MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-346D06
Chromosome	13 (Build37)
Map Location	68,038,511 - 68,222,330
singlet/doublet	doublet
Overlap gene	LOC666185, LOC100042687, LOC100042692, LOC674779
Upstream gene	Ptdss1, Zfp712, Zfp708, Zfp759, Rsl1, LOC674699, Zfp455, Zfp458, Zfp457, A230042K10Rik, E130120F12Rik, Zfp456, 2810487A22Rik, Zfp459, C330011K17Rik, LOC666098, 9630025I21Rik, Zfp817, Zfp87, Zfp748, A530054K11Rik, LOC328277, 3830402I07Rik, EG666137, Zfp85-rs1, LOC674597, Zfp273, BC048507
Downstream gene	LOC677603, LOC100042124, LOC666222, AA414992, LOC666238, EG666245, EG666272, LOC100042223, Mtrr, LOC100042233, Fastkd3, 1700001L19Rik, Adcy2, LOC666205
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ptdss1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19210 MGI:1276575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp712 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78251 MGI:1925501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 3 Proteins

name	Zfp708 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432769 MGI:3040674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Zfp759 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268670 MGI:2446280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rsl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:380855 MGI:3044162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674699 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674699
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Zfp455 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218311 MGI:3040708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp458 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238690 MGI:3040691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp457 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:431706 MGI:2664334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A230042K10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218314 MGI:3040707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E130120F12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629016 MGI:3612873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp456 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408065 MGI:3040694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810487A22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72807 MGI:1920057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328274 MGI:3040701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330011K17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238692 MGI:3040703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	9630025I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408067 MGI:3040702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp817 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238693 MGI:3040705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp87 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170763 MGI:107768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp748 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212276 MGI:1916455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	A530054K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212281 MGI:3036250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC328277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein

name	3830402I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408068 MGI:3040706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666137 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666137 MGI:3646533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Zfp85-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22746 MGI:107767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC674597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2029 ESTs, 2 Proteins pseudo : _no_value

name	Zfp273 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212569 MGI:3036278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408058 MGI:3040680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs

name	LOC100042687 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs

name	LOC100042692 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs

name	LOC674779 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs

name	LOC677603 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042124 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042124
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	LOC666222 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs

name	AA414992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102402 MGI:2142939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC666238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	EG666245 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666245 MGI:3648435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs

name	EG666272 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666272 MGI:3645625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs

name	LOC100042223 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042223
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Mtrr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210009 MGI:1891037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Fastkd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69577 MGI:1916827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700001L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69315 MGI:1916565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 24 ESTs, 1 Protein

name	Adcy2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210044 MGI:99676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666205 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 4 Proteins pseudo : _no_value

name	Ptdss1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560650 GeneID:19210 MGI:1276575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylserine synthase 1 transcript_id : NM_008959.2

name	Zfp712 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264285 GeneID:78251 MGI:1925501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 3 Proteins product : zinc finger protein 712, transcript variant 1 transcript_id : XM_127404.7

name	Zfp708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892737 GeneID:432769 MGI:3040674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 708 transcript_id : NM_001012449.2

name	Zfp708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892591 GeneID:432769 MGI:3040674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 708 transcript_id : NM_001012325.2

name	Zfp708 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893159 GeneID:432769 MGI:3040674
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 708 transcript_id : NM_001012448.2

name	Zfp759 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119226194 GeneID:268670 MGI:2446280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 759 transcript_id : NM_172392.3

name	Rsl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480077 GeneID:380855 MGI:3044162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of sex limited protein 1 transcript_id : NM_001013769.1

name	Zfp455 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842384 GeneID:218311 MGI:3040708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 455 transcript_id : NM_001048204.1

name	Zfp458 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131073 GeneID:238690 MGI:3040691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 458 transcript_id : NM_001001152.2

name	Zfp457 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110665713 GeneID:431706 MGI:2664334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 457 transcript_id : NM_001003666.2

name	A230042K10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815841 GeneID:218314 MGI:3040707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A030001O10 gene transcript_id : NM_177622.3

name	E130120F12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801734 GeneID:629016 MGI:3612873
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130120F12 gene transcript_id : NM_001038651.2

name	Zfp456 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702019 GeneID:408065 MGI:3040694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 456 transcript_id : NM_001001186.3

name	2810487A22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124301191 GeneID:72807 MGI:1920057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810487A22 gene transcript_id : NM_001080941.1

name	Zfp459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842408 GeneID:328274 MGI:3040701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 459 transcript_id : NM_177811.3

name	C330011K17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803549 GeneID:238692 MGI:3040703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330011K17 gene transcript_id : NM_177712.3

name	9630025I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053901 GeneID:408067 MGI:3040702
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630025I21 gene transcript_id : NM_001076791.2

name	Zfp817 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119155 GeneID:238693 MGI:3040705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 817 transcript_id : NM_001007575.1

