MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-065M19
Chromosome	14 (Build37)
Map Location	34,791,789 - 34,792,785
singlet/doublet	singlet
Overlap gene	Zfp488
Upstream gene	Lrrc18, EG622657, Arhgap22, Mapk8, LOC100040079, LOC665681, Frmpd2, LOC100040093, Ptpn20, Gdf10, Gdf2, Rbp3
Downstream gene	EG665754, EG432838, Antxrl, Anxa8, LOC100041131, LOC665768, Ppyr1, LOC100041163, Gprin2, Syt15, 3110001K24Rik, LOC623142, Glud1, LOC100041231, 2200001I15Rik, Sncg, Mmrn2, Bmpr1a, 9230112D13Rik, LOC665834, Ldb3, Opn4, 5830448L01Rik, Wapal, LOC100041341, Grid1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lrrc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67580 MGI:1914830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622657 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622657 MGI:3643354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	Arhgap22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239027 MGI:2443418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapk8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26419 MGI:1346861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein

name	LOC665681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	Frmpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268729 MGI:2685472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	LOC100040093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Ptpn20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19256 MGI:1196295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14560 MGI:95684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12165 MGI:1321394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19661 MGI:97878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382867 MGI:2686052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665754 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665754 MGI:3649114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG432838 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432838 MGI:3643519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Antxrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239029 MGI:1925726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Anxa8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11752 MGI:1201374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041131 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC665768 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665768
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ppyr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19065 MGI:105374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041163 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1104 ESTs, 9 Proteins

name	Gprin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432839 MGI:2444560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Syt15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319508 MGI:2442166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	3110001K24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75698 MGI:1922948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623142 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623142
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Glud1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14661 MGI:95753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041231 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins

name	2200001I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69134 MGI:1916384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sncg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20618 MGI:1298397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmrn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105450 MGI:2385618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmpr1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12166 MGI:1338938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9230112D13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78243 MGI:1925493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC665834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	Ldb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 7 mRNAs

name	Opn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30044 MGI:1353425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830448L01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76031 MGI:1923281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Wapal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218914 MGI:2675859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041341 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs

name	Grid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14803 MGI:95812
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742873 GeneID:67580 MGI:1914830
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 18 transcript_id : NM_026253.3

name	EG622657 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265417 GeneID:622657 MGI:3643354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : predicted gene, EG622657 transcript_id : XM_887100.3

name	Arhgap22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802510 GeneID:239027 MGI:2443418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 22 transcript_id : NM_153800.3

name	Mapk8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378811 GeneID:26419 MGI:1346861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 8 transcript_id : NM_016700.3

name	LOC100040079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265375 GeneID:100040079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 1 Protein product : similar to Mapk6 protein transcript_id : XM_001474049.1

name	Frmpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265423 GeneID:268729 MGI:2685472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : FERM and PDZ domain containing 2 transcript_id : XM_001481294.1

name	LOC100040093 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265377 GeneID:100040093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100040093 transcript_id : XM_001474080.1

name	Ptpn20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130575 GeneID:19256 MGI:1196295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 20 transcript_id : NM_008978.2

name	Gdf10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254186 GeneID:14560 MGI:95684
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 10 transcript_id : NM_145741.2

name	Gdf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130679 GeneID:12165 MGI:1321394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 2 transcript_id : NM_019506.4

name	Rbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892245 GeneID:19661 MGI:97878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol binding protein 3, interstitial transcript_id : NM_015745.2

name	Zfp488 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701467 GeneID:382867 MGI:2686052
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 488 transcript_id : NM_001013777.1

name	EG665754 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396902 GeneID:665754 MGI:3649114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG665754 transcript_id : XM_979222.1

name	EG432838 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367538 GeneID:432838 MGI:3643519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432838 transcript_id : NM_001034880.2

name	Antxrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120407059 GeneID:239029 MGI:1925726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anthrax toxin receptor-like transcript_id : NM_172808.2

name	Anxa8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377277 GeneID:11752 MGI:1201374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A8 transcript_id : NM_013473.3

name	LOC100041131 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265430 GeneID:100041131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100041131 transcript_id : XM_001476661.1

