MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-274C06
Chromosome	13 (Build37)
Map Location	55,584,738 - 55,731,735
singlet/doublet	doublet
Overlap gene	Dbn1, Pdlim7, Dok3, Ddx41, BC021381, Tmed9, B4galt7, Caml
Upstream gene	LOC100040543, 4732471D19Rik, 4833439L19Rik, Arl10, D13Wsu177e, Higd2a, Cltb, Ubxd8, Rn4.5s-ps3, Rnf44, BC040758, Gprin1, Sncb, Eif4e1b, Tspan17, Unc5a, Hk3, Uimc1, LOC622707, Zfp346, Fgfr4, Nsd1, Rab24, Prelid1, Mxd3, Lman2, Rgs14, Slc34a1, Pfn3, F12, Gprk6, Prr7
Downstream gene	Ddx46, B230219D22Rik, 2310047H23Rik, Pcbd2, Catsper3, Pitx1, H2afy, BC027057, Neurog1, Cxcl14, LOC100040926, AU042651, Il9, Fbxl21, Lect2, Tgfbi
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040543 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	4732471D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319719 MGI:2442599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833439L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97820 MGI:1921162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56795 MGI:1930788
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D13Wsu177e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:28126 MGI:107862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67044 MGI:1914294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cltb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74325 MGI:1921575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubxd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76577 MGI:1923827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rn4.5s-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19802 MGI:97944
definition	note : 4.5s RNA, pseudogene 3 pseudo : _no_value

name	Rnf44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105239 MGI:2145310
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC040758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268663 MGI:2687323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26913 MGI:1349455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sncb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104069 MGI:1889011
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4e1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218268 MGI:2685119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tspan17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74257 MGI:1921507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107448 MGI:894682
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212032 MGI:2670962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uimc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20184 MGI:103185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 903 ESTs, 5 Proteins

name	Zfp346 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26919 MGI:1349417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgfr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14186 MGI:95525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18193 MGI:1276545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19336 MGI:105065
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prelid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66494 MGI:1913744
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mxd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17121 MGI:104987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lman2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66890 MGI:1914140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51791 MGI:1859709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc34a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20505 MGI:1345284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75477 MGI:2178800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58992 MGI:1891012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26385 MGI:1347078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Prr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432763 MGI:3487246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56320 MGI:1931838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdlim7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67399 MGI:1914649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dok3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27261 MGI:1351490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72935 MGI:1920185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212483 MGI:2385851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67511 MGI:1914761
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218271 MGI:2384987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Caml (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12328 MGI:104728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212880 MGI:1920895
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230219D22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78521 MGI:1925771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310047H23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69672 MGI:1916922
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72562 MGI:1919812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Catsper3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76856 MGI:1924106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pitx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18740 MGI:107374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2afy (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26914 MGI:1349392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC027057 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212937 MGI:2385852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neurog1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18014 MGI:107754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxcl14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57266 MGI:1888514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	AU042651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328258 MGI:2145373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16198 MGI:96563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213311 MGI:2442921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lect2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16841 MGI:1278342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfbi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21810 MGI:99959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040543 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264242 GeneID:100040543
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to synapsin I transcript_id : XM_001474889.1

name	4732471D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196777 GeneID:319719 MGI:2442599
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732471D19 gene transcript_id : NM_176987.3

name	4833439L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384711 GeneID:97820 MGI:1921162
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833439L19 gene transcript_id : NM_133797.2

name	Arl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910333 GeneID:56795 MGI:1930788
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 10 transcript_id : NM_019968.1

name	D13Wsu177e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802676 GeneID:28126 MGI:107862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 13, Wayne State University 177, expressed transcript_id : NM_178605.3

name	Higd2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382651 GeneID:67044 MGI:1914294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 2A transcript_id : NM_025933.2

name	Cltb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351309 GeneID:74325 MGI:1921575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : clathrin, light polypeptide (Lcb) transcript_id : NM_028870.2

name	Ubxd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341590 GeneID:76577 MGI:1923827
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UBX domain containing 8 transcript_id : NM_178397.2

name	Rnf44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527279 GeneID:105239 MGI:2145310
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 44 transcript_id : NM_134064.1

name	BC040758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372214 GeneID:268663 MGI:2687323
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC040758 transcript_id : NM_001033364.2

name	Gprin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803046 GeneID:26913 MGI:1349455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-regulated inducer of neurite outgrowth 1 transcript_id : NM_012014.3

name	Sncb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20589946 GeneID:104069 MGI:1889011
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synuclein, beta transcript_id : NM_033610.2

name	Eif4e1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89199236 GeneID:218268 MGI:2685119
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E family member 1B transcript_id : NM_001033269.2

name	Eif4e1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89199241 GeneID:218268 MGI:2685119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E family member 1B transcript_id : NM_001039683.1

name	Tspan17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386321 GeneID:74257 MGI:1921507
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 17 transcript_id : NM_028841.2

name	Unc5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803458 GeneID:107448 MGI:894682
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-5 homolog A (C. elegans) transcript_id : NM_153131.2

name	Hk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356834 GeneID:212032 MGI:2670962
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hexokinase 3 transcript_id : NM_001033245.2

name	Uimc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363034 GeneID:20184 MGI:103185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin interaction motif containing 1 transcript_id : NM_011307.2

name	LOC622707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264246 GeneID:622707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 902 ESTs, 5 Proteins product : similar to ribosomal protein, transcript variant 1 transcript_id : XM_001475711.1

name	LOC622707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264248 GeneID:622707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 1 Protein product : similar to ribosomal protein, transcript variant 2 transcript_id : XM_001475730.1

name	Zfp346 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672927 GeneID:26919 MGI:1349417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 346 transcript_id : NM_012017.2