name	Zfp87 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165393 GeneID:170763 MGI:107768
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 87 transcript_id : NM_133228.2

name	Zfp748 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131029 GeneID:212276 MGI:1916455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 748 transcript_id : NM_001035231.2

name	Zfp748 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78191782 GeneID:212276 MGI:1916455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 748 transcript_id : NM_183145.2

name	A530054K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624757 GeneID:212281 MGI:3036250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530054K11 gene transcript_id : NM_183146.3

name	3830402I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374533 GeneID:408068 MGI:3040706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3830402I07 gene transcript_id : NM_001001187.2

name	Zfp85-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892769 GeneID:22746 MGI:107767
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 85, related sequence 1 transcript_id : NM_001001130.2

name	Zfp273 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802315 GeneID:212569 MGI:3036278
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 273 transcript_id : NM_198322.2

name	BC048507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802635 GeneID:408058 MGI:3040680
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048507 transcript_id : NM_001001185.2

name	LOC666185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94395281 GeneID:666185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs product : similar to CG32602-PA transcript_id : XM_982175.1

name	LOC100042687 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264352 GeneID:100042687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs product : similar to CG32602-PA transcript_id : XM_001478764.1

name	LOC100042692 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264354 GeneID:100042692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs product : similar to CG32602-PA transcript_id : XM_001478772.1

name	LOC674779 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264356 GeneID:674779
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs product : similar to CG32602-PA transcript_id : XM_001478781.1

name	LOC677603 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264296 GeneID:677603
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to CG32602-PA transcript_id : XM_001477594.1

name	LOC100042124 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264298 GeneID:100042124
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : similar to pol protein transcript_id : XM_001477610.1

name	LOC666222 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94395283 GeneID:666222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs product : similar to CG32602-PA transcript_id : XM_982378.1

name	AA414992 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264358 GeneID:102402 MGI:2142939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : expressed sequence AA414992 transcript_id : XM_001478791.1

name	LOC666238 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94395285 GeneID:666238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to CG32602-PA transcript_id : XM_982514.1

name	EG666245 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395287 GeneID:666245 MGI:3648435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs product : predicted gene, EG666245 transcript_id : XM_982548.1

name	EG666272 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94395296 GeneID:666272 MGI:3645625
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs product : predicted gene, EG666272 transcript_id : XM_982690.1

name	Mtrr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372988 GeneID:210009 MGI:1891037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-methyltetrahydrofolate-homocysteine methyltransferase reductase transcript_id : NM_172480.2

name	LOC100042233 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264302 GeneID:100042233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100042233 transcript_id : XM_001477772.1

name	Fastkd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368898 GeneID:69577 MGI:1916827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FAST kinase domains 3 transcript_id : NM_027123.4

name	1700001L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264361 GeneID:69315 MGI:1916565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 24 ESTs, 1 Protein product : RIKEN cDNA 1700001L19 gene transcript_id : XM_127414.8

name	Adcy2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244091 GeneID:210044 MGI:99676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adenylate cyclase 2 transcript_id : NM_153534.2

name	Ptdss1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560651 CCDS:CCDS26612.1 GeneID:19210 MGI:1276575
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 note : PtdSer Synthase-1 product : phosphatidylserine synthase 1 protein_id : NP_032985.2

name	Zfp712 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63650303 GeneID:78251 MGI:1925501
definition	codon_start : 1 product : zinc finger protein 712 isoform 1 protein_id : XP_127404.3

name	Zfp708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892738 GeneID:432769 MGI:3040674
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; regulator of sex-limitation candidate 11 product : zinc finger protein 708 isoform c protein_id : NP_001012451.2

name	Zfp708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892592 GeneID:432769 MGI:3040674
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; regulator of sex-limitation candidate 11 product : zinc finger protein 708 isoform a protein_id : NP_001012325.2

name	Zfp708 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133893160 GeneID:432769 MGI:3040674
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; regulator of sex-limitation candidate 11 product : zinc finger protein 708 isoform b protein_id : NP_001012450.2

name	Zfp759 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119226195 GeneID:268670 MGI:2446280
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : regulator of sex-limitation candidate 8 protein_id : NP_765980.3

name	Rsl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480078 CCDS:CCDS26613.1 GeneID:380855 MGI:3044162
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007530 - sex determination [Evidence IDA] codon_start : 1 note : regulator of sex-limitation 1 product : regulator of sex limited protein-Slp 1 protein_id : NP_001013791.1

name	Zfp455 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842385 GeneID:218311 MGI:3040708
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 455 protein_id : NP_001041669.1

name	Zfp458 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564121 GeneID:238690 MGI:3040691
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 458 protein_id : NP_001001152.1

name	Zfp457 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110665714 GeneID:431706 MGI:2664334
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 457 protein_id : NP_001003666.2

name	A230042K10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244006 GeneID:218314 MGI:3040707
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB zinc finger protein; regulator of sex-limitation candidate 23 product : hypothetical protein A230042K10 protein_id : NP_808290.1

