MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-029D07
Chromosome	14 (Build37)
Map Location	7,963,120 - 8,192,245
singlet/doublet	doublet
Overlap gene	LOC100041791, LOC100042164, LOC100042182, LOC100041808, LOC100042192, LOC100042207, EG432817, LOC100042217, LOC100041830, LOC100042235, EG545013, EG666947
Upstream gene	LOC100041774, LOC100041530, LOC100041540, LOC100041840, EG666844, LOC666851, LOC100041569, LOC100041970, LOC100042000, EG666874, B930046C15Rik, LOC100041600, LOC100041958, LOC100041964, LOC546590, LOC666906, LOC100042024, LOC100041664, LOC100042077, LOC100041675, LOC666329, EG666833, LOC100042043, EG666918, LOC100041700, LOC100042054, LOC100042100, EG622781, LOC100041740, LOC100038847, LOC100042129, LOC100041770, LOC100042149, LOC544988, EG626456
Downstream gene	LOC623215, LOC100042286, LOC666957, LOC100042263, LOC100042258, LOC100042272, LOC100041874, LOC100042304, LOC100041881, LOC100042312, LOC100041893, ENSMUSG00000058570, EG666976, Flnb, Dnase1l3, Abhd6, Rpp14, Pxk, Pdhb, Kctd6, Acox2, BC055107, Oit1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 9 Proteins

name	LOC100041530 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 105 ESTs, 1 Protein pseudo : _no_value

name	LOC100041540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins

name	EG666844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666844 MGI:3646015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC666851 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100041569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC100041970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 24 ESTs, 8 Proteins

name	LOC100042000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	EG666874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666874 MGI:3647183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	B930046C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544998 MGI:2441866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	LOC100041600 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 1 Protein pseudo : _no_value

name	LOC100041964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 7 Proteins

name	LOC546590 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC666906 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 16 Proteins

name	LOC100042024 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein pseudo : _no_value

name	LOC100041664 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins

name	LOC100042077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC100041675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	LOC666329 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins

name	EG666833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666833 MGI:3647063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042043 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein pseudo : _no_value

name	EG666918 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 22 ESTs, 9 Proteins

name	LOC100041700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC100042054 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 13 Proteins

name	LOC100042100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 78 ESTs pseudo : _no_value

name	EG622781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622781 MGI:3646390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100038847 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042129 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 28 ESTs, 9 Proteins

name	LOC100041770 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042149 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 98 ESTs, 7 Proteins pseudo : _no_value

name	LOC544988 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:544988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	EG626456 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626456 MGI:3646103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 9 Proteins

name	LOC100041791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042164 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 57 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042182 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 9 Proteins

name	LOC100041808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042192 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 55 ESTs, 5 Proteins pseudo : _no_value

name	LOC100042207 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs

name	EG432817 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432817 MGI:3643775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 164 ESTs, 7 Proteins

name	LOC100042217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 9 ESTs, 10 Proteins

name	LOC100041830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 87 ESTs, 1 Protein pseudo : _no_value

name	EG545013 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545013 MGI:3646487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666947 MGI:3647524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 8 Proteins pseudo : _no_value

name	LOC623215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	LOC100042286 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC666957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100042263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 8 Proteins pseudo : _no_value

name	LOC100042258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100042272 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 1 Protein pseudo : _no_value

name	LOC100042304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 26 ESTs, 9 Proteins

name	LOC100041881 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100042312 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 96 ESTs, 7 Proteins pseudo : _no_value

name	LOC100041893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 39 ESTs

name	ENSMUSG00000058570 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218695 MGI:3641749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 9 Proteins

name	EG666976 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666976 MGI:3648154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 162 ESTs, 1 Protein pseudo : _no_value

name	Flnb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:286940 MGI:2446089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 336 ESTs, 18 Proteins

name	Dnase1l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13421 MGI:1314633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66082 MGI:1913332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67053 MGI:1914303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pxk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218699 MGI:1289230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdhb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68263 MGI:1915513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71393 MGI:1918643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93732 MGI:1934852
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC055107 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268709 MGI:3041256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oit1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18300 MGI:1201784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265033 GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 21 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477197.1

name	LOC100041774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265035 GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477217.1

name	LOC100041840 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265052 GeneID:100041840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477400.1

name	LOC100041569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264996 GeneID:100041569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical protein LOC100041569 transcript_id : XM_001476596.1

name	LOC100041970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265070 GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 7 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477506.1

name	LOC100041970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265068 GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477521.1

name	LOC100042000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265079 GeneID:100042000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001477589.1

name	B930046C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265074 GeneID:544998 MGI:2441866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : RIKEN cDNA B930046C15 gene transcript_id : XM_001477541.1

name	LOC100041964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265066 GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 6 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477474.1

name	LOC100041964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265064 GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477494.1

name	LOC546590 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265003 GeneID:546590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001476729.1

name	LOC666906 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265077 GeneID:666906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : similar to Predicted gene, EG432825 transcript_id : XM_986936.2

name	LOC100041664 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265009 GeneID:100041664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001476781.1

name	LOC100042077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265095 GeneID:100042077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001477712.1

name	LOC666329 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265094 GeneID:666329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins product : similar to 1700001E04Rik protein, transcript variant 5 transcript_id : XM_988676.2

