MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-019G19
Chromosome	14 (Build37)
Map Location	19,916,813 - 19,917,922
singlet/doublet	singlet
Overlap gene	EG632477
Upstream gene	LOC627608, Nr1d2, LOC632287, Rpl15, Nkiras1, Ube2e1, LOC627717, LOC238963, Ube2e2, LOC627741, LOC100042299, LOC675069, LOC100042322, LOC632470
Downstream gene	EG632498, EG667341, LOC667344, LOC619996, EG434616, LOC675165, 1700110I01Rik, EG664814, LOC100039452, LOC100038983, LOC100039441, EG432825, LOC673583, EG664855, Nid2, 2700060E02Rik, LOC100039534, Gng2, 1810063B07Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC627608 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Nr1d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353187 MGI:2449205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins pseudo : _no_value

name	Rpl15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66480 MGI:1913730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkiras1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69721 MGI:1916971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22194 MGI:107411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 268 ESTs, 2 Proteins pseudo : _no_value

name	LOC238963 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:238963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 36 Proteins pseudo : _no_value

name	Ube2e2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218793 MGI:2384997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627741 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100042299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC675069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC632470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG632477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632477 MGI:3648627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG632498 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632498 MGI:3647982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG667341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667341 MGI:3643667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	LOC619996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins pseudo : _no_value

name	EG434616 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434616 MGI:3647174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein

name	LOC675165 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins pseudo : _no_value

name	1700110I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73549 MGI:1920799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG664814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664814 MGI:3643017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	LOC100039452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 16 Proteins

name	LOC100038983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100039441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein pseudo : _no_value

name	EG432825 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432825 MGI:3646663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC673583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG664855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664855 MGI:3643484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Nid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18074 MGI:1298229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700060E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68045 MGI:1915295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14702 MGI:102705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1810063B07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67509 MGI:1914759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 2 Proteins

name	Nr1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367557 GeneID:353187 MGI:2449205
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group D, member 2 transcript_id : NM_011584.3

name	Rpl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485552 GeneID:66480 MGI:1913730
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L15 transcript_id : NM_025586.3

name	Nkiras1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84872198 GeneID:69721 MGI:1916971
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NFKB inhibitor interacting Ras-like protein 1 transcript_id : NM_023526.3

name	Ube2e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365631 GeneID:22194 MGI:107411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) transcript_id : NM_009455.3

name	Ube2e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450232 GeneID:218793 MGI:2384997
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) transcript_id : NM_144839.1

name	LOC100042322 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265141 GeneID:100042322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to phosphatidylserine decarboxylase transcript_id : XM_001477939.1

name	EG632477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396600 GeneID:632477 MGI:3648627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG632477 transcript_id : XM_989855.1

name	EG434616 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265171 GeneID:434616 MGI:3647174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein product : predicted gene, EG434616 transcript_id : XM_486466.4

name	1700110I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265245 GeneID:73549 MGI:1920799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700110I01 gene transcript_id : XM_001471969.1

name	LOC100039452 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265253 GeneID:100039452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 16 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001472852.1

name	EG432825 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67010058 GeneID:432825 MGI:3646663
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432825 transcript_id : NM_001024706.1

name	EG664855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265248 GeneID:664855 MGI:3643484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG664855 transcript_id : XM_973078.2

name	Nid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370360 GeneID:18074 MGI:1298229
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nidogen 2 transcript_id : NM_008695.2

name	2700060E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370362 GeneID:68045 MGI:1915295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700060E02 gene transcript_id : NM_026528.3

name	LOC100039534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265255 GeneID:100039534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039534 transcript_id : XM_001472977.1

name	Gng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490420 GeneID:14702 MGI:102705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 2 subunit transcript_id : NM_001038637.1

name	Gng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490416 GeneID:14702 MGI:102705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 2 subunit transcript_id : NM_010315.4

name	1810063B07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265257 GeneID:67509 MGI:1914759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 2 Proteins product : RIKEN cDNA 1810063B07 gene transcript_id : XM_973341.2