name	E130120F12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579895 GeneID:629016 MGI:3612873
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC629016 protein_id : NP_001033740.1

name	Zfp456 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123702020 GeneID:408065 MGI:3040694
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 456 protein_id : NP_001001186.3

name	2810487A22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301192 GeneID:72807 MGI:1920057
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : regulator of sex-limitation 2 protein_id : NP_001074410.1

name	Zfp459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244364 CCDS:CCDS26615.1 GeneID:328274 MGI:3040701
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 459 protein_id : NP_808479.1

name	C330011K17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244168 GeneID:238692 MGI:3040703
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB zinc finger protein; regulator of sex-limitation candidate 15 product : hypothetical protein LOC238692 protein_id : NP_808380.1

name	9630025I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115647917 GeneID:408067 MGI:3040702
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : regulator of sex-limitation candidate 16 protein_id : NP_001070259.1

name	Zfp817 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119156 CCDS:CCDS26616.1 GeneID:238693 MGI:3040705
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB zinc finger protein; regulator of sex-limitation candidate 5 product : zinc finger protein 817 protein_id : NP_001007576.1

name	Zfp87 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165394 GeneID:170763 MGI:107768
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : KRAB zinc finger protein (Mzf22); zinc finger protein 72 product : zinc finger protein 87 protein_id : NP_573491.2

name	Zfp748 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78191781 GeneID:212276 MGI:1916455
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Rslcan20/21; KRAB zinc finger protein product : zinc finger protein 748 isoform 1 protein_id : NP_001030308.1

name	Zfp748 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059106 GeneID:212276 MGI:1916455
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Rslcan20/21; KRAB zinc finger protein product : zinc finger protein 748 isoform 2 protein_id : NP_898968.1

name	A530054K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68226738 CCDS:CCDS26617.1 GeneID:212281 MGI:3036250
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Regulator of sex-limitation candidate 3 (UniProt\|Q7M6X0, evidence: FASTY, 99.1%ID, 100%length, match=2083); putative; regulator of sex-limitation candidate 3 product : hypothetical protein LOC212281 protein_id : NP_898969.2

name	3830402I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564131 GeneID:408068 MGI:3040706
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC408068 protein_id : NP_001001187.1

name	Zfp85-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564117 GeneID:22746 MGI:107767
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : KRAB-zinc finger protein 71; regulator of sex-limitation candidate 2 product : zinc finger protein 85, related sequence 1 protein_id : NP_001001130.1

name	Zfp273 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810305 GeneID:212569 MGI:3036278
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : regulator of sex-limitation candidate 1 protein_id : NP_938081.1

name	BC048507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564127 GeneID:408058 MGI:3040680
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0003777 - microtubule motor activity [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 product : cDNA sequence BC048507 protein_id : NP_001001185.1

name	LOC666185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94395282 GeneID:666185
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987269.1

name	LOC100042687 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264353 GeneID:100042687
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478814.1

name	LOC100042692 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264355 GeneID:100042692
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478822.1

name	LOC674779 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264357 GeneID:674779
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478831.1

name	LOC677603 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264297 GeneID:677603
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477644.1

name	LOC100042124 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264299 GeneID:100042124
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001477660.1

name	LOC666222 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94395284 GeneID:666222
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987472.1

name	AA414992 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264359 GeneID:102402 MGI:2142939
definition	codon_start : 1 product : hypothetical protein LOC102402 protein_id : XP_001478841.1

name	LOC666238 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94395286 GeneID:666238
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987608.1

name	EG666245 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395288 GeneID:666245 MGI:3648435
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987642.1

name	EG666272 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94395297 GeneID:666272 MGI:3645625
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987784.1

name	Mtrr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369650 CCDS:CCDS26620.1 GeneID:210009 MGI:1891037
definition	GO_function : GO:0047138 - aquacobalamin reductase activity [Evidence ISS]; GO:0009055 - electron carrier activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence ISS]; GO:0010181 - FMN binding [Evidence ISS] [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0030586 - [methionine synthase] reductase activity [Evidence ISS] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0050821 - protein stabilization [Evidence ISS] codon_start : 1 product : 5-methyltetrahydrofolate-homocysteine methyltransferase reductase protein_id : NP_766068.1

name	LOC100042233 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264303 GeneID:100042233
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477822.1

name	Fastkd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485706 GeneID:69577 MGI:1916827
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : FAST kinase domains 3 protein_id : NP_081399.3

name	1700001L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20908537 GeneID:69315 MGI:1916565
definition	codon_start : 1 product : hypothetical protein LOC69315 protein_id : XP_127414.1

name	Adcy2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244092 GeneID:210044 MGI:99676
definition	GO_component : GO:0030425 - dendrite [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IDA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0004016 - adenylate cyclase activity [Evidence TAS]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence TAS]; GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007188 - G-protein signaling, coupled to cAMP nucleotide second messenger [Evidence TAS]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : adenylate cyclase 2 protein_id : NP_705762.2