name	EG666918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265087 GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 8 Proteins product : predicted gene, EG666918, transcript variant 3 transcript_id : XM_987009.2

name	EG666918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265083 GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 2 Proteins product : predicted gene, EG666918, transcript variant 1 transcript_id : XM_001477634.1

name	EG666918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265085 GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins product : predicted gene, EG666918, transcript variant 2 transcript_id : XM_001477643.1

name	LOC100041700 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265016 GeneID:100041700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001476859.1

name	LOC100042054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265092 GeneID:100042054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 12 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477672.1

name	LOC100042054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265090 GeneID:100042054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477653.1

name	LOC100042054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265088 GeneID:100042054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001477685.1

name	LOC100041740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265027 GeneID:100041740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476931.1

name	LOC100038847 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264824 GeneID:100038847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038847 transcript_id : XM_001471507.1

name	LOC100042129 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265103 GeneID:100042129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 26 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477746.1

name	LOC100042129 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265099 GeneID:100042129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477763.1

name	LOC100042129 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265101 GeneID:100042129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001477780.1

name	LOC100041770 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265031 GeneID:100041770
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476980.1

name	LOC544988 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:70608089 GeneID:544988
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC544988 transcript_id : NM_001024712.1

name	EG626456 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396501 GeneID:626456 MGI:3646103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 8 Proteins product : predicted gene, EG626456, transcript variant 2 transcript_id : XM_891048.2

name	EG626456 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265109 GeneID:626456 MGI:3646103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : predicted gene, EG626456, transcript variant 1 transcript_id : XM_001487799.1

name	LOC100041791 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265041 GeneID:100041791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041791 transcript_id : XM_001477011.1

name	LOC100042182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265114 GeneID:100042182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477839.1

name	LOC100042182 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265112 GeneID:100042182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477855.1

name	LOC100042207 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265118 GeneID:100042207
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs product : hypothetical protein LOC100042207 transcript_id : XM_001477897.1

name	EG432817 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265117 GeneID:432817 MGI:3643775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 164 ESTs, 7 Proteins product : predicted gene, EG432817 transcript_id : XM_484341.5

name	LOC100042217 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265124 GeneID:100042217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477911.1

name	LOC100042217 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265120 GeneID:100042217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477920.1

name	LOC100042217 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265122 GeneID:100042217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001477931.1

name	EG545013 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803196 GeneID:545013 MGI:3646487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545013 transcript_id : NM_001025085.2

name	LOC623215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396581 GeneID:623215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_354854.5

name	LOC100042286 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265132 GeneID:100042286
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001478055.1

name	LOC100042304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265138 GeneID:100042304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001478071.1

name	LOC100042304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265134 GeneID:100042304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001478082.1

name	LOC100042304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265136 GeneID:100042304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001478100.1

name	LOC100041881 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265056 GeneID:100041881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001477168.1

name	LOC100041893 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265058 GeneID:100041893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 39 ESTs product : hypothetical protein LOC100041893 transcript_id : XM_001477177.1

name	ENSMUSG00000058570 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265060 GeneID:218695 MGI:3641749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 9 Proteins product : predicted gene, ENSMUSG00000058570 transcript_id : XM_001477203.1

name	Flnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265147 GeneID:286940 MGI:2446089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 308 ESTs, 13 Proteins product : filamin, beta, transcript variant 6 transcript_id : XM_990154.2

name	Flnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265145 GeneID:286940 MGI:2446089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 331 ESTs, 17 Proteins product : filamin, beta transcript_id : XM_001478141.1

name	Flnb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265143 GeneID:286940 MGI:2446089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 336 ESTs, 16 Proteins product : filamin, beta transcript_id : XM_001478129.1

name	Dnase1l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490434 GeneID:13421 MGI:1314633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease 1-like 3 transcript_id : NM_007870.3

name	Abhd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130362 GeneID:66082 MGI:1913332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 6 transcript_id : NM_025341.3

name	Rpp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357090 GeneID:67053 MGI:1914303
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease P 14 subunit (human) transcript_id : NM_025938.2

name	Pxk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803276 GeneID:218699 MGI:1289230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PX domain containing serine/threonine kinase transcript_id : NM_145458.2

name	Pxk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72535127 GeneID:218699 MGI:1289230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PX domain containing serine/threonine kinase transcript_id : NM_178279.1

name	Pdhb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110227587 GeneID:68263 MGI:1915513
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyruvate dehydrogenase (lipoamide) beta transcript_id : NM_024221.3

name	Kctd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29789206 GeneID:71393 MGI:1918643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 6 transcript_id : NM_027782.1

name	Acox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716410 GeneID:93732 MGI:1934852
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A oxidase 2, branched chain transcript_id : NM_053115.1

name	BC055107 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130726 GeneID:268709 MGI:3041256
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC055107 transcript_id : NM_183187.3

name	Oit1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129790 GeneID:18300 MGI:1201784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oncoprotein induced transcript 1 transcript_id : NM_146050.2

name	LOC100041774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265036 GeneID:100041774
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477267.1

name	LOC100041774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265034 GeneID:100041774
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477247.1

name	LOC100041840 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265053 GeneID:100041840
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477450.1

name	LOC100041569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264997 GeneID:100041569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476646.1

name	LOC100041970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265069 GeneID:100041970
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477571.1

name	LOC100041970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265071 GeneID:100041970
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477556.1

