Drosophila) transcript_id : XM_354754.6

name	Hnrpa0 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395153 GeneID:77134 MGI:1924384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 244 ESTs, 50 Proteins product : heterogeneous nuclear ribonucleoprotein A0, transcript variant 2 transcript_id : XM_891442.2

name	5133401N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205441 GeneID:75731 MGI:1922981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133401N09 gene transcript_id : NM_198004.2

name	5133401N09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114205445 GeneID:75731 MGI:1922981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5133401N09 gene transcript_id : NM_001048060.1

name	Ubqln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22726198 GeneID:56085 MGI:1860276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 1 transcript_id : NM_026842.3

name	Ubqln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22726190 GeneID:56085 MGI:1860276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 1 transcript_id : NM_152234.1

name	Gkap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383921 GeneID:56278 MGI:1891694
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G kinase anchoring protein 1 transcript_id : NM_019832.3

name	Kif27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32401468 GeneID:75050 MGI:1922300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 27 transcript_id : NM_175214.3

name	Hnrpk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350515 GeneID:15387 MGI:99894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein K transcript_id : NM_025279.2

name	Rmi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541983 GeneID:74386 MGI:1921636
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) transcript_id : NM_028904.2

name	Slc28a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598782 GeneID:114304 MGI:2137361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 transcript_id : NM_022317.3

name	LOC100041510 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264264 GeneID:100041510
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to ribonuclease T2 transcript_id : XM_001476937.1

name	Ntrk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68215980 GeneID:18212 MGI:97384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotrophic tyrosine kinase, receptor, type 2 transcript_id : NM_008745.2

name	Ntrk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68215969 GeneID:18212 MGI:97384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotrophic tyrosine kinase, receptor, type 2 transcript_id : NM_001025074.1

name	LOC100041533 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264268 GeneID:100041533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041533 transcript_id : XM_001477019.1

name	Agtpbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158694 GeneID:67269 MGI:2159437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP/GTP binding protein 1 transcript_id : NM_023328.2

name	Agtpbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158682 GeneID:67269 MGI:2159437
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP/GTP binding protein 1 transcript_id : NM_001048008.1

name	Mak10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644570 GeneID:78689 MGI:1925939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAK10 homolog, amino-acid N-acetyltransferase subunit, (S. cerevisiae) transcript_id : NM_030153.1

name	Golph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93141216 GeneID:105348 MGI:1917329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi phosphoprotein 2 transcript_id : NM_001035122.2

name	Golph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93141215 GeneID:105348 MGI:1917329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi phosphoprotein 2 transcript_id : NM_027307.4

name	4921517D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347499 GeneID:70900 MGI:1918150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921517D22 gene transcript_id : NM_183290.2

name	1700013B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970995 GeneID:72219 MGI:1919469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700013B16 gene transcript_id : NM_028157.2

name	EG238662 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395158 GeneID:238662 MGI:3646080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : predicted gene, EG238662 transcript_id : XM_138646.6

name	4932411G14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970504 GeneID:238663 MGI:3045260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932411G14 gene transcript_id : NM_177711.3

name	Isca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360364 GeneID:69046 MGI:1916296
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iron-sulfur cluster assembly 1 homolog (S. cerevisiae) transcript_id : NM_026921.3

name	Zcchc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059475 GeneID:214290 MGI:2387179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 6 transcript_id : NM_153538.2

name	Spock1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50053938 GeneID:20745 MGI:105371
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : sparc/osteonectin, cwcv and kazal-like domains proteoglycan product : sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1 protein_id : NP_033288.2

name	Klhl3 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264251 GeneID:627648
definition	codon_start : 1 product : similar to Kelch-like protein 3 protein_id : XP_354754.6

name	Hnrpa0 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82950644 GeneID:77134 MGI:1924384
definition	codon_start : 1 product : heterogeneous nuclear ribonucleoprotein A0 isoform 2 protein_id : XP_896535.1

name	5133401N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205442 GeneID:75731 MGI:1922981
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004765 - shikimate kinase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : gluconokinase-like protein isoform a protein_id : NP_932121.2

name	5133401N09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114205446 GeneID:75731 MGI:1922981
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004765 - shikimate kinase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : gluconokinase-like protein isoform b protein_id : NP_001041525.1