name	LOC674699 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674699
definition	number : 1 pseudo : _no_value

name	EG666137 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666137
definition	number : 1 pseudo : _no_value

name	EG666137 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666137
definition	number : 2 pseudo : _no_value

name	LOC100042223 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042223
definition	number : 1 pseudo : _no_value

name	LOC100042223 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042223
definition	number : 2 pseudo : _no_value

name	LOC100042223 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042223
definition	number : 3 pseudo : _no_value

name	LOC100042223 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042223
definition	number : 4 pseudo : _no_value

name	LOC666098 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264351 GeneID:666098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to PA28 beta subunit pseudo : _no_value transcript_id : XR_033855.1

name	LOC328277 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264350 GeneID:328277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : hypothetical protein LOC328277 transcript_id : XR_033849.1

name	LOC674597 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264346 GeneID:674597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2029 ESTs, 2 Proteins product : similar to Acidic ribosomal phosphoprotein P0 pseudo : _no_value transcript_id : XR_033778.1

name	LOC666205 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264362 GeneID:666205
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 4 Proteins product : similar to farnesyl pyrophosphate synthase pseudo : _no_value transcript_id : XR_033933.1

clone name	MSMg01-080M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521F22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534P07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-437L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525E12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-045L12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-352C23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-167I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403K19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346G15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-523J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-268K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-491B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351F07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-294P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070P01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485A07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-394I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-289G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-084O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262C01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-346D06.b	B6Ng01-346D06.g
ACC	GA128164	GA128165
length	1,094	1,191
definition	B6Ng01-346D06.b	B6Ng01-346D06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(68,221,249 - 68,222,330)	(68,038,511 - 68,039,714)
sequence	gaattcccaaggcctgagatcttccacagatgcacacctggggaatccgt tctgggctcttagtgtatccctcacaaagccctgtagttttctttgattg gttcccttggcaagggagacagataaagactaatgatctgtatacgtgtt tggaatgtgtattgattgaacttgtgctgtgcaagtctagatttcttttt cttgcatttttttctttctgtccttgggaaaaataatgcataattgcatg ctctgtcacttgctgacaccactaaccaccggatgcaatgtctacttatg ctcacagttctcaggacacactgattcctctaccgcaggttgtgccttgg tcatgtgtagctgagacaggaaatcacaagctcgagatgatgatactttc tgtcctcagtgcttttctctcttatcctcctggtagctcaaatgtgtgca gagatgttatgcctagacctctggcttgactgatcaggacggataatgcc tttgaatagcctaaggaaaagtaatagaagatggagcttgttacggtttg tatatgtttggcccagtgagtggcactattagaagaagtagccttgttgg agtaggtatatccctcttggagtaggtgtgtctccacgggtatgggtttt aagaccctcatcctagctacctggaatccagtattctgctagcagccttc agatgaagatgtagaactctctactcctcctgcatcctgcctgcctggat gctgccatgcttccagccttgatgataatggactgaacctctgaacctgc aagccagcaccaattaaatgttgtcctttataagacttgcctttggtctc agtacctgttcatagcagtaaaaaccctaagacaaagctgtttggaaaca tttcagagcagagtccttgttaagggacaggatgggtggattttatcttc ccactttccaccagatgattagctacaaccagatgacagcagaatttcct cagtcctctttcttgacgctcagtagcctcaaagaaccttgttatcttta gccagttgagtggttgctggtgagggctagaaaaacccccatag	gaattcccaaggccccagatcttccacagatgcacactggaggaaactgt tctgggctgttagtgtatccctcacaaagcactgtggttttctttgattg gttcccttggcaagggagatggatacagactgatggtctgtatacttgtt tggaatgtgtattgattgaacttgtgctgtacacgtctagatttcttttt cttgcatttcttctttctctcctagggaaaaataatgcataattgcatac tctgtcagttgctgacatcactaaccaccagatgcaatgtctccttatgc tcacagttctcaggacacactgattcctctacagtaggctgtgccttgct catgtgtagctgagacaggaaatcacaagcttgagatgatgatactttct gtcctgagtgcttttccatcttatcctcctgttagctcaaacgtgtgcag agatgttatggctagacctctggcttagctgatcagcaggaataatgcct ttgaaaagcctaaggaaaagtaatagaagatggagcttgttacagcttga atatgtttggcccagggagtggcactattagaagaaatagccttgttgga gtaggtatgtccctcttggagtaggtgtgtcaccgtgggtatgggtttta agaccctcattctagctacctcgaagccactattctgctatcagccttca gatgaagatgtaaaactctctactcctcctgcatcctgcctgcctggatg ctgccatgcttccagccttgatgataatggactgaacatctgaacctgta agccagcaccaattaaatgttgtccttataagacttgcctttggtctcgg tacctgttcatagcagtaaaaccctaagacagagcttgttggaaccattt cagagcagagtccttggtaagggacagatgggtggagttcatcttcccac tttctaccagatgattagctaacaaccaaatgacagcagaattctgagtc tccatttctgacatcagtagctcaagacctatatatttttagccagttga gtgttgctgtgagctaaggagaacctttgggaaagaataagtagaatatc tagttatcttgaattctgttacctcaatcttctcattcgagctagccgaa aaattaattcatgagagaaatgttatccagatgtggctcta