name	Nr1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543338 GeneID:353187 MGI:2449205
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Rev-erb beta product : nuclear receptor subfamily 1, group D, member 2 protein_id : NP_035714.2

name	Rpl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385036 CCDS:CCDS22925.1 GeneID:66480 MGI:1913730
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : ribosomal protein L15 protein_id : NP_079862.1

name	Nkiras1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541888 CCDS:CCDS26836.1 GeneID:69721 MGI:1916971
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : I-kappa-B-interacting Ras-like protein 1 product : kappaB-Ras1 protein protein_id : NP_076015.2

name	Ube2e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678479 CCDS:CCDS26837.1 GeneID:22194 MGI:107411
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004840 - ubiquitin conjugating enzyme activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquitin-conjugating enzyme 5 product : ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog protein_id : NP_033481.1

name	Ube2e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450233 CCDS:CCDS26838.1 GeneID:218793 MGI:2384997
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : TBC1 domain family, member 12 product : ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) protein_id : NP_659088.1

name	LOC100042322 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265142 GeneID:100042322
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477989.1

name	EG632477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396601 GeneID:632477 MGI:3648627
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994949.1

name	EG434616 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51827552 GeneID:434616 MGI:3647174
definition	codon_start : 1 product : similar to geranylgeranyl diphosphate synthase1 protein_id : XP_486466.1

name	1700110I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265246 GeneID:73549 MGI:1920799
definition	codon_start : 1 product : hypothetical protein LOC73549 protein_id : XP_001472019.1

name	LOC100039452 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265254 GeneID:100039452
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001472902.1

name	EG432825 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67010059 GeneID:432825 MGI:3646663
definition	codon_start : 1 product : hypothetical protein LOC432825 protein_id : NP_001019877.1

name	EG664855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265249 GeneID:664855 MGI:3643484
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_978172.2

name	Nid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370361 GeneID:18074 MGI:1298229
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA] [Evidence IPI]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IPI] [Evidence IDA] codon_start : 1 note : entactin 2 product : nidogen 2 protein_id : NP_032721.2

name	2700060E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386026 CCDS:CCDS26839.1 GeneID:68045 MGI:1915295
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68045 protein_id : NP_080804.1

name	LOC100039534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265256 GeneID:100039534
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473027.1

name	Gng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490421 CCDS:CCDS26840.1 GeneID:14702 MGI:102705
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 2 subunit protein_id : NP_001033726.1

name	Gng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754020 CCDS:CCDS26840.1 GeneID:14702 MGI:102705
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 2 subunit protein_id : NP_034445.1

name	1810063B07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265258 GeneID:67509 MGI:1914759
definition	codon_start : 1 product : hypothetical protein LOC67509 protein_id : XP_978435.2

name	LOC627608 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627608
definition	number : 1 pseudo : _no_value

name	LOC627741 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627741
definition	number : 1 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 1 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 2 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 3 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 4 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 5 pseudo : _no_value

name	LOC675069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675069
definition	number : 1 pseudo : _no_value

name	LOC632470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632470
definition	number : 3 pseudo : _no_value

name	LOC632470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632470
definition	number : 2 pseudo : _no_value

name	LOC632470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632470
definition	number : 1 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 6 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 5 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 4 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 3 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 2 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 1 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 1 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 2 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 3 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 4 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 5 pseudo : _no_value

name	LOC619996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619996
definition	number : 2 pseudo : _no_value

name	LOC619996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619996
definition	number : 1 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 4 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 3 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 2 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 1 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 1 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 2 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 3 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 4 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 1 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 2 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 3 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 4 pseudo : _no_value

name	LOC632287 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265169 GeneID:632287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 3 Proteins product : similar to pleckstrin homology domain containing, family F (with FYVE domain) member 1 pseudo : _no_value transcript_id : XR_033982.1

name	LOC627717 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265170 GeneID:627717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 268 ESTs, 2 Proteins product : similar to farnesyl diphosphate farnesyl transferase 1 pseudo : _no_value transcript_id : XR_034005.1