name	Ubqln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726191 CCDS:CCDS26569.1 GeneID:56085 MGI:1860276
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0019215 - intermediate filament binding [Evidence NAS]; GO:0019900 - kinase binding [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence NAS] GO_process : GO:0008632 - apoptotic program [Evidence ISS]; GO:0006464 - protein modification [Evidence IEA]; GO:0031396 - regulation of protein ubiquitination [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : ubiquilin 1 isoform 2 protein_id : NP_689420.1

name	Ubqln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22726199 GeneID:56085 MGI:1860276
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0019215 - intermediate filament binding [Evidence NAS]; GO:0019900 - kinase binding [Evidence ISS]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence NAS] GO_process : GO:0008632 - apoptotic program [Evidence ISS]; GO:0006464 - protein modification [Evidence IEA]; GO:0031396 - regulation of protein ubiquitination [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : ubiquilin 1 isoform 1 protein_id : NP_081118.3

name	Gkap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789999 GeneID:56278 MGI:1891694
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007199 - G-protein signaling, coupled to cGMP nucleotide second messenger [Evidence TAS] codon_start : 1 note : 42 kD cGMP-dependent protein kinase anchoring protein product : G kinase anchoring protein 1 protein_id : NP_062806.1

name	Kif27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32401469 CCDS:CCDS26570.1 GeneID:75050 MGI:1922300
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : kinesin-related protein KIF27 protein_id : NP_780423.2

name	Hnrpk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384620 GeneID:15387 MGI:99894
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein K protein_id : NP_079555.1

name	Rmi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541984 CCDS:CCDS26571.1 GeneID:74386 MGI:1921636
definition	codon_start : 1 exception : mismatches in translation product : RMI1, RecQ mediated genome instability 1, homolog protein_id : NP_083180.2

name	Slc28a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91598783 CCDS:CCDS26572.1 GeneID:114304 MGI:2137361
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0001882 - nucleoside binding [Evidence IEA]; GO:0015390 - purine-specific nucleoside:sodium symporter activity [Evidence IDA]; GO:0015389 - pyrimidine- and adenine-specific:sodium symporter activity [Evidence IDA] GO_process : GO:0015860 - purine nucleoside transport [Evidence IDA]; GO:0015864 - pyrimidine nucleoside transport [Evidence IDA] codon_start : 1 note : concentrative Na+-nucleoside cotransporter product : solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 protein_id : NP_071712.3

name	LOC100041510 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264265 GeneID:100041510
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476987.1

name	Ntrk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68215970 CCDS:CCDS26573.1 GeneID:18212 MGI:97384
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007631 - feeding behavior [Evidence IMP]; GO:0042490 - mechanoreceptor differentiation [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0019222 - regulation of metabolism [Evidence IMP]; GO:0046548 - retinal rod cell development [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : neurotrophic tyrosine kinase, receptor, type 2 isoform a protein_id : NP_001020245.1

name	Ntrk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679150 GeneID:18212 MGI:97384
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007631 - feeding behavior [Evidence IMP]; GO:0042490 - mechanoreceptor differentiation [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0019222 - regulation of metabolism [Evidence IMP]; GO:0046548 - retinal rod cell development [Evidence IMP]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : neurotrophic tyrosine kinase, receptor, type 2 isoform b protein_id : NP_032771.1

name	LOC100041533 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264269 GeneID:100041533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477069.1

name	Agtpbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158695 GeneID:67269 MGI:2159437
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Purkinje cell degeneration; nuclear ATP/GTP-binding protein product : ATP/GTP binding protein 1 isoform 1 protein_id : NP_075817.2

name	Agtpbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158683 GeneID:67269 MGI:2159437
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Purkinje cell degeneration; nuclear ATP/GTP-binding protein product : ATP/GTP binding protein 1 isoform 2 protein_id : NP_001041473.1

name	Mak10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644571 CCDS:CCDS26575.1 GeneID:78689 MGI:1925939
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : embryonic growth-associated product : MAK10 homolog, amino-acid N-acetyltransferase subunit protein_id : NP_084429.1