name	Ppyr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357480 GeneID:19065 MGI:105374
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pancreatic polypeptide receptor 1 transcript_id : NM_008919.3

name	LOC100041163 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265436 GeneID:100041163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1104 ESTs, 9 Proteins product : similar to ribosomal protein L23a transcript_id : XM_001476718.1

name	Gprin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265440 GeneID:432839 MGI:2444560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : G protein regulated inducer of neurite outgrowth 2 transcript_id : XM_138975.8

name	Syt15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802005 GeneID:319508 MGI:2442166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin XV transcript_id : NM_181529.3

name	Syt15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542580 GeneID:319508 MGI:2442166
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin XV transcript_id : NM_176931.1

name	3110001K24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122891875 GeneID:75698 MGI:1922948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110001K24 gene transcript_id : NM_029389.2

name	Glud1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130959 GeneID:14661 MGI:95753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate dehydrogenase 1 transcript_id : NM_008133.3

name	LOC100041231 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265443 GeneID:100041231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins product : similar to Bcl7c protein transcript_id : XM_001476851.1

name	2200001I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367260 GeneID:69134 MGI:1916384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2200001I15 gene transcript_id : NM_183278.2

name	Sncg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386371 GeneID:20618 MGI:1298397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synuclein, gamma transcript_id : NM_011430.2

name	Mmrn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937369 GeneID:105450 MGI:2385618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : multimerin 2 transcript_id : NM_153127.3

name	Bmpr1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891829 GeneID:12166 MGI:1338938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein receptor, type 1A transcript_id : NM_009758.4

name	9230112D13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396907 GeneID:78243 MGI:1925493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 9230112D13 gene transcript_id : XM_127665.5

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056486 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_001039072.2

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056487 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_001039073.2

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056484 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_001039071.2

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056485 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_011918.4

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056488 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_001039074.2

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056489 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_001039075.2

name	Ldb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056490 GeneID:24131 MGI:1344412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LIM domain binding 3 transcript_id : NM_001039076.2

name	Opn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14349304 GeneID:30044 MGI:1353425
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opsin 4 (melanopsin) transcript_id : NM_013887.1

name	5830448L01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396909 GeneID:76031 MGI:1923281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 5830448L01 gene transcript_id : XM_979896.1

name	Wapal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100815492 GeneID:218914 MGI:2675859
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : wings apart-like homolog (Drosophila) transcript_id : NM_001004436.2

name	LOC100041341 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265450 GeneID:100041341
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs product : hypothetical protein LOC100041341 transcript_id : XM_001476968.1

name	Grid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680088 GeneID:14803 MGI:95812
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, delta 1 transcript_id : NM_008166.1

name	Lrrc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385762 CCDS:CCDS26924.1 GeneID:67580 MGI:1914830
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : testis-specific LRR protein protein_id : NP_080529.1

name	EG622657 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82953823 GeneID:622657 MGI:3643354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892193.1

name	Arhgap22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982013 CCDS:CCDS26926.1 GeneID:239027 MGI:2443418
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Rho GTPase activating protein 22 protein_id : NP_722495.2

name	Mapk8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710060 GeneID:26419 MGI:1346861
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004705 - JUN kinase activity [Evidence IMP] [Evidence IDA]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007254 - JNK cascade [Evidence IDA]; GO:0001503 - ossification [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : protein kinase mitogen-activated 8; c-Jun N-terminal kinase product : mitogen activated protein kinase 8 protein_id : NP_057909.1

name	LOC100040079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265376 GeneID:100040079
definition	codon_start : 1 product : similar to Mapk6 protein protein_id : XP_001474099.1

name	Frmpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265424 GeneID:268729 MGI:2685472
definition	codon_start : 1 note : overriding stop codons product : similar to FERM and PDZ domain containing 2 protein_id : XP_001481344.1 transl_except : (pos:34356263..34356265,aa:OTHER) transl_except : (pos:34356266..34356268,aa:OTHER) transl_except : (pos:34356269..34356271,aa:OTHER)

name	LOC100040093 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265378 GeneID:100040093
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474130.1

name	Ptpn20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679551 GeneID:19256 MGI:1196295
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase, non-receptor type 20 protein_id : NP_033004.1