name	Fgfr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293259 GeneID:14186 MGI:95525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 4 transcript_id : NM_008011.2

name	Nsd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118918399 GeneID:18193 MGI:1276545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor-binding SET-domain protein 1 transcript_id : NM_008739.3

name	Rab24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560646 GeneID:19336 MGI:105065
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB24, member RAS oncogene family transcript_id : NM_009000.2

name	Prelid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50582543 GeneID:66494 MGI:1913744
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PRELI domain containing 1 transcript_id : NM_025596.5

name	Mxd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372266 GeneID:17121 MGI:104987
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Max dimerization protein 3 transcript_id : NM_016662.4

name	Lman2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892179 GeneID:66890 MGI:1914140
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, mannose-binding 2 transcript_id : NM_025828.3

name	Rgs14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980625 GeneID:51791 MGI:1859709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signaling 14 transcript_id : NM_016758.2

name	Slc34a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119120880 GeneID:20505 MGI:1345284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 34 (sodium phosphate), member 1 transcript_id : NM_011392.2

name	Pfn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:106506691 GeneID:75477 MGI:2178800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : profilin 3 transcript_id : NM_029303.2

name	F12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946899 GeneID:58992 MGI:1891012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor XII (Hageman factor) transcript_id : NM_021489.1

name	Gprk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84000016 GeneID:26385 MGI:1347078
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase 6 transcript_id : NM_011938.2

name	Gprk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387107 GeneID:26385 MGI:1347078
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase 6 transcript_id : NM_001038018.2

name	Prr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366660 GeneID:432763 MGI:3487246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich 7 (synaptic) transcript_id : NM_001030296.3

name	Dbn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130629 GeneID:56320 MGI:1931838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : drebrin 1 transcript_id : NM_019813.3

name	Pdlim7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475997 GeneID:67399 MGI:1914649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ and LIM domain 7 transcript_id : NM_026131.2

name	Dok3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130854 GeneID:27261 MGI:1351490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : docking protein 3 transcript_id : NM_013739.2

name	Ddx41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21536245 GeneID:72935 MGI:1920185
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 transcript_id : NM_134059.1

name	BC021381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626028 GeneID:212483 MGI:2385851
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021381 transcript_id : NM_145382.3

name	Tmed9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802106 GeneID:67511 MGI:1914761
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 protein transport domain containing 9 transcript_id : NM_026211.2

name	B4galt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122526 GeneID:218271 MGI:2384987
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : xylosylprotein beta1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) transcript_id : NM_146045.1

name	Caml (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126154 GeneID:12328 MGI:104728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium modulating ligand transcript_id : NM_007596.2

name	Ddx46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78126141 GeneID:212880 MGI:1920895
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 transcript_id : NM_145975.2

name	B230219D22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341429 GeneID:78521 MGI:1925771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230219D22 gene transcript_id : NM_181278.2

name	2310047H23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52693934 GeneID:69672 MGI:1916922
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310047H23 gene transcript_id : NM_175150.3

name	Pcbd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421793 GeneID:72562 MGI:1919812
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 2 transcript_id : NM_028281.1

name	Catsper3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802013 GeneID:76856 MGI:1924106
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cation channel, sperm associated 3 transcript_id : NM_029772.2

name	Pitx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130224 GeneID:18740 MGI:107374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-like homeodomain transcription factor 1 transcript_id : NM_011097.2

name	H2afy (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41152516 GeneID:26914 MGI:1349392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2A histone family, member Y transcript_id : NM_012015.1

name	BC027057 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381297 GeneID:212937 MGI:2385852
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC027057 transcript_id : NM_145976.3

name	Neurog1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271508 GeneID:18014 MGI:107754
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurogenin 1 transcript_id : NM_010896.2

name	Cxcl14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392097 GeneID:57266 MGI:1888514
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) ligand 14 transcript_id : NM_019568.2

name	LOC100040926 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264244 GeneID:100040926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040926 transcript_id : XM_001475501.1

name	AU042651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384287 GeneID:328258 MGI:2145373
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU042651 transcript_id : NM_177809.3

name	Il9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680436 GeneID:16198 MGI:96563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 9 transcript_id : NM_008373.1

name	Fbxl21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803463 GeneID:213311 MGI:2442921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 21 transcript_id : NM_178674.4

name	Lect2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754529 GeneID:16841 MGI:1278342
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte cell-derived chemotaxin 2 transcript_id : NM_010702.1

name	Tgfbi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803530 GeneID:21810 MGI:99959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta induced transcript_id : NM_009369.2

name	LOC100040543 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264243 GeneID:100040543
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474939.1

name	4732471D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88196778 CCDS:CCDS26528.1 GeneID:319719 MGI:2442599
definition	codon_start : 1 product : hypothetical protein LOC319719 protein_id : NP_795961.2

name	4833439L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527012 CCDS:CCDS26529.1 GeneID:97820 MGI:1921162
definition	codon_start : 1 product : hypothetical protein LOC97820 protein_id : NP_598558.1

name	Arl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910334 CCDS:CCDS26530.1 GeneID:56795 MGI:1930788
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ADP-ribosylation factor-like membrane-associated product : ADP-ribosylation factor-like 10A protein_id : NP_064352.1

name	D13Wsu177e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519925 CCDS:CCDS26531.1 GeneID:28126 MGI:107862
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC28126 protein_id : NP_848720.1

name	Higd2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385426 CCDS:CCDS26532.1 GeneID:67044 MGI:1914294
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : HIG1 domain family, member 2A protein_id : NP_080209.1

name	Cltb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794164 CCDS:CCDS26533.1 GeneID:74325 MGI:1921575
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 product : clathrin, light polypeptide (Lcb) protein_id : NP_083146.1