name	Golph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78190500 CCDS:CCDS26576.1 GeneID:105348 MGI:1917329
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : golgi phosphoprotein 2 protein_id : NP_001030294.1

name	Golph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78190502 CCDS:CCDS26576.1 GeneID:105348 MGI:1917329
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : golgi phosphoprotein 2 protein_id : NP_081583.3

name	4921517D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304099 GeneID:70900 MGI:1918150
definition	codon_start : 1 product : hypothetical protein LOC70900 protein_id : NP_899113.1

name	1700013B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970996 GeneID:72219 MGI:1919469
definition	codon_start : 1 product : hypothetical protein LOC72219 protein_id : NP_082433.2

name	EG238662 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395159 GeneID:238662 MGI:3646080
definition	codon_start : 1 product : hypothetical protein protein_id : XP_138646.6

name	4932411G14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970505 GeneID:238663 MGI:3045260
definition	codon_start : 1 product : hypothetical protein LOC238663 protein_id : NP_808379.2

name	Isca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312189 CCDS:CCDS26578.1 GeneID:69046 MGI:1916296
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0051536 - iron-sulfur cluster binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : HESB like domain containing 2 protein_id : NP_081197.1

name	Zcchc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059476 GeneID:214290 MGI:2387179
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger, CCHC domain containing 6 protein_id : NP_705766.2

name	LOC100041086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041086
definition	number : 1 pseudo : _no_value

name	LOC100041086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041086
definition	number : 2 pseudo : _no_value

name	LOC100041086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041086
definition	number : 3 pseudo : _no_value

name	LOC100041086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041086
definition	number : 4 pseudo : _no_value

name	LOC100041086 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041086
definition	number : 5 pseudo : _no_value

name	LOC435361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:435361
definition	number : 1 pseudo : _no_value

name	LOC671252 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264262 GeneID:671252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 2 Proteins product : similar to Ac2-210 pseudo : _no_value transcript_id : XR_032911.1