quality values	Open. Hide. 58 36 27 32 62 62 62 39 32 47 62 62 62 62 47 62 62 62 26 31 62 62 62 62 39 31 62 44 56 59 59 62 62 43 59 56 43 59 62 62 62 62 62 59 62 49 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 54 54 62 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 54 58 58 58 45 39 58 54 41 52 58 58 58 54 58 58 54 54 52 58 58 54 54 42 58 49 58 58 52 58 58 49 58 58 52 58 58 58 58 58 54 58 58 58 58 58 53 54 42 58 52 50 54 54 52 54 58 58 54 58 58 30 58 58 58 52 54 54 42 58 49 54 54 58 54 54 52 52 54 32 54 49 54 52 43 50 49 54 41 27 50 58 51 42 40 58 46 53 34 58 54 58 53 52 53 58 58 53 53 32 58 42 40 58 58 52 51 51 51 41 29 52 49 33 53 52 50 40 51 50 52 51 49 42 46 37 51 50 40 51 58 45 54 50 40 22 51 40 41 49 49 32 47 30 46 50 40 28 58 50 50 58 47 53 58 52 34 39 50 42 47 46 53 41 46 53 50 39 53 51 58 41 54 51 51 47 53 33 33 39 53 51 41 32 53 53 53 52 41 52 32 49 50 41 24 28 53 46 25 35 40 58 49 33 39 32 25 40 39 18 32 37 40 46 39 39 24 34 42 33 27 27 38 53 39 22 25 32 29 41 40 32 41 36 34 24 32 37 28 31 25 37 26 53 27 18 23 53 30 37 54 32 37 42 27 37 40 36 40 52 34 51 8 24 19 37 42 23 45 18 22 33 31 37 14 7 40 15 15 12 15 27 32 35 30 32 23 28 23 21 21 30 17 32 35 26 32 40 37 28 33 17 34 37 51 51 37 53 12 52 20 21 32 29 14 34 14 25 18 28 32 35 29 14 10 51 11 32 14 40 42 32 33 21 24 51 21 36 14 10 31 20 31 32 9 51 10 29 31 38 36 30 24 32 31 29 18 17 37 24 26 22 12 8 7 19 21 33 46 46 31 46 16 13 5 11 20 10 23 12 29 33 42 32 46 38 6 21 46 48 13 28 32 24 34 36 22 23 18 23 38 34 32 26 31 24 37 39 29 7 6 18 32 31 19 9 36 42 31 32 11 9 11 15 20 11 33 44 20 46 23 7 9 23 22 22 21 16 16 7 7 12 35 48 13 8 9 6 7 19 22 11 5 19 8 19 24 32 18 8 6 7 18 31 25 31 19 9 13 19 10 30 14 6 8 10 9 6 9 15 10 26 29 9 7 9 14 8 15 14 21 21 9 16 6 18 16 22 10 10 23 18 12 6 6 20 14 14 8 7 5 8 13 9 32 11 21 24 10 24 27 32 8 8 8 11 24 32	Open. Hide. 62 49 42 39 62 62 62 47 42 26 26 50 25 31 21 21 16 18 44 59 62 62 62 62 59 43 62 59 62 59 62 62 62 62 62 62 59 62 59 62 54 54 62 59 62 62 59 62 62 62 62 62 62 62 54 56 59 56 54 59 49 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 46 62 62 62 62 62 62 62 62 62 62 62 62 47 46 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 46 58 58 58 58 58 41 58 58 40 54 58 49 45 54 43 58 58 58 58 58 58 58 58 58 47 54 58 58 54 54 36 58 58 58 58 58 54 54 58 51 49 58 52 58 58 54 45 37 58 58 58 54 58 58 58 58 51 58 46 50 49 51 58 58 58 58 58 58 54 53 45 49 46 58 58 58 46 31 58 54 45 50 48 58 51 52 51 58 53 50 49 52 58 53 58 51 49 52 58 51 50 58 58 40 47 58 48 51 52 58 50 53 52 58 58 50 51 30 52 53 51 58 52 46 39 44 39 52 58 58 58 58 58 51 58 58 54 53 53 53 39 51 49 58 41 54 41 51 39 38 54 49 41 58 58 51 38 41 41 53 58 43 37 58 58 53 42 58 39 53 35 58 51 54 53 31 52 51 52 50 39 42 52 53 39 52 54 52 50 40 54 54 32 53 53 37 49 53 42 40 54 45 45 50 31 52 35 35 45 31 42 52 41 29 39 42 34 24 40 34 39 41 33 32 35 19 41 37 28 54 54 52 35 53 53 35 42 40 37 37 53 42 45 40 29 46 45 47 33 34 42 31 42 32 53 21 34 32 53 37 45 30 53 41 34 34 45 37 45 39 32 47 26 40 53 40 31 49 35 42 24 40 32 53 37 26 32 30 32 40 45 25 27 25 32 52 20 32 26 32 41 22 52 34 32 40 33 34 32 31 31 31 32 31 53 32 30 32 32 31 34 28 31 31 25 32 32 28 30 42 45 32 51 25 27 13 8 30 35 28 31 32 31 28 35 36 31 32 13 31 16 31 32 43 25 27 6 41 23 31 42 29 31 30 31 30 35 9 21 15 31 29 46 36 25 34 20 32 31 30 24 28 26 19 32 46 46 31 27 46 38 38 21 31 22 34 19 31 29 30 17 21 26 8 11 21 21 30 32 21 22 15 8 13 18 43 34 32 18 9 24 11 19 30 9 39 9 13 31 30 32 14 29 27 23 28 11 21 46 22 26 18 23 24 30 13 31 47 32 30 38 34 35 20 22 37 38 24 31 32 22 21 24 48 32 18 31 32 48 30 29 9 11 25 33 22 8 38 13 21 33 31 21 31 22 33 32 23 21 29 10 17 24 35 8 41 25 20 31 35 29 16 20 29 9 7 25 7 22 5 8 25 27 34 10 11 19 12 8 30 13 25 48 34 21 21 24 32 13 9 21 10 6 12 17 16 11 16 17 9 25 29 13 19 7 10 10 10 17 7 5 6 6 30 48 27 22 14 17 20 14 9 18 18 14 17 20 15 3 6 6 21 28 25 15 23 5 14 10 25 8 11 20 13 8 6 11 8 11 13 28 16 4 9 9 24 10 7 6 6 5 7 8 28 12 20 22 15 11 14 5 7 3 5 3 9 26 16 20 11 16 8 5 4 10 16 15 23 4 9 23 5 8 5 8 7 22 6 13 10 16 20 9 18 6 6 4 13 8 8 24 5 13 5 5 1 2 8 11 10 9 12 10 4 14 18 30 28 15 3 2 2 3 3 3 3 1 3 1 2 3 4 6 10 7 23 13 5 5 4 4 4 4 4 4 6 7 13 3 7 4 5 12 2 3 6 6 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr13_68221249_68222330
seq2: B6Ng01-346D06.b_46_1139 (reverse)