name	Ubxd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409970 GeneID:76577 MGI:1923827
definition	codon_start : 1 exception : unclassified translation discrepancy product : protein expressed in T-cells and eosinophils in atopic dermatitis protein_id : NP_848484.1

name	Rnf44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527280 GeneID:105239 MGI:2145310
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 44 protein_id : NP_598825.1

name	BC040758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85662397 GeneID:268663 MGI:2687323
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protocadherin LKC protein_id : NP_001028536.1

name	Gprin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000009 CCDS:CCDS26534.1 GeneID:26913 MGI:1349455
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0031175 - neurite development [Evidence IDA] codon_start : 1 product : G protein-regulated inducer of neurite outgrowth 1 protein_id : NP_036144.2

name	Sncb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15809030 GeneID:104069 MGI:1889011
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_process : GO:0042417 - dopamine metabolism [Evidence IGI] codon_start : 1 product : synuclein, beta protein_id : NP_291088.1

name	Eif4e1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701778 GeneID:218268 MGI:2685119
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; oocyte-specific eukaryotic translation initiation factor 4E-like product : oocyte-specific eukaryotic translation initiation factor 4E-like isoform 1 protein_id : NP_001028441.1

name	Eif4e1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89199242 GeneID:218268 MGI:2685119
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; oocyte-specific eukaryotic translation initiation factor 4E-like product : oocyte-specific eukaryotic translation initiation factor 4E-like isoform 2 protein_id : NP_001034772.1

name	Tspan17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312678 CCDS:CCDS26536.1 GeneID:74257 MGI:1921507
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : F-box only protein 23; transmembrane 4 superfamily member 17 product : tetraspanin 17 protein_id : NP_083117.1

name	Unc5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346571 CCDS:CCDS26537.1 GeneID:107448 MGI:894682
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : unc5 homolog (C. elegans) 1 product : netrin receptor Unc5h1 protein_id : NP_694771.1

name	Hk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370288 CCDS:CCDS26538.1 GeneID:212032 MGI:2670962
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004396 - hexokinase activity [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006096 - glycolysis [Evidence IEA] codon_start : 1 product : hexokinase 3 protein_id : NP_001028417.1

name	Uimc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45597445 GeneID:20184 MGI:103185
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : retinoid X receptor interacting protein 110 protein_id : NP_035437.1

name	LOC622707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264247 GeneID:622707
definition	codon_start : 1 product : similar to ribosomal protein isoform 1 protein_id : XP_001475761.1

name	LOC622707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264249 GeneID:622707
definition	codon_start : 1 product : similar to ribosomal protein isoform 2 protein_id : XP_001475780.1

name	Zfp346 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754396 CCDS:CCDS26539.1 GeneID:26919 MGI:1349417
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IMP] codon_start : 1 note : just another zinc finger protein product : zinc finger protein 346 protein_id : NP_036147.1

name	Fgfr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293260 CCDS:CCDS26540.1 GeneID:14186 MGI:95525
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001759 - induction of an organ [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : fibroblast growth factor receptor 4 16 minus form product : fibroblast growth factor receptor 4 protein_id : NP_032037.2

name	Nsd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118918400 GeneID:18193 MGI:1276545
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence IC]; GO:0005634 - nucleus [Evidence IC] GO_function : GO:0050681 - androgen receptor binding [Evidence ISS]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0030331 - estrogen receptor binding [Evidence IPI]; GO:0046975 - histone lysine N-methyltransferase activity (H3-K36 specific) [Evidence IDA]; GO:0042799 - histone lysine N-methyltransferase activity (H4-K20 specific) [Evidence IDA]; GO:0042054 - histone methyltransferase activity [Evidence IDA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IEA]; GO:0016922 - ligand-dependent nuclear receptor binding [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0046965 - retinoid X receptor binding [Evidence IPI]; GO:0046966 - thyroid hormone receptor binding [Evidence IPI]; GO:0003712 - transcription cofactor activity [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0016571 - histone methylation [Evidence IDA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : nuclear receptor-binding SET-domain protein 1 protein_id : NP_032765.3

name	Rab24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679591 CCDS:CCDS26541.1 GeneID:19336 MGI:105065
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006914 - autophagy [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB24, member RAS oncogene family protein_id : NP_033026.1

name	Prelid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518501 CCDS:CCDS26542.1 GeneID:66494 MGI:1913744
definition	codon_start : 1 note : protein of relevant evolutionary and lymphoid interest product : PX19 homolog protein_id : NP_079872.4

name	Mxd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254561 CCDS:CCDS26543.1 GeneID:17121 MGI:104987
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 product : Max dimerization protein 3 protein_id : NP_057871.2

name	Lman2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328278 CCDS:CCDS26544.1 GeneID:66890 MGI:1914140
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : lectin, mannose-binding 2 protein_id : NP_080104.2

name	Rgs14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980626 GeneID:51791 MGI:1859709
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005096 - GTPase activator activity [Evidence TAS]; GO:0005057 - receptor signaling protein activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007067 - mitosis [Evidence IMP]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : rap1/rap2 interacting protein product : regulator of G-protein signaling 14 protein_id : NP_058038.2

name	Slc34a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119120881 GeneID:20505 MGI:1345284
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015321 - sodium-dependent phosphate transporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 17 (sodium/hydrogen exchanger), member 2; renal Na+/Pi transporter; Na/Pi cotransporter; type IIa Na+/Pi-cotransporter product : solute carrier family 34 (sodium phosphate), member 1 protein_id : NP_035522.2

name	Pfn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312794 CCDS:CCDS26545.1 GeneID:75477 MGI:2178800
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence TAS]; GO:0005471 - ATP:ADP antiporter activity [Evidence TAS] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : profilin 3 protein_id : NP_083579.1