clone name	MSMg01-266G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-218A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519G11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-294L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299M07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-221O21.b	B6Ng01-221O21.g
ACC	GA037087	GA037088
length	1,191	1,108
definition	B6Ng01-221O21.b	B6Ng01-221O21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(58,970,692 - 58,971,869)	(59,091,725 - 59,092,831)
sequence	gaattcatatcatgtgcttggatcttcttaggtgctttgtgtgaggagtg attgttagtactcctattctatcatgaggtttatcaagtcggatatatgt catagtcatggtgaccattgaaacattgggtccaaataaacatgactaag aattctaccttttaaaaatggagttttacatgtaaaatcaaatggtacta taaaccaaattctcccatttgtgggatccacgaggatttgagaacatgtg aagacaccaacttttccatcatcttcaaagcaagccccacatccagggag aaaccttggtcccaggttaactgtatagactcctccggggcttccccagc ttcgaaactgaaagtccattatctcagggatgtgcttcgtccctggctac ctgggatagttcataaccctggtgcaaactgagtttttcatatataaagt tatgtaccaagctgactgcgaaacaacatttcttacattctttgacctca aaatattgttttgaaagtagcattctcagagtcttccgcccatacaggaa cagaatggttttggtccatctggtctgaggccatgacctctgagctggga ctctattctccagtgagagtctggacagtctggtccttcctcctgtctca ctctggagtcctggatcaaagtgtgctcagggaggtggtggagccatgct gagttgtgcaaggatggacagagcttggaagagggcttagggtagattgg gaaagccaccaaggccacctaaggtgaatgctggagggcagaggccctgg ctgaccgagactgggtcaaggggaaggtgagcagacagcaaagggtgtta ggttctgagacagtgggtatctgggaagccagaggggacctgctcccatg gggctgtgacaccttccctcagtagggcttcaaggccatcactgtggggg acagtgtgtgctgtgggggtcttcccaaagggaaatggcttgagaggacc agtcattgtcttacacgtggcatcatgaaggcacgaaccttaaggctctt actgcttaagtcactaatgggtcccagactacatttgcagggcaggctac tatgccttggggtcttccatgtcttaagagattagctattttggtattgg tactcaacctactcaaaaactatatattgtgcagtggataa	gaattcagaacctttgctcatgtgcactccaagaagctcctcaaaggggt tgaaaacctctgtcgttttgcaaaagctctcacttgcctttgttgggaga agagtgacagagtggacattgtagttaagaagaatagggcatgcatggac tctgtgacgttttcaactactgctcaaatgtcccctctcttcagaacatc agctttcctgcaccatggctggccagcaagcctgtgcctacctaggcaat tgtttaataagcatatgaccagtaggggaaacacacagctataactgaag aaacatgggacccatactgcagagaggcaataaatgtccatttcattgaa aataaagtcaaccttcaaagtaaacgtaaaacaactttaaaattcttgct atgattttgcctctaagagtagttagccataggtgtgtgcagaggacatg ctctttaagacaaagatatgagggtgtgtcttagagacaaccccacttaa atttaggcacaggatttaggaccctagaataattacaaggctgttgtgga aggaaacacgattttgggaacaacaataagtctacggataaaacacaacc ccacccaccaactcaagacacagtttgggagttttgctggttaataggct tggtttctgtttttcagctcagaaggtgtgctcccatcacaccctgtcaa aatccctctcaataggcaaggcaaggagaagatagcacagctaccctcga gccaagtctgtaagtcctactggtcaaccaccccatgctgtcagacactg tgattttcagacacatctacacaggctagttgaataaagaccaactccag acttgatgttactgagctcctcagctccatcttgccatcctgattgatcg aggaagatggtctatagtttaaatgacacagcactttgaagggcttagtc atagagcactctgtttgtcctgggaaaggcaactttcttgcttggctagt atggaagctaagagtgacttccagatgctgtctgggccagaattgcaaga ataaccatagactcttctcctccaatcagcctggattaagcctctttggg ttcctgca
quality values	Open. Hide. 58 25 24 37 58 34 25 54 52 42 28 39 45 62 62 62 62 62 62 62 62 27 41 62 62 62 62 62 54 54 62 49 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 58 58 58 58 58 58 58 54 54 58 58 58 42 58 58 54 58 54 54 58 58 58 58 58 58 58 58 58 58 58 54 54 47 58 58 58 58 58 58 54 54 52 58 54 58 58 58 58 58 58 58 54 58 54 49 58 52 58 52 54 58 58 58 54 54 54 58 54 52 58 45 46 58 58 58 58 45 41 58 54 50 58 51 58 58 58 51 52 58 58 51 21 58 50 54 53 51 51 45 41 58 54 58 58 51 58 35 58 54 58 58 58 45 33 58 53 58 54 39 58 51 54 51 58 46 52 51 58 58 32 58 51 51 51 58 58 58 49 53 52 54 51 58 51 58 58 52 51 50 50 49 53 58 50 42 58 50 53 47 44 33 41 42 49 51 53 53 51 58 58 26 50 42 43 43 58 49 39 42 53 41 58 58 50 52 51 50 58 43 51 53 39 50 58 49 27 16 54 42 53 54 37 54 