seq1  CTATAGGGGTTTTCTTAG-CCTCACCAGCAACACCTCAACTGGCTAAAGT  49
      |||| ||||||||  ||| |||||||||||||  ||||||||||||||| 
seq2  CTATGGGGGTTTTTCTAGCCCTCACCAGCAACCACTCAACTGGCTAAAGA  50

seq1  ATACA--GGTCTTTGAGCTAACTGA-CGTC-AGAAAGGAGACTGAG--AA  93
        |||  | ||||||||   ||||| |||| ||||||  |||||||  ||
seq2  TAACAAGGTTCTTTGAGGCTACTGAGCGTCAAGAAAGAGGACTGAGGAAA  100

seq1  TTCTGCTGTCATCTGGTTGTTAGCTAATCATCTGGTGGAAAGTGGGAAGA  143
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TTCTGCTGTCATCTGGTTG-TAGCTAATCATCTGGTGGAAAGTGGGAAGA  149

seq1  TAAACTCCACCCAT-CTGTCCCTTAACAAGGACTCTGCTCTG-AATGTTT  191
      |||| ||||||||| ||||||||||||||||||||||||||| |||||||
seq2  TAAAATCCACCCATCCTGTCCCTTAACAAGGACTCTGCTCTGAAATGTTT  199

seq1  CC-AACAGCTTTGTCTTA-GGTTTTTACTGCTATGAACAGGTACTGAGAC  239
      || ||||||||||||||| |||||||||||||||||||||||||||||||
seq2  CCAAACAGCTTTGTCTTAGGGTTTTTACTGCTATGAACAGGTACTGAGAC  249

seq1  C-AAGGCAAGTCTTAT-AAGGACAACATTTAATTGGTGCTGGCTTGCAGG  287
      | |||||||||||||| |||||||||||||||||||||||||||||||||
seq2  CAAAGGCAAGTCTTATAAAGGACAACATTTAATTGGTGCTGGCTTGCAGG  299

seq1  TTCAGAGGTTCAGTCCATTATCATCAAGGCTGGAAGCATGGCAGCATCCA  337
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGAGGTTCAGTCCATTATCATCAAGGCTGGAAGCATGGCAGCATCCA  349