name	F12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946900 GeneID:58992 MGI:1891012
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : blood coagulation, fibrinolysis note : factor XII product : coagulation factor XII (Hageman factor) protein_id : NP_067464.1

name	Gprk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000007 GeneID:26385 MGI:1347078
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : G protein-coupled receptor kinase 6 isoform a protein_id : NP_001033107.1

name	Gprk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000017 GeneID:26385 MGI:1347078
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : G protein-coupled receptor kinase 6 isoform b protein_id : NP_036068.2

name	Prr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71892426 CCDS:CCDS26546.1 GeneID:432763 MGI:3487246
definition	codon_start : 1 product : proline rich 7 (synaptic) protein_id : NP_001025467.1

name	Dbn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328251 GeneID:56320 MGI:1931838
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005522 - profilin binding [Evidence ISS] GO_process : GO:0007015 - actin filament organization [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 note : drebrin E2; drebrin A product : drebrin 1 protein_id : NP_062787.2

name	Pdlim7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475998 CCDS:CCDS26547.1 GeneID:67399 MGI:1914649
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0001726 - ruffle [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IPI]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 exception : mismatches in translation product : PDZ and LIM domain 7 protein_id : NP_080407.2

name	Dok3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305003 CCDS:CCDS26548.1 GeneID:27261 MGI:1351490
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007265 - Ras protein signal transduction [Evidence IDA] codon_start : 1 note : p62Dok-like protein product : Dok-like protein protein_id : NP_038767.1

name	Ddx41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21536246 CCDS:CCDS26549.1 GeneID:72935 MGI:1920185
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : DEAD-box protein abstrakt product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 protein_id : NP_598820.1

name	BC021381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626029 GeneID:212483 MGI:2385851
definition	codon_start : 1 product : hypothetical protein LOC212483 protein_id : NP_663357.2

name	Tmed9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385718 GeneID:67511 MGI:1914761
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : transmembrane emp24 protein transport domain containing 9 protein_id : NP_080487.1

name	B4galt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122527 CCDS:CCDS26550.1 GeneID:218271 MGI:2384987
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence ISS]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0046525 - xylosylprotein 4-beta-galactosyltransferase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0043206 - fibril organization and biogenesis [Evidence ISS]; GO:0006024 - glycosaminoglycan biosynthesis [Evidence ISS]; GO:0048147 - negative regulation of fibroblast proliferation [Evidence ISS]; GO:0006029 - proteoglycan metabolism [Evidence ISS] codon_start : 1 note : xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 (galactosyltransferase I) product : xylosylprotein beta 1,4-galactosyltransferase, polypeptide 7 protein_id : NP_666157.1

name	Caml (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126155 CCDS:CCDS26551.1 GeneID:12328 MGI:104728
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007173 - epidermal growth factor receptor signaling pathway [Evidence IDA]; GO:0001881 - receptor recycling [Evidence IMP] codon_start : 1 product : calcium modulating ligand protein_id : NP_031622.2

name	Ddx46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78126142 GeneID:212880 MGI:1920895
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : DEAD box polypeptide 46 protein_id : NP_666087.2

name	B230219D22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044487 CCDS:CCDS26552.1 GeneID:78521 MGI:1925771
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 product : hypothetical protein LOC78521 protein_id : NP_851795.1

name	2310047H23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693935 CCDS:CCDS26553.1 GeneID:69672 MGI:1916922
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : disulfide isomerase protein_id : NP_780359.2

name	Pcbd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421794 CCDS:CCDS26554.1 GeneID:72562 MGI:1919812
definition	GO_component : GO:0005634 - nucleus [Evidence IPI] GO_function : GO:0008124 - 4-alpha-hydroxytetrahydrobiopterin dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004505 - phenylalanine 4-monooxygenase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051291 - protein heterooligomerization [Evidence IPI]; GO:0051289 - protein homotetramerization [Evidence IPI]; GO:0006729 - tetrahydrobiopterin biosynthesis [Evidence IEA] codon_start : 1 note : dimerization cofactor of hepatocyte nuclear factor 1 (HNF1) from muscle product : pterin-4 alpha-carbinolamine dehydratase 2 protein_id : NP_082557.1

name	Catsper3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30350218 CCDS:CCDS26555.1 GeneID:76856 MGI:1924106
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 product : cation channel, sperm associated 3 protein_id : NP_084048.1

name	Pitx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755070 CCDS:CCDS26556.1 GeneID:18740 MGI:107374
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : paired-like homeodomain transcription factor 1 protein_id : NP_035227.1

name	H2afy (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41152517 CCDS:CCDS26557.1 GeneID:26914 MGI:1349392
definition	GO_component : GO:0001740 - Barr body [Evidence ISS]; GO:0005813 - centrosome [Evidence TAS]; GO:0000793 - condensed chromosome [Evidence IDA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007549 - dosage compensation [Evidence ISS]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : MACROH2A1.2 product : H2A histone family, member Y protein_id : NP_036145.1

name	BC027057 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122419 CCDS:CCDS26558.1 GeneID:212937 MGI:2385852
definition	codon_start : 1 product : hypothetical protein LOC212937 protein_id : NP_666088.1

name	Neurog1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754826 CCDS:CCDS26559.1 GeneID:18014 MGI:107754
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0045165 - cell fate commitment [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007399 - nervous system development [Evidence IEA]; GO:0030182 - neuron differentiation [Evidence IMP]; GO:0031536 - positive regulation of exit from mitosis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : neurogenic differentiation 3 product : neurogenin 1 protein_id : NP_035026.1

name	Cxcl14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392098 GeneID:57266 MGI:1888514
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA] codon_start : 1 note : musculus CXC chemokine MIP-2gamma; small inducible cytokine subfamily B (Cys-X-Cys), member 14 product : kidney-expressed chemokine CXC protein_id : NP_062514.2