42 54 25 54 54 32 50 50 52 52 49 51 29 54 45 37 35 45 38 24 49 25 54 19 26 40 54 38 32 40 40 32 18 40 49 50 46 19 33 33 17 36 7 54 44 40 34 33 28 7 49 46 35 44 15 29 28 36 51 49 51 52 54 44 31 40 28 28 35 47 24 31 15 54 13 42 17 23 51 33 33 53 18 52 32 36 46 36 34 53 40 52 51 33 28 13 49 45 27 33 25 51 29 38 25 47 53 41 34 30 22 32 30 22 6 22 11 25 15 23 26 31 31 51 33 42 35 28 27 30 51 45 31 41 36 9 34 31 31 51 25 42 31 23 33 21 34 30 27 18 36 46 27 51 25 9 31 26 33 16 9 13 6 15 20 31 27 46 12 26 21 31 31 37 46 46 28 31 21 30 31 25 31 46 29 25 24 27 32 30 29 23 21 9 32 41 17 31 25 25 16 21 21 42 37 23 21 16 4 6 23 41 36 21 30 32 32 22 31 18 20 29 31 31 28 29 31 22 15 32 31 22 26 26 26 43 21 14 16 31 31 16 11 19 14 14 17 16 17 32 27 22 16 17 12 29 44 41 43 17 19 13 25 14 18 28 16 20 21 34 35 31 24 14 19 9 6 26 19 30 27 25 31 12 32 17 10 25 15 9 33 17 12 43 10 4 12 21 7 9 18 32 22 6 28 9 11 24 12 21 25 22 32 33 27 31 28 16 18 13 18 34 28 19 6 4 5 4 15 15 11 13 15 9 7 3 8 8 13 8 23 6 6 16 14 11 6 23 27 13 18 9 7 13 18 16 8 3 6 6 6 10 20 14 12 10 7 9 15 5 9 11 7 6 6 5 6 5 10 14 3 3 11 34 25 5 4 9 12 23 16 21 5 4 6 4 4 7 3 5 25 7 7 5 5 3 3 5 5 18 10 4 10 11 7 6 6 4 5 16 17 3 2 4 4 5 6 4 6 4 13 5 12 10 5 24 15 5 10 6 10 5 9 6 3 1 2 3 11 28 8 11 5 6 3 2 2 4 4 4 5 1 1 3 3 3 3 4 6 9 4 12 5 8 7 11 25 22 14 5 6 8 7 7 9 5 21 4 11 4 4 11 3 1 1 8 3 2 5 7 12	Open. Hide. 62 47 51 44 62 47 32 44 62 62 59 62 59 59 46 49 34 56 46 36 56 59 62 62 59 59 59 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 56 54 56 59 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 59 46 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 46 58 49 49 54 58 58 58 58 58 58 58 54 52 58 52 58 50 58 58 58 54 44 43 58 54 58 58 54 58 49 54 58 58 58 58 58 58 58 58 52 58 58 54 54 42 58 58 58 58 58 54 58 58 54 49 58 58 54 58 58 54 54 58 52 52 54 54 51 58 49 54 58 42 45 51 58 49 47 58 58 58 54 47 58 51 46 53 53 49 51 50 58 33 58 58 58 48 58 58 51 58 58 53 58 49 58 54 41 58 51 58 37 37 46 58 51 47 46 58 58 58 58 58 58 58 40 41 52 54 51 54 50 58 53 58 50 51 58 53 52 58 40 58 54 50 50 58 43 50 52 50 51 52 54 53 58 58 46 30 51 58 52 52 51 44 43 54 51 58 53 52 50 51 58 50 53 53 53 42 54 58 44 58 58 44 51 32 34 54 54 54 51 42 52 54 54 42 33 37 46 28 35 40 49 41 54 37 51 38 27 54 49 49 41 54 37 54 54 54 54 38 29 35 46 49 40 42 23 54 40 16 54 31 44 33 40 52 53 32 54 52 37 42 33 32 45 52 47 54 54 32 51 35 47 52 54 54 32 45 40 54 47 47 47 53 37 37 33 33 37 20 54 29 31 39 31 52 26 37 41 38 49 38 32 47 40 31 35 26 45 32 37 45 32 40 31 40 52 28 35 53 53 52 35 24 32 30 42 45 28 37 32 42 42 28 45 33 31 29 33 31 31 31 42 36 31 32 33 32 16 31 16 51 31 31 31 30 40 40 32 29 28 30 31 33 37 18 30 29 18 42 17 12 14 30 42 34 36 43 34 48 48 42 34 25 20 31 24 35 36 26 41 31 33 31 31 18 33 20 9 46 24 31 32 18 38 32 26 31 41 28 33 46 29 22 28 18 32 21 20 17 36 31 31 35 27 36 11 24 13 25 28 21 31 15 25 20 27 24 30 31 16 31 21 24 27 26 31 31 32 34 31 21 29 20 33 38 19 27 31 25 19 20 10 12 44 32 31 37 11 14 31 32 36 25 21 31 14 22 26 6 7 17 18 19 33 17 31 19 17 7 17 21 20 44 27 31 44 19 23 28 26 16 13 26 25 15 21 21 34 37 48 29 9 22 14 25 48 25 9 18 14 24 7 12 26 15 43 14 15 33 17 32 10 10 30 21 11 10 33 48 26 13 10 17 14 23 29 28 18 11 34 9 18 12 12 20 13 28 26 38 9 8 12 14 17 20 11 13 15 15 16 24 24 6 5 4 12 11 15 11 21 14 27 28 10 7 3 3 8 12 8 14 19 12 15 9 23 19 7 30 5 7 28 28 7 3 3 7 16 30 11 7 9 23 16 21 17 12 4 4 7 6 5 7 26 6 8 6 11 5 17 10 6 9 6 3 3 7 9 5 22 6 4 15 8 4 5 22 6 4 7 6 8 6 6 17 11 3 11 4 5 14 5 8 10 16 16 7 10 5 12 5 4 9 5 4 4 10 14 5 8 7 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_58970692_58971869
seq2: B6Ng01-221O21.b_48_1238