name	LOC100042000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265080 GeneID:100042000
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477639.1

name	B930046C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265075 GeneID:544998 MGI:2441866
definition	codon_start : 1 product : hypothetical protein LOC544998 protein_id : XP_001477591.1

name	LOC100041964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265065 GeneID:100041964
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477544.1

name	LOC100041964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265067 GeneID:100041964
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477524.1

name	LOC546590 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265004 GeneID:546590
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476779.1

name	LOC666906 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265078 GeneID:666906
definition	codon_start : 1 product : similar to Predicted gene, EG432825 protein_id : XP_992030.2

name	LOC100041664 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265010 GeneID:100041664
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001476831.1

name	LOC100042077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265096 GeneID:100042077
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477762.1

name	LOC666329 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396484 GeneID:666329
definition	codon_start : 1 product : similar to 1700001E04Rik protein isoform 5 protein_id : XP_993770.1

name	EG666918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265084 GeneID:666918 MGI:3648195
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477684.1

name	EG666918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265086 GeneID:666918 MGI:3648195
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477693.1

name	EG666918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396578 GeneID:666918 MGI:3648195
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_992103.1

name	LOC100041700 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265017 GeneID:100041700
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476909.1

name	LOC100042054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265089 GeneID:100042054
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001477735.1

name	LOC100042054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265091 GeneID:100042054
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477703.1

name	LOC100042054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265093 GeneID:100042054
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477722.1

name	LOC100041740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265028 GeneID:100041740
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476981.1

name	LOC100038847 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264825 GeneID:100038847
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471557.1

name	LOC100042129 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265100 GeneID:100042129
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477813.1

name	LOC100042129 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265102 GeneID:100042129
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001477830.1

name	LOC100042129 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265104 GeneID:100042129
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477796.1

name	LOC100041770 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265032 GeneID:100041770
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477030.1

name	EG626456 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265110 GeneID:626456 MGI:3646103
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001487849.1

name	EG626456 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82953098 GeneID:626456 MGI:3646103
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_896141.1

name	LOC100041791 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265042 GeneID:100041791
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477061.1

name	LOC100042182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265113 GeneID:100042182
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477905.1

name	LOC100042182 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265115 GeneID:100042182
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477889.1

name	LOC100042207 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265119 GeneID:100042207
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477947.1

name	EG432817 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63660228 GeneID:432817 MGI:3643775
definition	codon_start : 1 product : similar to sid478p protein_id : XP_484341.2

name	LOC100042217 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265121 GeneID:100042217
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477970.1

name	LOC100042217 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265123 GeneID:100042217
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001477981.1

name	LOC100042217 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265125 GeneID:100042217
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477961.1

name	EG545013 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68226435 GeneID:545013 MGI:3646487
definition	codon_start : 1 product : hypothetical protein LOC545013 protein_id : NP_001020256.1

name	LOC623215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82953030 GeneID:623215
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_354854.4

name	LOC100042286 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265133 GeneID:100042286
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001478105.1

name	LOC100042304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265135 GeneID:100042304
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001478132.1

name	LOC100042304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265137 GeneID:100042304
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001478150.1

name	LOC100042304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265139 GeneID:100042304
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001478121.1

name	LOC100041881 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265057 GeneID:100041881
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477218.1

name	LOC100041893 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265059 GeneID:100041893
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477227.1

name	ENSMUSG00000058570 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265061 GeneID:218695 MGI:3641749
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477253.1

name	Flnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265148 GeneID:286940 MGI:2446089
definition	codon_start : 1 product : filamin B, beta isoform 6 protein_id : XP_995248.2

name	Flnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265146 GeneID:286940 MGI:2446089
definition	codon_start : 1 product : filamin B, beta protein_id : XP_001478191.1

name	Flnb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265144 GeneID:286940 MGI:2446089
definition	codon_start : 1 product : filamin B, beta protein_id : XP_001478179.1

name	Dnase1l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490435 CCDS:CCDS26807.1 GeneID:13421 MGI:1314633
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006308 - DNA catabolism [Evidence IEA]; GO:0006309 - DNA fragmentation during apoptosis [Evidence IDA] codon_start : 1 note : DNase gamma; liver and spleen DNase; LS-DNase; macrophage specific DNase I product : deoxyribonuclease 1-like 3 precursor protein_id : NP_031896.3

name	Abhd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560264 CCDS:CCDS26808.1 GeneID:66082 MGI:1913332
definition	GO_function : GO:0004301 - epoxide hydrolase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : abhydrolase domain containing 6 protein_id : NP_079617.2

name	Rpp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385432 CCDS:CCDS26809.1 GeneID:67053 MGI:1914303
definition	GO_function : GO:0004540 - ribonuclease activity [Evidence IEA] codon_start : 1 product : ribonuclease P 14kDa subunit protein_id : NP_080214.1

name	Pxk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703910 CCDS:CCDS26810.1 GeneID:218699 MGI:1289230
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence ISS]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0050804 - regulation of synaptic transmission [Evidence IEP] codon_start : 1 exception : mismatches in translation note : long isoform is encoded by transcript variant L; modulator of Na,K-ATPase product : PX domain containing serine/threonine kinase long isoform protein_id : NP_663433.1