name	LOC100040926 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264245 GeneID:100040926
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475551.1

name	AU042651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244360 CCDS:CCDS26561.1 GeneID:328258 MGI:2145373
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC328258 protein_id : NP_808477.1

name	Il9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680437 CCDS:CCDS26562.1 GeneID:16198 MGI:96563
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005126 - hematopoietin/interferon-class (D200-domain) cytokine receptor binding [Evidence IEA]; GO:0005140 - interleukin-9 receptor binding [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0045407 - positive regulation of interleukin-5 biosynthesis [Evidence IMP] codon_start : 1 product : interleukin 9 protein_id : NP_032399.1

name	Fbxl21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776547 CCDS:CCDS26563.1 GeneID:213311 MGI:2442921
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 21 protein_id : NP_848789.2

name	Lect2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754530 CCDS:CCDS26564.1 GeneID:16841 MGI:1278342
definition	GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chondromodulin-II product : leukocyte cell-derived chemotaxin 2 protein_id : NP_034832.1

name	Tgfbi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678321 GeneID:21810 MGI:99959
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 function : cell adhesion inhibitor note : transforming growth factor, beta induced, 68 kDa product : transforming growth factor, beta induced protein_id : NP_033395.1

name	(CDS detail)
type	misc_feature
link
xref
definition	citation : [PUBMED 1373121] label : clone19 note : Terminal EcoRI-PstI fragment from 8 kb EcoRI genomic clone pseudo : _no_value