name	Gdf10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254187 CCDS:CCDS26927.1 GeneID:14560 MGI:95684
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : growth differentiation factor 10 protein_id : NP_665684.2

name	Gdf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582807 CCDS:CCDS26928.1 GeneID:12165 MGI:1321394
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0040007 - growth [Evidence IEA] codon_start : 1 note : bone morphogenetic protein 9 product : growth differentiation factor 2 protein_id : NP_062379.3

name	Rbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729751 CCDS:CCDS26929.1 GeneID:19661 MGI:97878
definition	GO_function : GO:0016918 - retinal binding [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : interphotoreceptor retinoid-binding protein product : retinol binding protein 3, interstitial protein_id : NP_056560.1

name	Zfp488 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701468 CCDS:CCDS26930.1 GeneID:382867 MGI:2686052
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 488 protein_id : NP_001013799.1

name	EG665754 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396903 GeneID:665754 MGI:3649114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984316.1

name	EG432838 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702223 GeneID:432838 MGI:3643519
definition	codon_start : 1 product : hypothetical protein LOC432838 protein_id : NP_001030052.1

name	Antxrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120407060 CCDS:CCDS26931.1 GeneID:239029 MGI:1925726
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : anthrax toxin receptor-like protein_id : NP_766396.2

name	Anxa8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165408 CCDS:CCDS26932.1 GeneID:11752 MGI:1201374
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 note : annexin 8 product : annexin A8 protein_id : NP_038501.2

name	LOC100041131 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265431 GeneID:100041131
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476711.1

name	Ppyr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543504 CCDS:CCDS26933.1 GeneID:19065 MGI:105374
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004983 - neuropeptide Y receptor activity [Evidence IEA]; GO:0001602 - pancreatic polypeptide receptor activity [Evidence IDA]; GO:0001601 - peptide YY receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Y4 receptor product : pancreatic polypeptide receptor 1 protein_id : NP_032945.2

name	LOC100041163 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265437 GeneID:100041163
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_001476768.1

name	Gprin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265441 GeneID:432839 MGI:2444560
definition	codon_start : 1 product : G protein regulated inducer of neurite outgrowth 2 protein_id : XP_138975.8

name	Syt15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542579 CCDS:CCDS26934.1 GeneID:319508 MGI:2442166
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0000299 - integral to membrane of membrane fraction [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant a; synaptotagmin 15 product : synaptotagmin 15 isoform a protein_id : NP_852682.1

name	Syt15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542581 GeneID:319508 MGI:2442166
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0000299 - integral to membrane of membrane fraction [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant b; synaptotagmin 15 product : synaptotagmin 15 isoform b protein_id : NP_795905.1

name	3110001K24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122891876 GeneID:75698 MGI:1922948
definition	codon_start : 1 product : hypothetical protein LOC75698 protein_id : NP_083665.2

name	Glud1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680027 CCDS:CCDS26935.1 GeneID:14661 MGI:95753
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004353 - glutamate dehydrogenase [NAD(P)+] activity [Evidence IDA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence NAS] codon_start : 1 product : glutamate dehydrogenase 1 protein_id : NP_032159.1

name	LOC100041231 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265444 GeneID:100041231
definition	codon_start : 1 product : similar to Bcl7c protein protein_id : XP_001476901.1

name	2200001I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304077 GeneID:69134 MGI:1916384
definition	codon_start : 1 product : hypothetical protein LOC69134 protein_id : NP_899101.1

name	Sncg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755592 CCDS:CCDS26937.1 GeneID:20618 MGI:1298397
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043025 - cell soma [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : gamma-synuclein product : synuclein, gamma protein_id : NP_035560.1

name	Mmrn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937370 GeneID:105450 MGI:2385618
definition	codon_start : 1 product : elastin microfibril interfacer 3 protein_id : NP_694767.3