name	LOC238963 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265131 GeneID:238963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 36 Proteins product : similar to SKD1 pseudo : _no_value transcript_id : XR_033426.1

name	LOC667344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265149 GeneID:667344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to Speer4e protein pseudo : _no_value transcript_id : XR_033495.1

name	EG664814 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265247 GeneID:664814 MGI:3643017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : predicted gene, EG664814 pseudo : _no_value transcript_id : XR_001650.2

name	LOC100039441 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265252 GeneID:100039441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein product : hypothetical protein LOC100039441 pseudo : _no_value transcript_id : XR_030894.1

clone name	MSMg01-501L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426B05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261A08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166C17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-305I13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-323D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292K09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-401E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522K06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-325F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049M02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-019G19.b	B6Ng01-019G19.g
ACC	DH852512	DH852513
length	1,286	1,103
definition	DH852512\|Mus musculus domesticus DNA, BAC clone: B6Ng01-019G19, 5' end.	DH852513\|Mus musculus domesticus DNA, BAC clone: B6Ng01-019G19, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctgacacacccagaatctcaggttcacaagagaccagaatcacag gatcacagagaaagctggacactaaggagtcctgaatgaactgggattat aggaaggacagactgcaatcagatatattgagggcagcaaacacttgaga taatcagatggcaggacacaagcataagaacagaagcaacagaaaacaag gttacttggcatcatcagaaacaaattctcccaccatagcaagtcctgga tacagcatcacaccagaaaagcaaaatatggatctaaggtcacttctcat gatgatgatggaggactttaagaaggaaataaataactcccttaaagaaa tacaggaaaacacaggtaaacagctagaagctcttaaagaggaaacacaa aaatcccttaaagagttacaggaaaacactaccaaacagttgaaagaatt gaacaaaaccatccaggatctaaaaatggaagtagaaacaatgaagaaaa cccaaagggagacaactctggaggtagaaatgctaggaaagaaatcagga accatagatgtgagcatcagcaacagaatacaagagatggaagagagaat ctcaggtgcagaagattccatagggaacatgaacacaacaatcaaagaaa atgcaaaatgcaaaacgatcctaactcaaaacatccaggaaatccaggac acaatgagaagaccaaacctaaggataataggagtagatgagaatgaaga ttttccatttaaagggccagtaaatatcttcaacaaaattatagaagaaa ccttcccaaacctaaagaaaaagatgattatgaacatacaagaggcctac agaactccaaatagactgggtcagaaaagaaattcctcctgacacataat gatcagagcaacaaaagcactaaataaggataggatattaaaagaagtaa agggaaaaggtcaagtaacatatacaggcagacgtatcagaattacagaa ggacttcttcaccaaagactattgaaagcagaagaatcctggacagatgt ttttacagaaccctagaagagcacaaatttgcagccaggctacttaaccc agccaaactctcattaccacagttggagaaaccaagtaatccatgccaaa cggatttaacaaatatttcatggagcagcccttcaagatatataacgaat atcatacatgggagggtaatgaaccttgaagcgagaagtaatcctcacaa ccttaaaagagaaaaagtcctgagacaggaattcta	gaattctaaatgctgggattttcttaaccttgggaaacttgctatcgtgg ccccagaacaccagaagctaggcatctagatggaaggtgccctggctccc tgtgttcactcagtagggctggaagagcacactaaccaggtatgttctca agagccttaggctacaagtctttgcccaccagacacctgtgattgtattt cccctgttttcataaaagggattctaattctggataactaatactgtata gacagctattacacataattgtggagatgaggccatacatcaccacagcc ttataatctgcccaagggatacaaatgaatggacaattgttagtacatat