clone name	MSMg01-355A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-098C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-266L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-332I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-352E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-097G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-326I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222P07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-274C06.b	B6Ng01-274C06.g
ACC	GA075523	GA075524
length	1,120	1,073
definition	B6Ng01-274C06.b	B6Ng01-274C06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(55,730,625 - 55,731,735)	(55,584,738 - 55,585,796)
sequence	gaattcaaaggtgatctctaaaatttatttatttagtatcactaaatagc tactggtaactcagcaactttaaatatataaaaagctatatagttaacca agagcaatgaaagcttatgtccacataaagactcatactaggatattctt gccggatgcgggtggcatattcctttaataacagcacttgggaggcaaag gcaggggaatttctaggttctaggctagcctggtctgtagagtaagttct aggacaactaggactacacaaagaaactgtatcaaaacaaccaaataaac aagattccctatcaacagggttcctggctaacatggaactccttctgtag accaggctggcctcaaactcaaagatccacctgcttgtggctctcaactg ttaggattaaaacatggaccaccaccacctggcaaataaataaacttaaa aaaagagaagagggctggagagatggctcagtggttaagagcactgactg ctcttccagaggtcctgagttcaattcccagcaaccacatggtggctcac aaccatctgtaatgggatctgatgccctcttctggtgtgtctgaaaacag ctacggtgtactcatatatatgaaataaatctttaaaaaaaaaaaagaga gaaggaagatctactgcagttgtggatggtagagtgagagctgaagaaac catatgtagatgtttcttcaagaaaaacaagagacttggactatgaaagc tcactttgggttagatattcctcacttggggcttcgaggggagaaaatac aggttcacaggctgatgaggttaataggttttgatttcttttgttttgtt tttttttccttttttgtgtgtgtgctgaggggttggacacagcaccatgc tctgtgtcctctccttctgagtacatgttcagccctgggcacaagcaact gtcatcgtgccaggagaggacatcaggctctctgggagctaggatttata ggtactttgtagcccgccagtgtgcctactgggactgaatcaggttcctc tacagagcagtaaggctcaataaaccactgggctatcttctgtaccccgg gcttggaccagccatgttac	gaattcttacctcctgacgctgcaagcttgaggtcatctgagccatcctc gtatgtgtacagagccctgaggagagggaggatggctcagaactgtcagg gcctaggcagccaattttgggtggggaaggcactagggagggagagtgaa accagaggggacaggcagggcagaacaggacgaggagggggaaagctgtg gttgtcggttggtcatgacaataaagctaggcatggcatcgttccgctga gccgggagtcctgggtcagatggcaatcagggaacggtgggggagaaatc gctgcctagtcagctcagcgtccggccctagccctggcagcccacaactc agtggagcgggtgtgcgatggagactccaaggcaacggttccttggttac cgttccctggcgaccatgattctcatccctcattggccagagccaggaat ctacctggtgcgtgccttggtacccgctgcccctcccccttttgggaggg agaagaatctggtgctcaatgctgggcatcccctggtaaccatggcaacc cagcaattggcacagaaatcagcccaccagagctgcattctcctcgaaca caaaggaccctggggacatcctcagactcaatctctccctctctgagatg gggatgaggttgctgtgaccactccccgactctgaccctaagatctggtc ttctagccctgaggcagcctctgccctccctgaagcctcctaggactacc atatagactgaagccgaccagaaagctaaactaatgacttccttcctccc tagccttttctgctctgtatttattcttggcaggcatactaaacgcatcc attttcatggaaggtaatgtagttatttcttccctttgagccacccctca acccatcctgatgcaggccaccacgctgggacacacatgaagaagaagac ttctttggtccctgagattcagaagggctcagaacccttgcttcattctc ccatttcccatctaagtcaggagcttgggggtggtgcgagacagatgaaa agcagagatggaggaaatggggg
quality values	Open. Hide. 58 31 34 38 62 31 21 47 62 62 47 47 62 31 31 62 62 62 49 62 62 62 62 54 62 62 62 59 62 59 45 44 34 24 20 28 50 48 59 59 49 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 54 49 49 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 54 49 47 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 47 52 54 42 62 58 58 58 58 58 58 40 58 58 54 52 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 52 54 54 58 58 58 48 58 58 58 58 58 54 58 54 58 58 58 54 47 58 58 58 58 54 58 54 58 58 58 58 58 58 54 58 58 58 54 54 51 58 58 58 58 58 58 58 58 58 48 50 54 58 58 52 58 41 58 51 58 51 51 47 58 58 53 58 54 54 53 53 58 58 58 58 58 58 53 52 58 50 51 53 58 58 58 53 58 58 58 58 58 58 49 58 58 58 58 46 58 46 58 41 58 44 29 51 58 49 39 49 29 52 54 46 58 58 58 53 54 49 58 58 51 52 58 44 49 39 58 58 32 58 50 58 39 58 54 54 34 44 26 58 58 50 58 46 26 58 58 50 40 41 32 49 41 53 53 52 50 39 41 39 51 45 54 42 42 53 52 45 28 41 41 54 54 54 54 50 38 39 49 36 51 25 38 27 51 49 40 27 33 26 53 45 42 42 54 46 52 32 50 47 40 34 31 54 49 41 40 54 36 36 46 37 35 53 33 31 53 45 37 54 42 43 40 45 53 39 38 54 54 51 32 52 38 40 20 34 21 49 49 34 53 34 53 52 53 33 31 31 34 32 26 35 31 45 32 30 32 31 47 52 31 37 42 31 30 35 46 24 33 27 19 31 33 34 35 17 51 30 46 46 41 30 45 25 46 32 51 42 51 46 40 51 32 46 51 29 20 21 46 46 46 51 46 46 46 31 31 48 33 48 46 46 48 42 38 24 41 21 46 28 46 30 31 29 31 42 31 11 46 46 25 14 14 18 36 27 18 28 30 26 29 36 35 26 39 18 31 41 27 31 30 31 28 11 18 16 25 32 31 31 29 21 31 29 26 23 31 31 41 19 38 26 21 18 25 31 31 12 31 27 20 25 41 24 10 19 47 16 14 7 9 4 16 21 29 22 22 21 33 24 8 18 22 35 33 22 31 38 31 31 20 29 31 22 9 38 18 24 24 18 18 23 24 12 19 17 15 34 32 32 32 32 21 36 11 32 8 28 29 31 28 32 14 6 39 9 4 4 6 25 11 27 31 31 13 39 7 12 12 13 12 17 40 6 5 5 20 20 13 6 14 17 26 10 15 9 17 17 24 28 40 21 14 17 28 16 15 15 7 8 13 19 17 12 10 32 13 27 13 8 10 18 29 9 24 7 14 18 11 14 18 13 6 11 6 10 11 15 10 14 19 47 23 10 5 6 11 4 6 22 13 2 8 16 21 14 7 4 5 5 9 13 16 11 25 23 25 9 22 12 2 4 7 17 12 6 6 4 6 8 11 5 24 5 13 5 6 6 5	Open. Hide. 62 35 56 47 62 62 62 54 56 62 56 56 49 56 56 38 25 29 45 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 59 62 59 59 62 62 62 62 62 54 33 56 62 62 62 62 62 56 62 46 56 62 62 62 62 62 59 59 59 59 62 59 59 54 62 62 62 59 59 62 59 59 62 62 62 62 62 62 46 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 47 49 62 62 62 62 62 46 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 33 46 62 62 62 62 58 52 58 54 41 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 54 58 58 54 54 58 58 58 58 54 58 58 54 58 54 54 52 54 58 58 54 58 58 58 54 54 54 51 58 58 58 34 42 58 54 41 54 58 52 52 45 54 47 54 58 42 58 58 58 54 50 58 58 58 52 58 58 51 58 50 58 58 50 50 51 50 58 51 48 58 45 38 58 51 58 51 58 58 58 42 48 35 51 51 58 53 58 52 37 54 46 58 53 54 48 51 53 51 49 58 53 58 58 51 53 51 53 53 52 49 32 47 49 54 58 58 58 48 32 58 58 36 41 32 52 49 50 54 54 50 51 32 39 49 26 54 54 51 49 49 58 43 35 39 53 38 50 50 49 29 58 58 50 50 53 50 35 29 52 53 58 58 41 53 42 53 53 50 53 53 52 58 54 40 49 37 19 54 30 40 34 53 51 49 53 39 52 41 54 44 40 51 54 54 42 52 53 53 31 51 39 40 39 53 45 35 8 51 38 29 52 31 35 46 33 53 45 53 53 32 33 37 38 47 54 24 24 49 51 32 37 19 35 33 34 49 54 30 35 52 40 18 54 46 52 42 49 33 31 45 40 34 39 41 32 31 20 31 42 34 33 18 51 36 14 27 31 36 39 33 51 49 27 35 31 45 32 32 45 32 41 29 34 26 49 33 29 23 47 35 31 30 36 33 30 26 9 25 16 20 20 25 32 25 11 51 12 21 22 26 26 31 30 33 15 30 45 40 23 24 21 29 46 13 27 14 8 46 10 33 28 16 32 25 38 22 15 42 27 29 46 11 27 31 41 35 48 37 9 46 31 31 30 21 26 28 15 26 41 37 20 25 20 13 23 31 42 33 16 29 18 21 25 30 31 33 32 36 24 25 19 7 6 8 19 16 11 17 17 27 31 11 41 17 27 20 17 26 22 31 13 36 36 30 25 15 30 46 21 27 37 19 31 11 8 11 9 6 29 31 38 29 13 20 48 24 10 19 31 8 22 12 21 32 18 15 31 12 5 41 21 14 24 31 20 9 38 25 11 44 13 33 17 21 28 13 15 10 20 18 10 7 6 8 48 33 12 19 43 25 17 39 18 6 17 18 14 21 22 19 8 9 26 25 14 17 16 10 17 22 15 39 25 39 9 8 5 13 21 10 7 5 14 6 8 7 18 8 16 7 4 11 18 6 20 8 16 11 6 8 4 4 9 25 10 12 13 15 17 27 23 6 30 29 27 28 34