name	Bmpr1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46519168 CCDS:CCDS26938.1 GeneID:12166 MGI:1338938
definition	EC_number : 2.7.11.1 GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004702 - receptor signaling protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0005024 - transforming growth factor beta receptor activity [Evidence IEA]; GO:0004675 - transmembrane receptor protein serine/threonine kinase activity [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0051216 - cartilage development [Evidence IMP]; GO:0030154 - cell differentiation [Evidence IGI]; GO:0009950 - dorsal/ventral axis specification [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IGI]; GO:0007398 - ectoderm development [Evidence IMP]; GO:0007492 - endoderm development [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0035137 - hindlimb morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IMP]; GO:0048382 - mesendoderm development [Evidence IMP]; GO:0001880 - Mullerian duct regression [Evidence IMP]; GO:0050679 - positive regulation of epithelial cell proliferation [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IEA]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IEA] codon_start : 1 product : bone morphogenetic protein receptor, type 1A protein_id : NP_033888.2

name	9230112D13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396908 GeneID:78243 MGI:1925493
definition	codon_start : 1 product : hypothetical protein LOC78243 protein_id : XP_127665.4

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875544 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant 3; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform c protein_id : NP_001034161.1

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872219 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform d is encoded by transcript variant 4; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform d protein_id : NP_001034162.1

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872215 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform e is encoded by transcript variant 5; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform e protein_id : NP_001034163.1

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872213 CCDS:CCDS26940.1 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform b protein_id : NP_001034160.1

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872211 CCDS:CCDS26941.1 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform a protein_id : NP_036048.3

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872217 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform f is encoded by transcript variant 6; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform f protein_id : NP_001034164.1

name	Ldb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872221 CCDS:CCDS26942.1 GeneID:24131 MGI:1344412
definition	GO_component : GO:0005856 - cytoskeleton [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA]; GO:0005080 - protein kinase C binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform g is encoded by transcript variant 7; cypher; PDZ-LIM domain protein; oracle protein; Z-band alternatively spliced PDZ-motif protein product : LIM domain binding 3 isoform g protein_id : NP_001034165.1

name	Opn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14349305 CCDS:CCDS26943.1 GeneID:30044 MGI:1353425
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007602 - phototransduction [Evidence IEA]; GO:0018298 - protein-chromophore linkage [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : melanopsin product : opsin 4 protein_id : NP_038915.1

name	5830448L01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396910 GeneID:76031 MGI:1923281
definition	codon_start : 1 product : hypothetical protein LOC76031 protein_id : XP_984990.1

name	Wapal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100815493 GeneID:218914 MGI:2675859
definition	codon_start : 1 note : friend of EBNA2; WAPL protein product : wings apart-like homolog protein_id : NP_001004436.2

name	LOC100041341 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265451 GeneID:100041341
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477018.1

name	Grid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680089 CCDS:CCDS26944.1 GeneID:14803 MGI:95812
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glutamate receptor, ionotropic, delta 1 protein_id : NP_032192.1

name	LOC665768 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665768
definition	number : 1 pseudo : _no_value

name	LOC623142 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623142
definition	number : 1 pseudo : _no_value

name	LOC665681 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265420 GeneID:665681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to Ac1158 pseudo : _no_value transcript_id : XR_032780.1

name	LOC665834 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265449 GeneID:665834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_032985.1