seq1  GAATTCATATCATGTGCTTGGATCTTCTTAGGTGCTTTGTGTGAGGAGTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATATCATGTGCTTGGATCTTCTTAGGTGCTTTGTGTGAGGAGTG  50

seq1  ATTGTTAGTACTCCTATTCTATCATGAGGTTTATCAAGTCGGATATATGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTAGTACTCCTATTCTATCATGAGGTTTATCAAGTCGGATATATGT  100

seq1  CATAGTCATGGTGACCATTGAAACATTGGGTCCAAATAAACATGACTAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAGTCATGGTGACCATTGAAACATTGGGTCCAAATAAACATGACTAAG  150

seq1  AATTCTACCTTTTAAAAATGGAGTTTTACATGTAAAATCAAATGGTACTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCTACCTTTTAAAAATGGAGTTTTACATGTAAAATCAAATGGTACTA  200

seq1  TAAACCAAATTCTCCCATTTGTGGGATCCACGAGGATTTGAGAACATGTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCAAATTCTCCCATTTGTGGGATCCACGAGGATTTGAGAACATGTG  250

seq1  AAGACACCAACTTTTCCATCATCTTCAAAGCAAGCCCCACATCCAGGGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACACCAACTTTTCCATCATCTTCAAAGCAAGCCCCACATCCAGGGAG  300

seq1  AAACCTTGGTCCCAGGTTAACTGTATAGACTCCTCCGGGGCTTCCCCAGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCTTGGTCCCAGGTTAACTGTATAGACTCCTCCGGGGCTTCCCCAGC  350

seq1  TTCGAAACTGAAAGTCCATTATCTCAGGGATGTGCTTCGTCCCTGGCTAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGAAACTGAAAGTCCATTATCTCAGGGATGTGCTTCGTCCCTGGCTAC  400

seq1  CTGGGATAGTTCATAACCCTGGTGCAAACTGAGTTTTTCATATATAAAGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGATAGTTCATAACCCTGGTGCAAACTGAGTTTTTCATATATAAAGT  450

seq1  TATGTACCAAGCTGACTGCGAAACAACATTTCTTACATTCTTTGACCTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTACCAAGCTGACTGCGAAACAACATTTCTTACATTCTTTGACCTCA  500

seq1  AAATATTGTTTTGAAAGTAGCATTCTCAGAGTCTTCCGCCCATACAGGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATTGTTTTGAAAGTAGCATTCTCAGAGTCTTCCGCCCATACAGGAA  550

seq1  CAGAATGGTTTTGGTCCATCTGGTCTGAGGCCATGACCTCTGAGCTGGGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATGGTTTTGGTCCATCTGGTCTGAGGCCATGACCTCTGAGCTGGGA  600

seq1  CTCTATTCTCCAGTGAGAGTCTGGACAGTCTGGTCCTTCCTCCTGTCTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTATTCTCCAGTGAGAGTCTGGACAGTCTGGTCCTTCCTCCTGTCTCA  650

seq1  CTCTGGAGTCCTGGATCAAAGTGTGCTCAGGGAGGTGGTGGAGCCATGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGAGTCCTGGATCAAAGTGTGCTCAGGGAGGTGGTGGAGCCATGCT  700

seq1  GAGTTGTGCAAGGATGGACAGAGCTTGGAAGAGGGCTTAGGGTAGATTGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTGTGCAAGGATGGACAGAGCTTGGAAGAGGGCTTAGGGTAGATTGG  750