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_55730625_55731735
seq2: B6Ng01-274C06.b_49_1168 (reverse)

seq1  GTAACAT-GCT-GTCC-AGCCCGGGGTTACAG-AGATAGCCCAGT-GTTT  45
      ||||||| ||| |||| ||||||||| ||||| |||||||||||| ||||
seq2  GTAACATGGCTGGTCCAAGCCCGGGG-TACAGAAGATAGCCCAGTGGTTT  49

seq1  A-TGAGCCTTTACTGCTCTTGTAGAGG-ACCTGATTCAGTCCCAGTAGGC  93
      | |||||| ||||||||| |||||||| ||||||||||||||||||||||
seq2  ATTGAGCC-TTACTGCTC-TGTAGAGGAACCTGATTCAGTCCCAGTAGGC  97

seq1  ACACTGGCGGCTTAC-AAGTACCTAT-AATCCTAGCT-CCAGAGAGCCTG  140
      ||||||||||  ||| |||||||||| |||||||||| ||||||||||||
seq2  ACACTGGCGGGCTACAAAGTACCTATAAATCCTAGCTCCCAGAGAGCCTG  147

seq1  ATGTCCTCTCCTGGCACGATGACAGTTGCTTGTGCCCAGGGCTGAACATG  190
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCTCTCCTGGCACGATGACAGTTGCTTGTGCCCAGGGCTGAACATG  197

seq1  TACTCAGAAGGAGAGGACACAGAGCATGGTGCTGTGTCCAA-CCCTCAGC  239
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TACTCAGAAGGAGAGGACACAGAGCATGGTGCTGTGTCCAACCCCTCAGC  247

seq1  ACACACACAAAAAAGG-AAAAAAAACAAAACAAAAGAAATCAAAACCTAT  288
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  ACACACACAAAAAAGGAAAAAAAAACAAAACAAAAGAAATCAAAACCTAT  297

seq1  TAACCTCATCAGCCTGTGAACCTGTATTTTCTCCCCTCGAAGCCCCAAGT  338
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCTCATCAGCCTGTGAACCTGTATTTTCTCCCCTCGAAGCCCCAAGT  347

seq1  GAGGAATATCTAACCCAAAGTGAGCTTTCATAGTCCAAGTCTCTTGTTTT  388
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAATATCTAACCCAAAGTGAGCTTTCATAGTCCAAGTCTCTTGTTTT  397

seq1  TCTTGAAGAAACATCTACATATGGTTTCTTCAGCTCTCACTCTACCATCC  438
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGAAGAAACATCTACATATGGTTTCTTCAGCTCTCACTCTACCATCC  447

seq1  ACAACTGCAGTAGATCTTCCTTCTCTCTTTTTTTTTTTTAAAGATTTATT  488
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACTGCAGTAGATCTTCCTTCTCTCTTTTTTTTTTTTAAAGATTTATT  497

seq1  TCATATATATGAGTACACCGTAGCTGTTTTCAGACACACCAGAAGAGGGC  538
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATATATATGAGTACACCGTAGCTGTTTTCAGACACACCAGAAGAGGGC  547

seq1  ATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAAT  588
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAAT  597

seq1  TGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCACTGAGCCA  638
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCACTGAGCCA  647

seq1  TCTCTCCAGCCCTCTTCTCTTTTTTTAAGTTTATTTATTTGCCAGGTGGT  688
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCCAGCCCTCTTCTCTTTTTTTAAGTTTATTTATTTGCCAGGTGGT  697

seq1  GGTGGTCCATGTTTTAATCCTAACAGTTGAGAGCCACAAGCAGGTGGATC  738
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGTCCATGTTTTAATCCTAACAGTTGAGAGCCACAAGCAGGTGGATC  747

seq1  TTTGAGTTTGAGGCCAGCCTGGTCTACAGAAGGAGTTCCATGTTAGCCAG  788
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAGTTTGAGGCCAGCCTGGTCTACAGAAGGAGTTCCATGTTAGCCAG  797

seq1  GAACCCTGTTGATAGGGAATCTTGTTTATTTGGTTGTTTTGATACAGTTT  838
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCCTGTTGATAGGGAATCTTGTTTATTTGGTTGTTTTGATACAGTTT  847

seq1  CTTTGTGTAGTCCTAGTTGTCCTAGAACTTACTCTACAGACCAGGCTAGC  888
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGTGTAGTCCTAGTTGTCCTAGAACTTACTCTACAGACCAGGCTAGC  897

seq1  CTAGAACCTAGAAATTCCCCTGCCTTTGCCTCCCAAGTGCTGTTATTAAA  938
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGAACCTAGAAATTCCCCTGCCTTTGCCTCCCAAGTGCTGTTATTAAA  947

seq1  GGAATATGCCACCCGCATCCGGCAAGAATATCCTAGTATGAGTCTTTATG  988
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATATGCCACCCGCATCCGGCAAGAATATCCTAGTATGAGTCTTTATG  997

seq1  TGGACATAAGCTTTCATTGCTCTTGGTTAACTATATAGCTTTTTATATAT  1038
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACATAAGCTTTCATTGCTCTTGGTTAACTATATAGCTTTTTATATAT  1047

seq1  TTAAAGTTGCTGAGTTACCAGTAGCTATTTAGTGATACTAAATAAATAAA  1088
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGTTGCTGAGTTACCAGTAGCTATTTAGTGATACTAAATAAATAAA  1097