tcaaagtacattgctatttaaagtaggaactaccagacctcgggacccac atcacctggaaactgttagggaggtaaatcctcaggggaaaaacacaggc tgctagattccaaattgtggagaaaaataaaaacatataaaacctattca cgtttgtacatgtgcacacacacaggttcacagacttagacctatacaca agatggagaaagagaaagagtgagagaataaaaaagagagacagcgacaa cgagaacacaatgagaggtagaagaaatgtacacaatattactgtctcag tgtttaaggcacacagacaaagaggaacaggcatgaacctcgggccttct aatcgagcactgagaagaaccaagatatgaatttcttgagttatttttag gcatacacaactcttcacatggacaagatatttacatgtaagtctaacct atgaaaccaactcttagaacaaggtatctggatttacatcaccacagaac tactcagggtacccttgtcctcttgaatacgttttgcttggctgtcatct aaaggatcatgcaatgcaacaacactatgtgggttctacttgctcaacat gacatgcaaacctgcccctgttatgcatatcaagagtattgttcccctgt ggcaccaatgaaaatgaataccctttggagtcttttatgtgttcctgctg gacataagccttgttttacttagtgaccacataaataagacaaatgctac taa
quality values	Open. Hide. 61 41 32 33 61 47 36 43 52 52 29 47 24 50 50 43 24 43 55 55 47 55 55 49 49 52 49 61 36 49 11 29 14 10 8 18 12 19 19 21 17 27 59 59 61 59 52 59 49 59 55 59 59 59 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 52 43 36 31 44 43 36 52 45 61 61 61 61 59 61 61 61 59 61 61 61 61 59 44 59 61 61 61 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 59 61 59 59 59 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 59 59 61 59 59 59 59 59 59 52 61 61 61 61 59 59 59 61 61 61 61 61 59 59 59 61 59 61 59 59 59 61 61 61 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 59 61 59 59 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 55 61 55 61 61 61 61 61 55 61 61 61 61 61 55 61 55 55 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 53 53 50 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 50 43 43 50 28 35 50 50 61 50 50 61 61 61 61 61 61 61 61 61 61 61 61 34 61 61 61 53 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 53 61 61 61 61 61 53 61 61 61 47 61 61 61 47 61 61 61 61 61 61 53 47 61 61 61 61 46 61 47 61 61 61 61 53 31 61 61 61 61 61 52 61 61 61 61 45 57 53 45 47 57 53 57 57 57 45 53 53 39 57 53 57 57 57 57 57 53 38 46 42 50 53 53 57 36 39 53 45 53 50 47 57 53 57 57 53 57 57 57 45 57 50 43 57 53 53 43 57 42 57 47 50 53 32 42 53 53 53 45 53 40 53 53 40 53 53 33 57 53 47 50 57 43 50 50 50 42 46 53 57 45 53 39 57 47 32 57 45 57 38 57 50 53 38 50 53 50 52 38 33 57 34 53 50 50 45 57 57 38 41 29 53 53 52 40 52 45 37 57 57 37 57 45 38 53 57 41 47 47 30 53 22 46 53 32 57 52 41 26 57 57 52 53 57 57 45 43 57 42 43 43 57 35 38 53 37 30 57 57 57 37 31 53 42 57 50 42 43 53 45 53 52 31 57 57 53 50 30 53 53 50 30 53 38 53 57 33 40 53 39 23 37 38 34 30 36 52 35 57 52 57 53 39 53 53 37 37 24 50 33 57 39 40 57 40 35 53 24 57 24 28 40 50 38 52 34 52 52 27 37 40 36 36 30 53 53 27 52 40 37 53 57 31 33 33 20 57 57 37 37 40 29 31 57 48 14 57 44 52 57 53 31 42 29 33 37 32 57 46 40 34 37 40 47 53 40 25 44 37 33 57 57 30 20 26 33 40 32 33 33 33 18 53 57 47 37 44 33 53 41 57 37 22 57 47 24 53 40 37 57 30 33 53 57 57 57 37 23 28 16 39 39 16 31 32 27 31 30 32 31 17 31 28 39 23 32 20 46 25 48 20 32 30 27 30 25 24 43 11 13 40 33 30 22 51 28 30 31 23 24 21 28 47 51 32 24 32 28 14 43 46 51 39 14 26 51 27 29 25 25 36 35 29 31 28 38 20 17 13 29 13 34 21 28 26 27 20 35 30 15 24 40 28 32 20 18 39 22 31 46 32 35 33 15 28 24 29 43 5 16 20 19 16 28 13 12 16 23 29 28 27 14 29 26 8 46 41 30 11 21 28 10 26 18 36 13 11 46 39 20 33 43 23 8 15 7 25 21 18 20 23 8 26 16 15 27 18 38 21 23 7 10 13 14 9 19 20 21 15 7 7 7 8 9 7 18 32 27 10 12 22 6 10 21 36 6 8 20 10 27 18 11 6 12 10 10 20 18 7 38 13 13 9 6 7 12 6 16 12 28 31 17 12 30 7 9 30 23 9 7 11 5 20 13 16 29 24 27 9 6 6 11 5 22 28 29 10 7 6 7 12 6 13 12 14 28 28 