seq1  GAAAGCCACCAAGGCCACCTAAGGTGAATGCTGGAGGGCAGAGGCCCTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGCCACCAAGGCCACCTAAGGTGAATGCTGGAGGGCAGAGGCCCTGG  800

seq1  CTGACCGAGACTGGGTCAAGGGGAAGGTGAGCAGACAGCAAAGGGTGTTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACCGAGACTGGGTCAAGGGGAAGGTGAGCAGACAGCAAAGGGTGTTA  850

seq1  GG-TCTGAGACAGTGGGTATCTGGGAAGCCAGAGGGGACCTGCTCCCATG  899
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCTGAGACAGTGGGTATCTGGGAAGCCAGAGGGGACCTGCTCCCATG  900

seq1  GGGCTGTGACACCTTCCCTCAGTAGGGCTTCAAGGCCATCACTGTGGGGG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTGTGACACCTTCCCTCAGTAGGGCTTCAAGGCCATCACTGTGGGGG  950

seq1  ACAGTGTGTGCTGTGGGGGTCTTCCCAAAGGGAAAAGGCTTGAGAGGACC  999
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  ACAGTGTGTGCTGTGGGGGTCTTCCCAAAGGGAAATGGCTTGAGAGGACC  1000

seq1  AGTCATTGTCTTACACGTGGCATCA-GGAGGCACGACCCTTAGGCTTCTT  1048
      ||||||||||||||||||||||||| | |||||||| ||||| |  ||||
seq2  AGTCATTGTCTTACACGTGGCATCATGAAGGCACGAACCTTAAGGCTCTT  1050

seq1  ACTGCTTAAGTCACTAAATGGTCCCCAGACTACA--TGCAGGGCA-GCCA  1095
      ||||||||||||||| |||||  |||||||||||  ||||||||| || |
seq2  ACTGCTTAAGTCACT-AATGGGTCCCAGACTACATTTGCAGGGCAGGCTA  1099

seq1  CTATGCAT--GGTGCTACAATG-CTAAAGA---TAGGTATTTTGATATTG  1139
      |||||| |  ||  || | ||| || ||||   ||| ||||||| |||||
seq2  CTATGCCTTGGGGTCTTCCATGTCTTAAGAGATTAGCTATTTTGGTATTG  1149

seq1  TATTTCAAAACTACTCAAAAA--ATATATTG-GCAGT-GATAA  1178
          || || |||||||||||  |||||||| ||||| |||||
seq2  GTACTC-AACCTACTCAAAAACTATATATTGTGCAGTGGATAA  1191

seq1: chr13_59091725_59092831
seq2: B6Ng01-221O21.g_66_1173 (reverse)

seq1  TGCAGGAACCAAAGGAGGCTAAATCCAAGGCTGA-TGGAGGAGAAGAGTT  49
      |||||||||| || |||||| ||||| ||||||| ||||||||||||| |
seq2  TGCAGGAACCCAAAGAGGCTTAATCC-AGGCTGATTGGAGGAGAAGAG-T  48

seq1  CTATGGTTA-TCTGCAAATTCTGG-CCAGACAGCATCTGGAAGTCACTCC  97
      ||||||||| |||   |||||||| ||||||||||||||||||||||| |
seq2  CTATGGTTATTCTTGCAATTCTGGCCCAGACAGCATCTGGAAGTCACT-C  97

seq1  TTAGCTTCCATAACTAGCCAAGCAAG-AAGTTGCC-TTCCCAGGACAAAA  145
      ||||||||||| |||||||||||||| |||||||| |||||||||| |||
seq2  TTAGCTTCCAT-ACTAGCCAAGCAAGAAAGTTGCCTTTCCCAGGAC-AAA  145

seq1  CAGAGTGCTCTAATGACTAAGCCC-TCAAAGTGCTGTGTCATTTAAACTA  194
      ||||||||||| |||||||||||| |||||||||||||||||||||||||
seq2  CAGAGTGCTCT-ATGACTAAGCCCTTCAAAGTGCTGTGTCATTTAAACTA  194

seq1  TAGACCATC-TCCTCGATCAATCAGGATGGCAAGATGGAGCTGAGGAGCT  243
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  TAGACCATCTTCCTCGATCAATCAGGATGGCAAGATGGAGCTGAGGAGCT  244