name	Pxk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72535128 GeneID:218699 MGI:1289230
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence ISS]; GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0050804 - regulation of synaptic transmission [Evidence IEP] codon_start : 1 note : short isoform is encoded by transcript variant S; modulator of Na,K-ATPase product : PX domain containing serine/threonine kinase short isoform protein_id : NP_840063.1

name	Pdhb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18152793 GeneID:68263 MGI:1915513
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] codon_start : 1 product : pyruvate dehydrogenase (lipoamide) beta protein_id : NP_077183.1

name	Kctd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789207 CCDS:CCDS26812.1 GeneID:71393 MGI:1918643
definition	GO_function : GO:0005216 - ion channel activity [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 6 protein_id : NP_082058.1

name	Acox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716411 GeneID:93732 MGI:1934852
definition	GO_component : GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0003997 - acyl-CoA oxidase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006635 - fatty acid beta-oxidation [Evidence IEA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : acyl-Coenzyme A oxidase 2, branched chain protein_id : NP_444345.1

name	BC055107 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147238 CCDS:CCDS26813.1 GeneID:268709 MGI:3041256
definition	codon_start : 1 product : downregulated in renal cell carcinoma protein_id : NP_899010.1

name	Oit1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164770 GeneID:18300 MGI:1201784
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0005125 - cytokine activity [Evidence ISS] GO_process : GO:0046676 - negative regulation of insulin secretion [Evidence ISS] codon_start : 1 product : oncoprotein induced transcript 1 protein_id : NP_666162.1

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 4 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 3 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 2 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 1 pseudo : _no_value

name	EG666844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666844
definition	number : 1 pseudo : _no_value

name	LOC666851 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666851
definition	number : 1 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 1 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 2 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 3 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 4 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 1 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 2 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 3 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 4 pseudo : _no_value

name	EG622781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622781
definition	number : 5 pseudo : _no_value

name	EG622781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622781
definition	number : 4 pseudo : _no_value

name	EG622781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622781
definition	number : 3 pseudo : _no_value

name	EG622781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622781
definition	number : 2 pseudo : _no_value

name	EG622781 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622781
definition	number : 1 pseudo : _no_value

name	LOC100041808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041808
definition	number : 1 pseudo : _no_value

name	LOC100041808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041808
definition	number : 2 pseudo : _no_value

name	LOC100041808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041808
definition	number : 3 pseudo : _no_value

name	LOC100041830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041830
definition	number : 1 pseudo : _no_value

name	LOC100041830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041830
definition	number : 2 pseudo : _no_value

name	LOC666957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666957
definition	number : 1 pseudo : _no_value

name	LOC100041530 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264993 GeneID:100041530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 105 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032805.1

name	EG666874 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264998 GeneID:666874 MGI:3647183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : predicted gene, EG666874 pseudo : _no_value transcript_id : XR_001934.2

name	LOC100041958 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265063 GeneID:100041958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 1 Protein product : hypothetical protein LOC100041958 pseudo : _no_value transcript_id : XR_033237.1

name	LOC100042024 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265081 GeneID:100042024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein product : hypothetical protein LOC100042024 pseudo : _no_value transcript_id : XR_033294.1

name	LOC100041675 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265011 GeneID:100041675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to ribosomal protein L3 pseudo : _no_value transcript_id : XR_032924.1

name	LOC100042043 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265082 GeneID:100042043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein product : hypothetical protein LOC100042043 pseudo : _no_value transcript_id : XR_033305.1

name	LOC100042100 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265098 GeneID:100042100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 78 ESTs product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033371.1

name	LOC100042149 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265108 GeneID:100042149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 98 ESTs, 7 Proteins product : hypothetical protein LOC100042149 pseudo : _no_value transcript_id : XR_033392.1

name	LOC100042164 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265111 GeneID:100042164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 57 ESTs, 5 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033407.1

name	LOC100042192 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265116 GeneID:100042192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 55 ESTs, 5 Proteins product : similar to LOC100036568 protein pseudo : _no_value transcript_id : XR_033427.1

name	LOC100042235 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265126 GeneID:100042235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 87 ESTs, 1 Protein product : hypothetical protein LOC100042235 pseudo : _no_value transcript_id : XR_033465.1

name	EG666947 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265127 GeneID:666947 MGI:3647524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 8 Proteins product : predicted gene, EG666947 pseudo : _no_value transcript_id : XR_033488.1

name	LOC100042263 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265129 GeneID:100042263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 8 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033507.1

name	LOC100042258 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265128 GeneID:100042258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : hypothetical protein LOC100042258 pseudo : _no_value transcript_id : XR_033500.1

name	LOC100042272 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265130 GeneID:100042272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 8 Proteins product : similar to Predicted gene, EG545013 pseudo : _no_value transcript_id : XR_033515.1

name	LOC100041874 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265055 GeneID:100041874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033080.1

name	LOC100042312 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265140 GeneID:100042312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 96 ESTs, 7 Proteins product : hypothetical protein LOC100042312 pseudo : _no_value transcript_id : XR_033544.1

name	EG666976 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396582 GeneID:666976 MGI:3648154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 162 ESTs, 1 Protein product : predicted gene, EG666976 pseudo : _no_value transcript_id : XR_001954.1