clone name	MSMg01-382L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528I02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105P06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-511P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-073A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015L09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-065M19.b	B6Ng01-065M19.g
ACC	DH885167	DH885168
length	988	268
definition	DH885167\|Mus musculus domesticus DNA, BAC clone: B6Ng01-065M19, 5' end.	DH885168\|Mus musculus domesticus DNA, BAC clone: B6Ng01-065M19, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctttcccgggaagaggccaagggaaggagaggcattctgctgtcc tctcccggtgagtctgtccggtgagtctgtcccgtaggaccgcggggcgc atctcacctgggctctctcgcagcatcagcaaggcaggttgagtgtacca gctgcgggtccttcagcgtgcgtgttgttgaacttggctgcggagcccgc gggattccaggccccgcctcgagggcgggaccttcaagcccgtagagggt cctcacccctggctcctccgggcggaggcaccagagaccatagactgtag caactttgcagaaatcagagctcactccgcagaccccctccctcctcgac tctggcttcggagcttgacagacagccaggagctccagtctcagtcagta ctgctgtgtttagaggcgattctgtcacctctaagcggttgcacagtgca ctccaacctctagggtcttgaaccctcccggccaaagtgagagcagcgat gaaggcttggtggcacacgagaagttcctgcttgaaatggccaagaaccc ctgtctgctctcaactcattttcctctaaccgctagaatagccgcctgcg cagcggctcttggccttcactgaagcacccattgtctccccacctttcca agtctccccacctttccaagtctccccacctttccaagtcgtgggtggca gagaggccctgggctgccaacaatctccaagggtcttttaggtaactttc ctgaaagaaagggtgaaatgaggcaggaagggtccctttgaatcaggtgg ctgagaatggatatccataaggccatgtcctgcaggaccaggagtttcca ctgttgtgagtttcggggatgaggatcggggtggtgcttggtgtggttgc agactcctttgtgggtctgatgtttaacctgggtgctaaacagctggctt ggttggcaatgaaacccacccaagtcccagtccttctc	accagcgcgggaggggaggatctctccctcatcagctccaccatagagca gacaagagtccgggtccctctcctgtgctcacaccctcagggtcggctca ctcataacccctgcatccagggctagctctacaatgctgcccgggtgaag tgcaggggcagctcttccaagattacagttggtgaggaacagggatagct ctcccactctgagctctgatagtgttgggaccagctctcctgtctgctat tggtggtaaggggtgaag
quality values	Open. Hide. 47 25 21 29 47 43 53 57 61 61 53 42 53 61 50 37 53 50 61 53 47 43 40 35 43 13 15 15 13 10 7 10 11 10 50 38 47 43 50 47 61 55 55 61 61 61 61 61 61 61 61 61 55 55 61 61 61 55 55 61 47 61 61 61 61 61 49 43 36 25 30 19 20 20 22 33 43 59 61 61 59 61 61 59 59 59 59 55 32 59 61 59 59 59 59 61 59 59 59 61 59 61 59 55 59 59 59 59 61 61 59 61 59 61 61 61 59 59 59 52 59 59 49 59 59 59 59 49 45 59 59 59 59 61 59 59 59 61 59 59 61 61 59 61 61 61 59 61 61 59 52 59 61 61 59 52 59 55 44 59 61 61 61 61 59 52 59 59 59 61 59 59 59 61 61 61 61 59 59 59 61 59 59 61 61 61 59 59 61 61 59 52 59 61 59 59 61 59 59 59 59 59 59 59 59 59 59 59 59 59 61 59 61 61 61 59 59 59 59 59 39 59 59 61 61 59 59 61 59 59 59 59 59 55 59 52 59 59 59 61 61 59 59 59 39 61 59 59 61 59 61 61 61 61 59 59 59 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 59 59 61 61 59 61 55 55 61 61 52 52 61 52 49 61 55 55 61 55 52 