9 6 13 5 9 10 5 6 8 8 10 19 9 18 13 9 26 19 13 13 15 14 25 30 8 24 15 18 9 6 6 8 13 9 6 4 15 21 10 14 13 8 19 30 8 6 13 9 5 7 10 14 16 7 15 6 5 17 5 3 3 4 21 17 6 6 6 31 13 6 13 4 11 9 6 4 6 22 5 13 6 4 7 9 4 6 36 5 18 5 9 14 6 26 17 7 11 9 9 4 4 5 11 20 29 18 12 9 5 8 6 12 6 12 8 5 5 21 12 7 16 5 11 6 21 4 6 13 4 5 4 22 13 5 5 16 9 4 8 7 14 5 3 4 12 16 5 9 7 7 4 10 24 14 6 18 19 4 6 7 12 3 13 4 4 6 3 5 3 3 8 12 9 20 13 5 10 16 6 5 12 4 18 8 7 16 5 5 4 15 6 4 13 16 16 5 6 4 4 17 20 20 9 7 4 3 4 10 5 4 4 4 11 4 7 3 6 18 17 4 3 5 1 2	Open. Hide. 55 61 55 49 61 59 59 16 19 23 20 23 19 28 28 28 28 30 37 61 59 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 59 61 61 61 59 61 59 61 59 55 55 59 59 59 61 59 59 38 37 59 52 52 49 59 61 59 59 61 61 61 61 61 61 59 61 59 59 61 61 61 61 59 61 61 61 61 59 59 59 61 59 61 61 61 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 49 59 59 52 59 59 59 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 59 61 61 61 61 61 59 61 59 61 61 61 59 61 61 59 59 59 61 61 61 59 59 61 61 61 61 61 61 61 59 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 49 59 52 59 52 61 61 61 59 59 59 59 59 52 43 59 59 61 61 61 59 61 59 61 61 61 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 55 55 55 55 55 61 61 55 61 61 61 55 61 61 61 61 47 61 61 61 55 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 49 49 33 28 43 35 55 55 55 50 55 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 55 61 61 61 55 61 55 55 61 61 55 61 61 61 61 50 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 47 47 47 61 61 47 35 53 61 61 61 61 61 61 61 61 45 61 61 61 61 47 52 50 50 61 61 61 61 53 61 61 61 43 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 53 53 61 50 61 61 52 61 61 50 53 50 61 45 53 50 53 50 47 61 50 53 61 50 53 52 45 61 53 61 61 52 50 61 47 61 61 61 61 52 61 43 53 43 61 53 61 61 61 61 61 52 61 61 61 53 61 50 61 61 61 61 61 45 53 57 53 45 57 45 53 43 29 50 57 57 53 47 57 43 53 43 57 53 53 45 52 53 53 45 53 45 17 39 46 34 53 50 57 50 50 39 53 47 50 42 53 53 38 53 39 47 24 53 38 53 57 33 57 53 47 40 39 25 45 47 34 53 34 57 50 50 45 53 50 53 53 57 42 57 34 47 30 28 38 42 23 57 30 38 47 20 41 21 53 53 45 53 34 43 53 45 27 47 47 32 53 46 32 47 47 30 33 47 46 24 38 53 52 53 27 52 41 50 53 47 27 22 17 53 28 37 52 23 17 38 50 53 34 52 34 50 45 47 52 52 35 23 53 41 14 41 25 19 47 52 31 23 37 24 38 38 50 34 42 16 57 46 52 36 30 37 45 18 47 25 30 10 57 57 57 40 38 30 52 36 35 40 33 50 27 35 14 47 47 39 38 50 42 38 30 38 30 35 50 52 29 36 14 46 39 33 16 25 24 57 57 33 48 28 52 53 33 16 52 19 31 37 36 33 30 37 53 33 31 33 30 52 57 33 38 37 33 21 32 33 37 37 16 37 29 57 16 23 30 30 40 44 26 30 27 27 10 20 8 8 8 57 40 25 34 19 32 34 27 29 31 27 31 32 25 51 24 28 32 25 38 30 29 11 21 51 21 11 21 29 51 47 20 31 25 21 30 30 21 31 47 8 30 30 12 9 13 19 24 29 35 44 26 12 17 29 33 29 29 25 35 29 14 31 31 23 29 29 25 51 29 31 29 25 14 29 10 9 13 18 26 21 18 41 9 5 7 30 10 29 28 31 28 10 17 17 14 10 8 51 6 14 12 28 7 8 16 20 28 20 11 20 14 27 21 14 20 20 15 14 7 5 11 18 31 35 38 30 12 23 16 28 13 17 24 24 13 29 14 22 16 14 24 8 12 13 12 11 14 10 21 18 33 15 8 22 18 13 36 12 10 10 10 5 5 7 18 9 9 7 8 7 9 6 6 6 8 10 13 28 6 6 5 6 12 31 10 14 9 11 18 19 8 6 5 7 10 10 6 9 15 35 33 17 28 8 6 6 10 4 3 6 4 5 6 5 10 21 26 18 7 9 6 5 9 8 29 7 6 7 6 7 29 29 30 8 15 28 23 29 6 14 6 9 5 9 10 5 10 5 12 21 7 6 4 4 4 21 8 13 29 30 11 30 16 23 4 8 3 4 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_19916813_19917922
seq2: B6Ng01-019G19.g_68_1170 (reverse)