clone name	MSMg01-500I03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088O14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-029D07.b	B6Ng01-029D07.g
ACC	DH859471	DH859472
length	1,191	677
definition	DH859471\|Mus musculus domesticus DNA, BAC clone: B6Ng01-029D07, 5' end.	DH859472\|Mus musculus domesticus DNA, BAC clone: B6Ng01-029D07, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(7,963,120 - 7,964,338)	(8,191,571 - 8,192,245)
sequence	gaattctgtaaccaaaggtgtgctctataatggctcaccaatggagatct caaagtaacagtaataaaaaggaattcgtgagcagcaggggagaaatatt tgaaaatctaaaacactaaagaaagtcaaggaactttttatgaaccaaat gagacaatgtgctatgtatttgaaattgtagtaggcattttgagaaatag attttgatgcaggagacctgccataaattccaagtcagattgggcctgag gtatgctagaggactccctcaaaacaaagaaacacactgaacaaagaaaa gacaagtggatgtcccttaggtcagagaaccactgtgaaagctttgaact aggagaagtagttagtaggtcagatactattttaaattggggattccttg aaagtttctcagaagccatgatctttcaccagggttttcccctgagctgc ctttagtgggaaatgaggcagctttcctttctttgcctacacagtatttc cacccatcctgggtttcctctacagctgcagatgctgtagagttgcagtc atttacttagcaggaaccagcttagactggctttgcttttcaaagttaca ggccttaggagctggctactgaattctgtgttgatcagagcgggctgcaa agctaggtttttataagtaagatacctgcactttaaggaattaattgcct ggctcctggatgtgaagctgtgcaatgtgtctttaagcaatcagcatcct ttgaaagagtaataaatggaacccgtattcttcaccaaataggcatgggc cttagaccacctttcacttcagtcacccttgactggattctgggacatgt tgctatataaaacctgaaagtacggcttttgagatggctcaatggggaag ggcactgactgttcttccaaggtcctgagttcaaatcccagtaacacatg gtggctcacagccatccctaacgagatcttgacttcctcttctgatatgt ctgaagacgctacagtgtacttacatataataaataatatcctttaaaaa atctggaagttaatgtgtggctggaatacgatactggccaagtgactttt cctctatagagttgtggggaagaacattagatctatatcacatttgttca ctggccttgcctcttaattaaaggaagttgaactgggttag	gaattcttgtagggtcagatttttaactgactagagacaaaactattgat tctcattgaaatctttagagcaaatgtaagggatatggtatatggaggta aggaggacattgctgtataaaatccttgtgtttatgacctttttctgctc ttggtgaattgtgaaggaccactgggaggtcaggtggctcactgtgtctt ctaagcattccaggttgttttcctcattgcctgccaccattacatttcct gctacctctgctcagtaaagctttgccttgtagtttgtcttggattttac tcattgagagattgagttgcttggagctgaacttgcatccagcagaattc ccatagctgtggagcaaaccaggcctgtttcaggagcccattgagggtct tgataatctaaagaactcacactatcttatctgtgtagatattcagcatg actgttcttcaacatcattttgtcagagttaaaatcagcctcagtggggg ttgggagaaatgaggacatacattccaagaactcaaaaaggtcaacaaac tgaagtgcccaagtaaggacgccttattcccacctgggagagagaagaaa gcaatcaccagtgggagaaggagggaaggacctgggagggaaagtgacag gggacagtgggggagttggggagagaa
quality values	Open. Hide. 61 43 35 27 61 61 47 31 50 55 55 61 37 23 55 55 61 47 43 49 47 47 61 61 61 18 15 26 12 13 17 28 19 20 27 33 52 59 59 38 59 61 61 61 59 59 59 59 61 61 59 59 61 61 61 59 59 59 61 59 59 61 61 61 61 61 61 61 61 59 52 59 44 28 35 50 43 35 39 61 61 59 61 59 52 61 61 59 61 61 55 34 61 61 61 61 61 61 59 55 55 59 61 61 59 59 61 61 61 59 52 52 52 59 52 43 59 49 61 61 61 61 61 59 59 59 59 49 59 61 59 59 59 59 59 59 61 61 61 59 61 49 59 49 36 37 38 52 59 61 61 61 59 61 59 59 59 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 55 44 59 61 61 61 59 61 61 61 59 43 61 59 49 59 59 59 59 55 55 59 61 61 61 61 59 52 61 61 59 55 59 59 59 59 52 49 38 33 61 59 43 59 59 44 59 59 55 59 52 59 59 61 59 59 59 59 59 52 59 59 59 61 59 52 61 59 59 61 59 59 52 59 59 59 61 59 61 59 61 61 61 61 61 61 59 59 41 55 44 59 59 37 37 59 59 59 45 49 59 59 59 59 59 61 61 59 59 59 59 49 59 45 59 59 59 61 61 61 61 61 61 61 61 61 61 59 52 61 59 52 59 61 61 61 61 61 59 59 59 52 59 59 59 52 61 52 61 59 59 59 52 61 49 59 59 59 59 49 59 59 61 61 59 61 59 59 52 59 59 44 61 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 45 59 49 52 52 41 61 59 52 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 59 61 59 59 59 59 59 59 59 59 59 37 59 59 45 59 59 49 59 59 59 59 59 59 59 59 59 52 59 59 52 45 61 61 61 59 59 59 59 50 59 59 52 59 59 52 59 52 59 49 52 52 52 61 61 59 61 61 55 55 61 59 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 59 59 59 61 59 59 59 59 52 59 52 43 59 52 59 59 59 59 61 61 52 41 52 52 43 52 52 52 43 55 52 52 52 61 61 61 52 52 49 52 52 49 52 52 