61 61 61 61 52 52 36 52 52 55 61 61 61 61 55 55 52 52 61 55 55 61 55 41 33 61 52 52 55 52 52 52 55 55 55 52 52 52 43 61 61 55 61 61 61 61 61 61 61 61 61 61 55 55 52 55 55 55 61 61 61 61 55 61 61 61 43 55 61 61 61 61 55 61 55 55 47 50 61 55 50 55 55 61 55 50 50 61 50 55 55 61 61 61 61 61 61 61 61 61 50 61 61 61 55 61 61 61 61 61 55 55 55 55 61 61 61 55 55 55 61 61 61 55 50 61 55 55 61 61 61 61 61 55 61 61 61 53 52 43 53 50 53 61 61 61 61 61 61 52 61 53 53 50 61 47 52 53 53 61 61 53 61 61 61 61 61 61 61 52 61 61 61 61 53 52 53 53 50 47 50 61 61 61 61 61 61 61 53 61 61 61 61 50 61 61 61 53 61 53 61 53 53 61 53 61 61 61 61 61 39 61 53 61 61 61 42 61 61 61 61 45 61 53 61 45 61 39 61 61 39 47 61 61 61 61 61 53 61 53 52 53 47 43 47 47 47 38 53 40 53 27 53 47 38 47 47 57 53 53 53 57 53 47 47 53 57 53 43 43 53 47 53 57 50 57 57 57 53 53 57 47 50 53 43 47 52 57 45 53 57 50 52 57 43 36 57 42 53 57 50 57 53 53 53 53 47 47 52 38 53 57 57 53 53 57 52 38 41 33 47 51 50 52 45 24 38 47 46 47 50 14 26 17 9 21 24 42 52 47 57 42 57 53 45 57 57 53 28 52 57 41 57 37 26 38 17 53 34 52 52 50 27 57 57 38 29 45 50 53 57 57 28 23 5 43 36 35 38 53 28 57 57 52 35 37 57 37 57 52 39 39 24 25 27 45 41 29 42 57 57 52 26 46 46 17 38 25 53 17 37 11 37 16 57 52 40 24 46 46 34 50 34 30 37 26 36 32 32 33 42 44 42 42 28 23 24 37 57 53 30 48 48 57 57 24 29 10 25 14 25 34 33 52 57 40 29 42 37 38 25 39 30 27 42 30 34 16 39 37 20 27 33 57 34 24 33 40 29 40 24 31 8 53 30 37 29 57 40 29 32 57 40 41 57 37 24 37 32 33 30 17 21 19 24 41 34 31 37 35 48 10 53 37 22 33 17 33 24 28 22 37 28 16 31 17 30 15 24 25 10 9 27 35 30 25 32 21 29 25 30 27 25 30 22 36 32 29 26 22 9 24 46 30 38 25 23 29 21 47 24 22 29 27 23 29 14 18 51 48 26 6 37 33 17 6 5 10 20 33 14 29 28 25 29 30 44 27 24 29 38 15 19 20 31 14 24 20 27 13 12 18 33 22 28 11 12 7 15 11 14 29 33 32 34 35 21 20 21 28 39 30 15 46 12 14 23 10 11 19 15 11 17 14 17 11 8 16 27 7 21 7 13 22 26 28 28 15 28 7 7 25 9 8 10 7 23 34 17 29 24 24 22 29 17 14 6 7 14 14 18 7 23 11 10 16 28 15 9 19 15 14 29 29 16 17 12 40 20 14 10 17 25 19 14	Open. Hide. 11 28 28 10 9 12 12 12 12 52 59 59 59 61 61 61 61 59 61 36 36 59 61 61 61 61 61 61 59 59 59 59 59 59 49 59 61 61 59 59 61 59 38 39 37 18 30 23 29 36 18 59 59 59 61 59 61 59 61 61 59 59 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 61 61 59 61 59 52 61 61 59 61 59 61 59 59 59 52 59 59 59 52 59 59 61 61 61 61 61 59 61 59 59 61 61 61 59 59 59 59 52 59 59 52 59 59 61 61 59 61 59 59 59 61 55 55 59 61 61 61 61 61 59 59 61 61 59 59 59 61 59 59 52 61 61 61 59 59 59 59 61 61 61 59 61 59 59 59 59 61 61 59 59 59 59 59 59 61 61 61 59 61 61 59 61 61 61 59 59 52 61 59 59 59 59 59 59 61 61 61 61 61 61 55 61 61 55 55 55 61 52 55 61 55 55 55 61 55 55 52 55 61 55 55 61 61 61 61 61 55 55 52 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 20