seq1  TTAGTAAGCATTTGTCTACTTTTTATGT-GTACTTAAGTAAAACAAGGGC  49
      ||||| |||||||||||  | ||||||| ||   |||||||||||| |||
seq2  TTAGT-AGCATTTGTCT--TATTTATGTGGTCACTAAGTAAAACAA-GGC  46

seq1  TCATGTCCAGCAGGGGACACACATAAAAAGACT-CAAAGGATATTCATGT  98
      | ||||||||||||    |||||| |||||||| |||||| ||||||| |
seq2  TTATGTCCAGCAGG---AACACAT-AAAAGACTCCAAAGGGTATTCATTT  92

seq1  TCA-TAGTGACACAGTGGAACAATACTACTGATATGCATAACAGGGGCAG  147
      ||| | ||| ||||| |||||||||||  |||||||||||||||||||||
seq2  TCATTGGTGCCACAGGGGAACAATACTCTTGATATGCATAACAGGGGCAG  142

seq1  GTTTTGCATGTCATGTTGAGCAAGTAGAA-CCACATAGTGTTGGTGCATT  196
      | ||||||||||||||||||||||||||| ||||||||||||| ||||||
seq2  G-TTTGCATGTCATGTTGAGCAAGTAGAACCCACATAGTGTTGTTGCATT  191

seq1  GCATGATCCTTTAGATGACAGCCAAGCAAAACGTATTCCAAGAGGACAAG  246
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  GCATGATCCTTTAGATGACAGCCAAGCAAAACGTATT-CAAGAGGACAAG  240

seq1  GGTACCCTGAGTAGTTCTGTGGTGATGTAAATTCCAGATACCTTGTTCTA  296
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  GGTACCCTGAGTAGTTCTGTGGTGATGTAAA-TCCAGATACCTTGTTCTA  289