43 52 43 43 49 52 52 52 41 36 55 52 55 52 50 52 61 61 52 61 61 49 52 52 52 39 37 49 52 43 50 49 43 34 49 49 49 55 49 55 55 49 55 50 49 41 49 43 35 49 50 50 47 35 61 55 55 61 47 55 61 55 55 55 55 55 55 50 50 38 35 38 38 61 37 34 29 43 27 29 50 31 49 37 37 61 43 47 61 50 50 50 53 53 45 50 50 50 50 53 61 41 38 50 50 37 47 50 61 61 61 61 47 61 43 53 43 61 50 52 42 45 47 33 43 42 39 27 28 35 50 61 53 45 53 43 40 61 50 50 61 50 50 50 61 50 53 61 61 50 61 39 39 43 35 35 42 33 24 27 43 45 38 30 39 40 61 43 33 16 53 50 61 31 43 47 39 43 45 43 34 19 31 30 28 27 30 57 39 30 53 47 47 38 42 30 38 43 40 31 28 26 27 28 47 57 50 50 43 29 40 45 40 28 28 14 28 23 23 36 35 21 11 25 16 23 30 28 27 23 53 53 42 57 53 27 53 21 23 25 26 25 21 20 41 31 47 47 38 30 22 16 23 20 25 45 29 33 37 36 39 30 25 17 20 24 32 39 32 25 24 33 20 14 16 46 34 16 11 25 45 45 33 8 43 32 42 36 31 32 42 43 9 12 22 38 27 29 17 10 8 12 34 24 22 34 37 33 42 34 25 24 37 33 35 50 35 30 21 21 52 38 35 16 23 30 30 38 19 19 20 23 35 30 30 33 30 16 29 26 30 31 19 18 30 30 53 19 14 22 22 24 19 33 14 21 57 57 31 18 31 16 37 22 33 21 13 30 29 37 10 12 37 45 45 30 31 23 23 53 53 18 29 35 30 23 14 13 25 43 20 22 25 13 32 25 19 10 20 16 44 11 12 30 20 29 31 12 24 27 18 15 20 6 17 16 16 18 5 6 4 9 5 29 16 15 12 16 17 30 14 28 21 20 27 14 5 10 29 14 29 28 13 24 13 31 29 26 29 21 15 6 25 5 11 12 9 10 8 14 21 12 30 7 20 10 9 15 8 36 14 21 13 28 9 11 6 18 11 18 24 24 30 20 16 11 6 7 8 26 12 12 7 18 10 12 20 29 17 19 39 11 22 6 7 5 8 19 14 24 16 51 31 28 25 16 5 8 6 9 15 28 30 28 31 43 29 29 29 24 5 26 17 13 10 26 24 11 22 31 10 24 13 15 6 13 6 29 32 5 21 9 9 16 18 19 14 6 16 7 5 5 6 13 8 6 13 7 17 10 6 5 10 10 28 6 19 14 5 7 9 15 14 9 11 8 5 9 28 12 14 6 10 6 16 30 30 8 28 11 8 23 24 5 10 10 15 15 8 33 5 10 6 4 5 9 11 7 5 6 20 20 37 7 15 15 5 4 1 4 6 6 6 4 3 4 8 4 3 4 11 7 10 7 4 4 7 15 7 30 7 4 14 25 25 4 3 5 5 4 18 5 5 11 7 5 4 5 5 22	Open. Hide. 55 61 52 49 43 28 25 27 19 20 12 12 28 20 22 59 59 52 59 61 61 61 59 59 59 59 59 61 61 61 61 61 59 59 61 59 61 61 61 59 59 59 59 61 59 61 61 61 61 59 59 59 43 37 36 52 59 61 61 61 61 61 61 61 61 61 61 49 61 59 59 59 59 61 59 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 55 55 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 59 59 61 59 59 59 59 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 59 59 52 59 59 61 61 61 59 59 61 59 61 59 59 61 59 61 59 59 59 59 59 59 61 61 59 61 59 59 59 59 59 59 59 59 49 59 52 59 59 55 59 49 59 61 61 61 61 61 59 59 59 59 59 59 59 49 59 61 61 59 59 59 61 59 59 49 59 59 49 59 59 59 61 59 61 59 59 52 59 52 59 44 52 45 50 43 52 52 59 59 59 59 59 59 43 52 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 59 59 59 61 52 59 59 59 59 59 59 59 59 59 49 59 61 61 61 59 61 59 59 44 59 61 61 61 59 59 59 59 59 59 61 52 61 49 59 59 36 59 49 49 49 49 59 52 45 59 52 52 45 43 59 59 38 61 49 59 59 43 49 52 45 59 52 36 44 59 59 59 61 59 61 59 59 59 59 59 59 59 59 28 45 36 49 52 59 52 52 59 52 49 37 55 52 28 37 36 36 39 49 61 61 59 59 59 59 59 59 59 59 61 61 61 52 59 59 59 59 59 59 61 43 59 52 49 52 52 39 45 43 49 49 49 59 59 59 39 49 45 41 45 49 61 61 61 55 55 61 61 61 61 61 59 59 59 59 59 49 52 59 49 52 52 43 45 43 43 37 52 49 52 41 38 43 37 36 43 61 61 61 43 28 30 18 13 52 52 61 61 61 61 59 52 52 52 28 20 31 36 36 36 39 35 52 61 61 55 55 55 52 52 55 52 52 61 49 61 61 55 47 55 61 28 43 52 37 30 49 36 43 24 36 37 30 28 25 28 28 52 32 19 23 19 11 15 11 49 50 49 55 43 40 43 49 49 37 43 50 50 50 49 43 41 41 38 43 37 43 43 37 31 49 38 18 55 21 49 36 29 15 27 39 50 49 50 23 35 31 28 21 19 16 26 30 24 50 50 47 36 53 40 47 36 45 32 31 50 35 32 16 18 10 8 20 31 12 16 19 8 10 23 50 39 36 47 35 52 39 12 29 21 10 16 18 52 52 10 24 24 15 12 23 24 17 13 50 10 61 38 50 42 36 35 40 45 38 45 31 31 27 42 13 31 27 13 15 24 39 14 27 16 24 34 20 21 19 27 17 17 20 21 30 43 10 13 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_7963120_7964338
seq2: B6Ng01-029D07.b_45_1235