seq1  GGCAGGCAGGATGCAGGAGGAGTAGAGAGTTCTACATCTTCATCTGAAGG  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGCAGGATGCAGGAGGAGTAGAGAGTTCTACATCTTCATCTGAAGG  399

seq1  CTGCTAGCAGAATACTGGATTCCAGGTAGCTAGGATGAGGGTCTTAAAAC  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTAGCAGAATACTGGATTCCAGGTAGCTAGGATGAGGGTCTTAAAAC  449

seq1  CCATACCCGTGGAGACACACCTACTCCAAGAGGGATATACCTACTCCAAC  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATACCCGTGGAGACACACCTACTCCAAGAGGGATATACCTACTCCAAC  499

seq1  AAGGCTACTTCTTCTAATAGTGCCACTCACTGGGCCAAACATATACAAAC  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTACTTCTTCTAATAGTGCCACTCACTGGGCCAAACATATACAAAC  549

seq1  CGTAACAAGCTCCATCTTCTATTACTTTTCCTTAGGCTATTCAAAGGCAT  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTAACAAGCTCCATCTTCTATTACTTTTCCTTAGGCTATTCAAAGGCAT  599

seq1  TATCCGTCCTGATCAGTCAAGCCAGAGGTCTAGGCATAACATCTCTGCAC  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCCGTCCTGATCAGTCAAGCCAGAGGTCTAGGCATAACATCTCTGCAC  649

seq1  ACATTTGAGCTACCAGGAGGATAAGAGAGAAAAGCACTGAGGACAGAAAG  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTGAGCTACCAGGAGGATAAGAGAGAAAAGCACTGAGGACAGAAAG  699

seq1  TATCATCATCTCGAGCTTGTGATTTCCTGTCTCAGCTACACATGACCAAG  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCATCATCTCGAGCTTGTGATTTCCTGTCTCAGCTACACATGACCAAG  749

seq1  GCACAACCTGCGGTAGAGGAATCAGTGTGTCCTGAGAACTGTGAGCATAA  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAACCTGCGGTAGAGGAATCAGTGTGTCCTGAGAACTGTGAGCATAA  799

seq1  GTAGACATTGCATCCGGTGGTTAGTGGTGTCAGCAAGTGACAGAGCATGC  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGACATTGCATCCGGTGGTTAGTGGTGTCAGCAAGTGACAGAGCATGC  849

seq1  AATTATGCATTATTTTTCCCAAGGACAGAAAGAAAAAAATGCAAGAAAAA  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTATGCATTATTTTTCCCAAGGACAGAAAGAAAAAAATGCAAGAAAAA  899

seq1  GAAATCTAGACTTGCACAGCACAAGTTCAATCAATACACATTCCAAACAC  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATCTAGACTTGCACAGCACAAGTTCAATCAATACACATTCCAAACAC  949

seq1  GTATACAGATCATTAGTCTTTATCTGTCTCCCTTGCCAAGGGAACCAATC  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATACAGATCATTAGTCTTTATCTGTCTCCCTTGCCAAGGGAACCAATC  999

seq1  AAAGAAAACTACAGGGCTTTGTGAGGGATACACTAAGAGCCCAGAACGGA  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAAACTACAGGGCTTTGTGAGGGATACACTAAGAGCCCAGAACGGA  1049

seq1  TTCCCCAGGTGTGCATCTGTGGAAGATCTCAGGCCTTGGGAATTC  1082
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCAGGTGTGCATCTGTGGAAGATCTCAGGCCTTGGGAATTC  1094

seq1: chr13_68038511_68039714
seq2: B6Ng01-346D06.g_68_1258

seq1  GAATTCCCAAGGCCCCAGATCTTCCACAGATGCACACTGGAGGAAACTGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAAGGCCCCAGATCTTCCACAGATGCACACTGGAGGAAACTGT  50

seq1  TCTGGGCTGTTAGTGTATCCCTCACAAAGCACTGTGGTTTTCTTTGATTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGGCTGTTAGTGTATCCCTCACAAAGCACTGTGGTTTTCTTTGATTG  100

seq1  GTTCCCTTGGCAAGGGAGATGGATACAGACTGATGGTCTGTATACTTGTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCCTTGGCAAGGGAGATGGATACAGACTGATGGTCTGTATACTTGTT  150

seq1  TGGAATGTGTATTGATTGAACTTGTGCTGTACACGTCTAGATTTCTTTTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATGTGTATTGATTGAACTTGTGCTGTACACGTCTAGATTTCTTTTT  200

seq1  CTTGCATTTCTTCTTTCTCTCCTAGGGAAAAATAATGCATAATTGCATAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCATTTCTTCTTTCTCTCCTAGGGAAAAATAATGCATAATTGCATAC  250

seq1  TCTGTCAGTTGCTGACATCACTAACCACCAGATGCAATGTCTCCTTATGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCAGTTGCTGACATCACTAACCACCAGATGCAATGTCTCCTTATGC  300