seq1  AGAGTTGGTTTCATAGGTTAGACTTACATGTAAATATCTTGTCCATGTGA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTTGGTTTCATAGGTTAGACTTACATGTAAATATCTTGTCCATGTGA  339

seq1  AGAGTTGTGTATGCCTAAAAATAACTCAAGAAATTCATATCTTGGTTCTT  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTTGTGTATGCCTAAAAATAACTCAAGAAATTCATATCTTGGTTCTT  389

seq1  CTCAGTGCTCGATTAGAAGGCCCGAGGTTCATGCCTGTTCCTCTTTGTCT  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGTGCTCGATTAGAAGGCCCGAGGTTCATGCCTGTTCCTCTTTGTCT  439

seq1  GTGTGCCTTAAACACTGAGACAGTAATATTGTGTACATTTCTTCTACCTC  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGCCTTAAACACTGAGACAGTAATATTGTGTACATTTCTTCTACCTC  489

seq1  TCATTGTGTTCTCGTTGTCGCTGTCTCTCTTTTTTATTCTCTCACTCTTT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTGTGTTCTCGTTGTCGCTGTCTCTCTTTTTTATTCTCTCACTCTTT  539

seq1  CTCTTTCTCCATCTTGTGTATAGGTCTAAGTCTGTGAACCTGTGTGTGTG  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTTCTCCATCTTGTGTATAGGTCTAAGTCTGTGAACCTGTGTGTGTG  589

seq1  CACATGTACAAACGTGAATAGGTTTTATATGTTTTTATTTTTCTCCACAA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATGTACAAACGTGAATAGGTTTTATATGTTTTTATTTTTCTCCACAA  639

seq1  TTTGGAATCTAGCAGCCTGTGTTTTTCCCCTGAGGATTTACCTCCCTAAC  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGAATCTAGCAGCCTGTGTTTTTCCCCTGAGGATTTACCTCCCTAAC  689

seq1  AGTTTCCAGGTGATGTGGGTCCCGAGGTCTGGTAGTTCCTACTTTAAATA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTCCAGGTGATGTGGGTCCCGAGGTCTGGTAGTTCCTACTTTAAATA  739

seq1  GCAATGTACTTTGAATATGTACTAACAATTGTCCATTCATTTGTATCCCT  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATGTACTTTGAATATGTACTAACAATTGTCCATTCATTTGTATCCCT  789

seq1  TGGGCAGATTATAAGGCTGTGGTGATGTATGGCCTCATCTCCACAATTAT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAGATTATAAGGCTGTGGTGATGTATGGCCTCATCTCCACAATTAT  839

seq1  GTGTAATAGCTGTCTATACAGTATTAGTTATCCAGAATTAGAATCCCTTT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTAATAGCTGTCTATACAGTATTAGTTATCCAGAATTAGAATCCCTTT  889

seq1  TATGAAAACAGGGGAAATACAATCACAGGTGTCTGGTGGGCAAAGACTTG  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAAAACAGGGGAAATACAATCACAGGTGTCTGGTGGGCAAAGACTTG  939

seq1  TAGCCTAAGGCTCTTGAGAACATACCTGGTTAGTGTGCTCTTCCAGCCCT  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCTAAGGCTCTTGAGAACATACCTGGTTAGTGTGCTCTTCCAGCCCT  989

seq1  ACTGAGTGAACACAGGGAGCCAGGGCACCTTCCATCTAGATGCCTAGCTT  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGTGAACACAGGGAGCCAGGGCACCTTCCATCTAGATGCCTAGCTT  1039

seq1  CTGGTGTTCTGGGGCCACGATAGCAAGTTTCCCAAGGTTAAGAAAATCCC  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTGTTCTGGGGCCACGATAGCAAGTTTCCCAAGGTTAAGAAAATCCC  1089

seq1  AGCATTTAGAATTC  1110
      ||||||||||||||
seq2  AGCATTTAGAATTC  1103

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information