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_34791789_34792785
seq2: B6Ng01-065M19.b_49_1036

seq1  GAATTCTTTCCCGGGAAGAGGCCAAGGGAAGGAGAGGCATTCTGCTGTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCCCGGGAAGAGGCCAAGGGAAGGAGAGGCATTCTGCTGTCC  50

seq1  TCTCCCGGTGAGTCTGTCCGGTGAGTCTGTCCCGTAGGACCGCGGGGCGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCGGTGAGTCTGTCCGGTGAGTCTGTCCCGTAGGACCGCGGGGCGC  100

seq1  ATCTCACCTGGGCTCTCTCGCAGCATCAGCAAGGCAGGTTGAGTGTACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCACCTGGGCTCTCTCGCAGCATCAGCAAGGCAGGTTGAGTGTACCA  150

seq1  GCTGCGGGTCCTTCAGCGTGCGTGTTGTTGAACTTGGCTGCGGAGCCCGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCGGGTCCTTCAGCGTGCGTGTTGTTGAACTTGGCTGCGGAGCCCGC  200

seq1  GGGATTCCAGGCCCCGCCTCGAGGGCGGGACCTTCAAGCCCGTAGAGGGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATTCCAGGCCCCGCCTCGAGGGCGGGACCTTCAAGCCCGTAGAGGGT  250

seq1  CCTCACCCCTGGCTCCTCCGGGCGGAGGCACCAGAGACCATAGACTGTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCACCCCTGGCTCCTCCGGGCGGAGGCACCAGAGACCATAGACTGTAG  300

seq1  CAACTTTGCAGAAATCAGAGCTCACTCCGCAGACCCCCTCCCTCCTCGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTTTGCAGAAATCAGAGCTCACTCCGCAGACCCCCTCCCTCCTCGAC  350

seq1  TCTGGCTTCGGAGCTTGACAGACAGCCAGGAGCTCCAGTCTCAGTCAGTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGCTTCGGAGCTTGACAGACAGCCAGGAGCTCCAGTCTCAGTCAGTA  400

seq1  CTGCTGTGTTTAGAGGCGATTCTGTCACCTCTAAGCGGTTGCACAGTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGTGTTTAGAGGCGATTCTGTCACCTCTAAGCGGTTGCACAGTGCA  450

seq1  CTCCAACCTCTAGGGTCTTGAACCCTCCCGGCCAAAGTGAGAGCAGCGAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAACCTCTAGGGTCTTGAACCCTCCCGGCCAAAGTGAGAGCAGCGAT  500

seq1  GAAGGCTTGGTGGCACACGAGAAGTTCCTGCTTGAAATGGCCAAGAACCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGCTTGGTGGCACACGAGAAGTTCCTGCTTGAAATGGCCAAGAACCC  550

seq1  CTGTCTGCTCTCAACTCATTTTCCTCTAACCGCTAGAATAGCCGCCTGCG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTCTGCTCTCAACTCATTTTCCTCTAACCGCTAGAATAGCCGCCTGCG  600

seq1  CAGCGGCTCTTGGCCTTCACTGAAGCACCCATTGTCTCCCCACCTTTCCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCGGCTCTTGGCCTTCACTGAAGCACCCATTGTCTCCCCACCTTTCCA  650

seq1  AGTCTCCCCACCTTTCCAAGTCTCCCCACCTTTCCAAGTCGTGGGTGGCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTCCCCACCTTTCCAAGTCTCCCCACCTTTCCAAGTCGTGGGTGGCA  700

seq1  GAGAGGCCCTGGGCTGCCAACAATCTCCAAGGGTCTTTTAGGTAACTTTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGGCCCTGGGCTGCCAACAATCTCCAAGGGTCTTTTAGGTAACTTTC  750

seq1  CTGAAAGAAAGGGTGAAATGAGGCAGGAAGGGTCCCTTTGAATCAGGTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAAGAAAGGGTGAAATGAGGCAGGAAGGGTCCCTTTGAATCAGGTGG  800

seq1  CTGAGAATGGATATCCATAAGGCCATGTCCTGCAGGACCAGGAGTTTCCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGAATGGATATCCATAAGGCCATGTCCTGCAGGACCAGGAGTTTCCA  850

seq1  CTGTTGTGAGTTTCGGGGATGAGGATCGGGGTGGTGCTTGGTGTGGTTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTGTGAGTTTCGGGGATGAGGATCGGGGTGGTGCTTGGTGTGGTTGC  900

seq1  AGGACTCCTTTGTGGGTCCTGATGTTTAAACCTGGGTTGCTAAACAGCTT  950
      | ||||||||||||||| ||||||||| |||||||| ||||||||||| |
seq2  A-GACTCCTTTGTGGGT-CTGATGTTT-AACCTGGG-TGCTAAACAGC-T  945

seq1  GACATGGTTGGCAAAGGAAAACCCACCCAAGTCCCCAGTTCCTTCTC  997
      | | |||||||||| |  |||||||||||||| ||||| ||||||||
seq2  GGCTTGGTTGGCAATG--AAACCCACCCAAGT-CCCAG-TCCTTCTC  988

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information