seq1  GAATTCTGTAACCAAAGGTGTGCTCTATAATGGCTCACCAATGGAGATCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTAACCAAAGGTGTGCTCTATAATGGCTCACCAATGGAGATCT  50

seq1  CAAAGTAACAGTAATAAAAAGGAATTCGTGAGCAGCAGGGGAGAAATATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGTAACAGTAATAAAAAGGAATTCGTGAGCAGCAGGGGAGAAATATT  100

seq1  TGAAAATCTAAAACACTAAAGAAAGTCAAGGAACTTTTTATGAACCAAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAATCTAAAACACTAAAGAAAGTCAAGGAACTTTTTATGAACCAAAT  150

seq1  GAGACAATGTGCTATGTATTTGAAATTGTAGTAGGCATTTTGAGAAATAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACAATGTGCTATGTATTTGAAATTGTAGTAGGCATTTTGAGAAATAG  200

seq1  ATTTTGATGCAGGAGACCTGCCATAAATTCCAAGTCAGATTGGGCCTGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTGATGCAGGAGACCTGCCATAAATTCCAAGTCAGATTGGGCCTGAG  250

seq1  GTATGCTAGAGGACTCCCTCAAAACAAAGAAACACACTGAACAAAGAAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGCTAGAGGACTCCCTCAAAACAAAGAAACACACTGAACAAAGAAAA  300

seq1  GACAAGTGGATGTCCCTTAGGTCAGAGAACCACTGTGAAAGCTTTGAACT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAGTGGATGTCCCTTAGGTCAGAGAACCACTGTGAAAGCTTTGAACT  350

seq1  AGGAGAAGTAGTTAGTAGGTCAGATACTATTTTAAATTGGGGATTCCTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAAGTAGTTAGTAGGTCAGATACTATTTTAAATTGGGGATTCCTTG  400

seq1  AAAGTTTCTCAGAAGCCATGATCTTTCACCAGGGTTTTCCCCTGAGCTGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTTTCTCAGAAGCCATGATCTTTCACCAGGGTTTTCCCCTGAGCTGC  450

seq1  CTTTAGTGGGAAATGAGGCAGCTTTCCTTTCTTTGCCTACACAGTATTTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGTGGGAAATGAGGCAGCTTTCCTTTCTTTGCCTACACAGTATTTC  500

seq1  CACCCATCCTGGGTTTCCTCTACAGCTGCAGATGCTGTAGAGTTGCAGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCATCCTGGGTTTCCTCTACAGCTGCAGATGCTGTAGAGTTGCAGTC  550

seq1  ATTTACTTAGCAGGAACCAGCTTAGACTGGCTTTGCTTTTCAAAGTTACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTACTTAGCAGGAACCAGCTTAGACTGGCTTTGCTTTTCAAAGTTACA  600

seq1  GGCCTTAGGAGCTGGCTACTGAATTCTGTGTTGATCAGAGCGGGCTGCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCTTAGGAGCTGGCTACTGAATTCTGTGTTGATCAGAGCGGGCTGCAA  650

seq1  AGCTAGGTTTTTATAAGTAAGATACCTGCACTTTAAGGAATTAATTGCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAGGTTTTTATAAGTAAGATACCTGCACTTTAAGGAATTAATTGCCT  700

seq1  GGCTCCTGGATGTGAAGCTGTGCAATGTGTCTTTAAGCAATCAGCATCCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCCTGGATGTGAAGCTGTGCAATGTGTCTTTAAGCAATCAGCATCCT  750

seq1  TTGAAAGAGTAATAAATGGAACCCGTATTCTTCACCAAATAGGCATGGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAGAGTAATAAATGGAACCCGTATTCTTCACCAAATAGGCATGGGC  800

seq1  CTTAGACCACCTTTCACTTCAGTCACCCTTGACTGGATTCTGGGACATGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGACCACCTTTCACTTCAGTCACCCTTGACTGGATTCTGGGACATGT  850

seq1  TGCTATATAAAACCTGAAAGTACGGCTTTTGAGATGGCTCAATGGGGAAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATATAAAACCTGAAAGTACGGCTTTTGAGATGGCTCAATGGGGAAG  900