seq1  TTTTAGAGATCACCTTTGAATTC  1111
      |||||||||||||||||||||||
seq2  TTTTAGAGATCACCTTTGAATTC  1120

seq1: chr13_55584738_55585796
seq2: B6Ng01-274C06.g_65_1137

seq1  GAATTCTTACCTCCTGACGCTGCAAGCTTGAGGTCATCTGAGCCATCCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTACCTCCTGACGCTGCAAGCTTGAGGTCATCTGAGCCATCCTC  50

seq1  GTATGTGTACAGAGCCCTGAGGAGAGGGAGGATGGCTCAGAACTGTCAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGTGTACAGAGCCCTGAGGAGAGGGAGGATGGCTCAGAACTGTCAGG  100

seq1  GCCTAGGCAGCCAATTTTGGGTGGGGAAGGCACTAGGGAGGGAGAGTGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTAGGCAGCCAATTTTGGGTGGGGAAGGCACTAGGGAGGGAGAGTGAA  150

seq1  ACCAGAGGGGACAGGCAGGGCAGAACAGGACGAGGAGGGGGAAAGCTGTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGAGGGGACAGGCAGGGCAGAACAGGACGAGGAGGGGGAAAGCTGTG  200

seq1  GTTGTCGGTTGGTCATGACAATAAAGCTAGGCATGGCATCGTTCCGCTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTCGGTTGGTCATGACAATAAAGCTAGGCATGGCATCGTTCCGCTGA  250

seq1  GCCGGGAGTCCTGGGTCAGATGGCAATCAGGGAACGGTGGGGGAGAAATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCGGGAGTCCTGGGTCAGATGGCAATCAGGGAACGGTGGGGGAGAAATC  300

seq1  GCTGCCTAGTCAGCTCAGCGTCCGGCCCTAGCCCTGGCAGCCCACAACTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCCTAGTCAGCTCAGCGTCCGGCCCTAGCCCTGGCAGCCCACAACTC  350

seq1  AGTGGAGCGGGTGTGCGATGGAGACTCCAAGGCAACGGTTCCTTGGTTAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGAGCGGGTGTGCGATGGAGACTCCAAGGCAACGGTTCCTTGGTTAC  400

seq1  CGTTCCCTGGCGACCATGATTCTCATCCCTCATTGGCCAGAGCCAGGAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTTCCCTGGCGACCATGATTCTCATCCCTCATTGGCCAGAGCCAGGAAT  450

seq1  CTACCTGGTGCGTGCCTTGGTACCCGCTGCCCCTCCCCCTTTTGGGAGGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACCTGGTGCGTGCCTTGGTACCCGCTGCCCCTCCCCCTTTTGGGAGGG  500

seq1  AGAAGAATCTGGTGCTCAATGCTGGGCATCCCCTGGTAACCATGGCAACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAATCTGGTGCTCAATGCTGGGCATCCCCTGGTAACCATGGCAACC  550

seq1  CAGCAATTGGCACAGAAATCAGCCCACCAGAGCTGCATTCTCCTCGAACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAATTGGCACAGAAATCAGCCCACCAGAGCTGCATTCTCCTCGAACA  600

seq1  CAAAGGACCCTGGGGACATCCTCAGACTCAATCTCTCCCTCTCTGAGATG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGACCCTGGGGACATCCTCAGACTCAATCTCTCCCTCTCTGAGATG  650

seq1  GGGATGAGGTTGCTGTGACCACTCCCCGACTCTGACCCTAAGATCTGGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATGAGGTTGCTGTGACCACTCCCCGACTCTGACCCTAAGATCTGGTC  700

seq1  TTCTAGCCCTGAGGCAGCCTCTGCCCTCCCTGAAGCCTCCTAGGACTACC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAGCCCTGAGGCAGCCTCTGCCCTCCCTGAAGCCTCCTAGGACTACC  750

seq1  ATATAGACTGAAGCCGACCAGAAAGCTAAACTAATGACTTCCTTCCTCCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAGACTGAAGCCGACCAGAAAGCTAAACTAATGACTTCCTTCCTCCC  800

seq1  TAGCCTTTTCTGCTCTGTATTTATTCTTGGCAGGCATACT-AACGCATCC  849
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  TAGCCTTTTCTGCTCTGTATTTATTCTTGGCAGGCATACTAAACGCATCC  850

seq1  A-TTTCATGGAAGGTAATGTAGTTA-TTCTTCCC-TTGAGCCACCCCTCA  896
      | ||||||||||||||||||||||| |||||||| |||||||||||||||
seq2  ATTTTCATGGAAGGTAATGTAGTTATTTCTTCCCTTTGAGCCACCCCTCA  900

seq1  ACCCATCCTGATGCAGG-CACCACGCT-GGACACACATGAAGAAG-AGAC  943
      ||||||||||||||||| ||||||||| ||||||||||||||||| ||||
seq2  ACCCATCCTGATGCAGGCCACCACGCTGGGACACACATGAAGAAGAAGAC  950

seq1  T--CTTGGTCCCTGAGATTCAGAAGGGCTCAGAA-CCTTGC-TCA-TCTC  988
      |   |||||||||||||||||||||||||||||| |||||| ||| ||||
seq2  TTCTTTGGTCCCTGAGATTCAGAAGGGCTCAGAACCCTTGCTTCATTCTC  1000

seq1  CCATTTCCCATCTAAGTCAGGAGGCTGGGG--TGTGCGAGA-AGATGAAA  1035
      |||||||||||||||||||||||  |||||   |||||||| ||||| ||
seq2  CCATTTCCCATCTAAGTCAGGAGCTTGGGGGTGGTGCGAGACAGATG-AA  1049

seq1  AAGCAGAGATGGAGGAAAGGGGGG  1059
      |||||||||||||||||| |||||
seq2  AAGCAGAGATGGAGGAAATGGGGG  1073

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information