seq1  TCACAGTTCTCAGGACACACTGATTCCTCTACAGTAGGCTGTGCCTTGCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAGTTCTCAGGACACACTGATTCCTCTACAGTAGGCTGTGCCTTGCT  350

seq1  CATGTGTAGCTGAGACAGGAAATCACAAGCTTGAGATGATGATACTTTCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGTAGCTGAGACAGGAAATCACAAGCTTGAGATGATGATACTTTCT  400

seq1  GTCCTGAGTGCTTTTCCATCTTATCCTCCTGTTAGCTCAAACGTGTGCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTGAGTGCTTTTCCATCTTATCCTCCTGTTAGCTCAAACGTGTGCAG  450

seq1  AGATGTTATGGCTAGACCTCTGGCTTAGCTGATCAGCAGGAATAATGCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGTTATGGCTAGACCTCTGGCTTAGCTGATCAGCAGGAATAATGCCT  500

seq1  TTGAAAAGCCTAAGGAAAAGTAATAGAAGATGGAGCTTGTTACAGCTTGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAAGCCTAAGGAAAAGTAATAGAAGATGGAGCTTGTTACAGCTTGA  550

seq1  ATATGTTTGGCCCAGGGAGTGGCACTATTAGAAGAAATAGCCTTGTTGGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGTTTGGCCCAGGGAGTGGCACTATTAGAAGAAATAGCCTTGTTGGA  600

seq1  GTAGGTATGTCCCTCTTGGAGTAGGTGTGTCACCGTGGGTATGGGTTTTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGTATGTCCCTCTTGGAGTAGGTGTGTCACCGTGGGTATGGGTTTTA  650

seq1  AGACCCTCATTCTAGCTACCTCGAAGCCACTATTCTGCTATCAGCCTTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCCTCATTCTAGCTACCTCGAAGCCACTATTCTGCTATCAGCCTTCA  700

seq1  GATGAAGATGTAAAACTCTCTACTCCTCCTGCATCCTGCCTGCCTGGATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAAGATGTAAAACTCTCTACTCCTCCTGCATCCTGCCTGCCTGGATG  750

seq1  CTGCCATGCTTCCAGCCTTGATGATAATGGACTGAACATCTGAACCTGTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCATGCTTCCAGCCTTGATGATAATGGACTGAACATCTGAACCTGTA  800

seq1  AGCCAGCACCAATTAAATGTTGTCCTTATAAGACTTGCC-TTGGTCTCGG  849
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  AGCCAGCACCAATTAAATGTTGTCCTTATAAGACTTGCCTTTGGTCTCGG  850

seq1  TACCTGTTCATAGCAGTAAAACCCTAAGACAGAGC-TGTTGGAACCA-TT  897
      ||||||||||||||||||||||||||||||||||| ||||||||||| ||
seq2  TACCTGTTCATAGCAGTAAAACCCTAAGACAGAGCTTGTTGGAACCATTT  900

seq1  CAGAGCAGAGTCCTTGGTAAGGGACAGATGGGTGGAGTTCATCTTCCCAC  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCAGAGTCCTTGGTAAGGGACAGATGGGTGGAGTTCATCTTCCCAC  950

seq1  TTTCTACCAGATGATTAGCTAACAACCAAATGACAGCAGAATTCTGAGTC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTACCAGATGATTAGCTAACAACCAAATGACAGCAGAATTCTGAGTC  1000

seq1  TCCATTTCTGACATCAGTTAGCTCAAAGACCTATATA-TTTTAGCCAGTT  1046
      ||||||||||||||||| |||||| |||||||||||| ||||||||||||
seq2  TCCATTTCTGACATCAG-TAGCTC-AAGACCTATATATTTTTAGCCAGTT  1048

seq1  GAGGTGTTGCTGGTGAGGCTAA-GAGAACCCCTATGGGATAG-ATAAGTA  1094
      || |||||||| |||| ||||| |||||  ||| ||||| || |||||||
seq2  GA-GTGTTGCT-GTGA-GCTAAGGAGAA--CCTTTGGGAAAGAATAAGTA  1093

seq1  GAAATTAATCTAGTTATCTTGGATTCTGTTTACTCAATCTTCTCCATCCC  1144
      |||    |||||||||||||| ||||||||  ||||||||||||  |  |
seq2  GAA---TATCTAGTTATCTTGAATTCTGTTACCTCAATCTTCTCATT--C  1138

seq1  AAGCTAGCAGAAAAAAATAAAAATAAAAGAGAGAAAAATGTATCACAGAA  1194
       ||||||| |||||    |  |||  | ||||||||  | |||| ||| |
seq2  GAGCTAGCCGAAAA----ATTAATTCATGAGAGAAATGT-TATC-CAG-A  1181

seq1  TGTGGCTCTA  1204
      ||||||||||
seq2  TGTGGCTCTA  1191

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information