seq1  GGCACTGACTGTTCTTCCAAAGGTCCTGAGTTCAAATCCCAGTAACCACA  950
      |||||||||||||||||| |||||||||||||||||||||||||| ||||
seq2  GGCACTGACTGTTCTTCC-AAGGTCCTGAGTTCAAATCCCAGTAA-CACA  948

seq1  TGGTGGCTCACAGCCATCCCTAACGAGATC-TGACTTCCTCTTCTGATAT  999
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TGGTGGCTCACAGCCATCCCTAACGAGATCTTGACTTCCTCTTCTGATAT  998

seq1  GTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTT  1049
      |||||||||| ||||||||||||||||||||||||||||   | ||| ||
seq2  GTCTGAAGAC-GCTACAGTGTACTTACATATAATAAATA---ATATCCTT  1044

seq1  AAAAAAACCTGAAAGTTTAATGTGTGGGTTGAAATACAGGATAGCTGCCA  1099
       |||||| ||| ||| ||||||||| || || |||||  |||| ||| | 
seq2  TAAAAAATCTGGAAG-TTAATGTGT-GGCTGGAATAC--GATA-CTGGCC  1089

seq1  AAGTGACCTTTCACTCTATAGAG-TGTGGGGAAGAGAACATTAGAATCAT  1148
      ||||||| |||| |||||||||| ||||||||  |||||||||| |||  
seq2  AAGTGACTTTTC-CTCTATAGAGTTGTGGGGA--AGAACATTAG-ATCTA  1135

seq1  AATCACATTTTGGTCCCAGCTTGTGCCCTCTGTCTTCTTTACATTAAAAG  1198
       |||||| |||| || |      || ||| || | ||||   | | ||||
seq2  TATCACA-TTTGTTCAC------TGGCCT-TG-CCTCTT---AATTAAAG  1173

seq1  GAAAAGTCTGAACTGGGTTAG  1219
      |  |||| |||||||||||||
seq2  G--AAGT-TGAACTGGGTTAG  1191

seq1: chr14_8191571_8192245
seq2: B6Ng01-029D07.g_67_743 (reverse)

seq1  TTCTCTCCCCAACT-CCCCACTGT-CCCTGTCACTTTCCCTCCCAGGTCC  48
      |||||||||||||| ||||||||| |||||||||||||||||||||||||
seq2  TTCTCTCCCCAACTCCCCCACTGTCCCCTGTCACTTTCCCTCCCAGGTCC  50

seq1  TTCCCTCCTTCTCCCACTGGTGATTGCTTTCTTCTCTCTCCCAGGTGGGA  98
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCTCCTTCTCCCACTGGTGATTGCTTTCTTCTCTCTCCCAGGTGGGA  100

seq1  ATAAGGCGTCCTTACTTGGGCACTTCAGTTTGTTGACCTTTTTGAGTTCT  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGCGTCCTTACTTGGGCACTTCAGTTTGTTGACCTTTTTGAGTTCT  150

seq1  TGGAATGTATGTCCTCATTTCTCCCAACCCCCACTGAGGCTGATTTTAAC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATGTATGTCCTCATTTCTCCCAACCCCCACTGAGGCTGATTTTAAC  200

seq1  TCTGACAAAATGATGTTGAAGAACAGTCATGCTGAATATCTACACAGATA  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGACAAAATGATGTTGAAGAACAGTCATGCTGAATATCTACACAGATA  250

seq1  AGATAGTGTGAGTTCTTTAGATTATCAAGACCCTCAATGGGCTCCTGAAA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATAGTGTGAGTTCTTTAGATTATCAAGACCCTCAATGGGCTCCTGAAA  300

seq1  CAGGCCTGGTTTGCTCCACAGCTATGGGAATTCTGCTGGATGCAAGTTCA  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCCTGGTTTGCTCCACAGCTATGGGAATTCTGCTGGATGCAAGTTCA  350

seq1  GCTCCAAGCAACTCAATCTCTCAATGAGTAAAATCCAAGACAAACTACAA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCAAGCAACTCAATCTCTCAATGAGTAAAATCCAAGACAAACTACAA  400

seq1  GGCAAAGCTTTACTGAGCAGAGGTAGCAGGAAATGTAATGGTGGCAGGCA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAAGCTTTACTGAGCAGAGGTAGCAGGAAATGTAATGGTGGCAGGCA  450

seq1  ATGAGGAAAACAACCTGGAATGCTTAGAAGACACAGTGAGCCACCTGACC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGAAAACAACCTGGAATGCTTAGAAGACACAGTGAGCCACCTGACC  500

seq1  TCCCAGTGGTCCTTCACAATTCACCAAGAGCAGAAAAAGGTCATAAACAC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGTGGTCCTTCACAATTCACCAAGAGCAGAAAAAGGTCATAAACAC  550

seq1  AAGGATTTTATACAGCAATGTCCTCCTTACCTCCATATACCATATCCCTT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGATTTTATACAGCAATGTCCTCCTTACCTCCATATACCATATCCCTT  600

seq1  ACATTTGCTCTAAAGATTTCAATGAGAATCAATAGTTTTGTCTCTAGTCA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTTGCTCTAAAGATTTCAATGAGAATCAATAGTTTTGTCTCTAGTCA  650

seq1  GTTAAAAATCTGACCCTACAAGAATTC  675
      |||||||||||||||||||||||||||
seq2  GTTAAAAATCTGACCCTACAAGAATTC  677

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information