seq1  CAGTAACATCAAGTCTGGAGTTGGTCTTTATTCAACTAGCCTGTGTAGAT  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAACATCAAGTCTGGAGTTGGTCTTTATTCAACTAGCCTGTGTAGAT  294

seq1  GTGTCTGAAAATCACAGTGTCTGACAGCATGGGGTGGTTGACCAGTAGGA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTGAAAATCACAGTGTCTGACAGCATGGGGTGGTTGACCAGTAGGA  344

seq1  CTTACAGACTTGGCTCGAGGGTAGCTGTGCTATCTTCTCCTTGCCTTGCC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTACAGACTTGGCTCGAGGGTAGCTGTGCTATCTTCTCCTTGCCTTGCC  394

seq1  TATTGAGAGGGATTTTGACAGGGTGTGATGGGAGCACACCTTCTGAGCTG  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGAGAGGGATTTTGACAGGGTGTGATGGGAGCACACCTTCTGAGCTG  444

seq1  AAAAACAGAAACCAAGCCTATTAACCAGCAAAACTCCCAAACTGTGTCTT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACAGAAACCAAGCCTATTAACCAGCAAAACTCCCAAACTGTGTCTT  494

seq1  GAGTTGGTGGGTGGGGTTGTGTTTTATCCGTAGACTTATTGTTGTTCCCA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTGGTGGGTGGGGTTGTGTTTTATCCGTAGACTTATTGTTGTTCCCA  544

seq1  AAATCGTGTTTCCTTCCACAACAGCCTTGTAATTATTCTAGGGTCCTAAA  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATCGTGTTTCCTTCCACAACAGCCTTGTAATTATTCTAGGGTCCTAAA  594

seq1  TCCTGTGCCTAAATTTAAGTGGGGTTGTCTCTAAGACACACCCTCATATC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGTGCCTAAATTTAAGTGGGGTTGTCTCTAAGACACACCCTCATATC  644

seq1  TTTGTCTTAAAGAGCATGTCCTCTGCACACACCTATGGCTAACTACTCTT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTCTTAAAGAGCATGTCCTCTGCACACACCTATGGCTAACTACTCTT  694

seq1  AGAGGCAAAATCATAGCAAGAATTTTAAAGTTGTTTTACGTTTACTTTGA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCAAAATCATAGCAAGAATTTTAAAGTTGTTTTACGTTTACTTTGA  744

seq1  AGGTTGACTTTATTTTCAATGAAATGGACATTTATTGCCTCTCTGCAGTA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTGACTTTATTTTCAATGAAATGGACATTTATTGCCTCTCTGCAGTA  794

seq1  TGGGTCCCATGTTTCTTCAGTTATAGCTGTGTGTTTCCCCTACTGGTCAT  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTCCCATGTTTCTTCAGTTATAGCTGTGTGTTTCCCCTACTGGTCAT  844

seq1  ATGCTTATTAAACAATTGCCTAGGTAGGCACAGGCTTGCTGGCCAGCCAT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTTATTAAACAATTGCCTAGGTAGGCACAGGCTTGCTGGCCAGCCAT  894

seq1  GGTGCAGGAAAGCTGATGTTCTGAAGAGAGGGGACATTTGAGCAGTAGTT  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGCAGGAAAGCTGATGTTCTGAAGAGAGGGGACATTTGAGCAGTAGTT  944

seq1  GAAAACGTCACAGAGTCCATGCATGCCCTATTCTTCTTAACTACAATGTC  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAACGTCACAGAGTCCATGCATGCCCTATTCTTCTTAACTACAATGTC  994

seq1  CACTCTGTCACTCTTCTCCCAACAAAGGCAAGTGAGAGCTTTTGCAAAAC  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTGTCACTCTTCTCCCAACAAAGGCAAGTGAGAGCTTTTGCAAAAC  1044

seq1  GACAGAGGTTTTCAACCCCTTTGAGGAGCTTCTTGGAGTGCACATGAGCA  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGAGGTTTTCAACCCCTTTGAGGAGCTTCTTGGAGTGCACATGAGCA  1094

seq1  AAGGTTCTGAATTC  1107
      ||||||||||||||
seq2  AAGGTTCTGAATTC  1108

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information