MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-077I02
Chromosome	14 (Build37)
Map Location	45,230,521 - 45,231,483
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG666556, EG666561, LOC676304, Rbmxrtp, LOC673132, LOC100041300, LOC624717, LOC672977, EG666590, LOC100041327, EG623592, Ear1, Ear-ps12, Ear-ps9, Ear-ps8, Ang-ps3, Ear10, EG666451, LOC672161, Ang3, Ear-ps7, Ear-ps10, EG630952, EG666621, LOC100041356, LOC100041364, LOC100041371, LOC100041376, Ear-ps2, Ang-ps1, Ear2, LOC100041393, LOC100041422, EG666638, 4930503E14Rik, EG666647, EG624862, EG666660, EG666667, EG546250, EG666675, LOC100041494, LOC100041497, EG666678, LOC676402, BC061237, LOC434476, EG666707, LOC100042570
Downstream gene	LOC666723, LOC673290, EG666725, EG624966, EG666744, Ptgdr, Ptger2, LOC100041591, 5730420B22Rik, LOC100041611, 6330416L11Rik, Ero1l, Psmc6, Styx, Gnpnat1, Plekhc1, EG382884, Ddhd1
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG666556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666556 MGI:3644714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666561 MGI:3648126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC676304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Rbmxrtp (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:652988
definition	note : Rbmxrt pseudogene pseudo : _no_value

name	LOC673132 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC100041300 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041300
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC624717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC672977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666590 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666590 MGI:3643326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG623592 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623592 MGI:3646923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 50 ESTs, 1 Protein

name	Ear1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13586 MGI:108021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear-ps12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503849 MGI:3528644
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 12 pseudo : _no_value

name	Ear-ps9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503493 MGI:3528636
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 9 pseudo : _no_value

name	Ear-ps8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497109 MGI:3528634
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 8 pseudo : _no_value

name	Ang-ps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497104 MGI:3528607
definition	note : angiogenin, ribonuclease A family, pseudogene 3 pseudo : _no_value

name	Ear10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93725 MGI:1890464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666451 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666451 MGI:3648791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 49 ESTs, 1 Protein

name	LOC672161 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Ang3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11730 MGI:1201793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Ear-ps7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497105 MGI:3528630
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 7 pseudo : _no_value

name	Ear-ps10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503495 MGI:3528640
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 10 pseudo : _no_value

name	EG630952 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630952 MGI:3646399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	EG666621 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666621 MGI:3643352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041356 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041364 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041371 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100041376 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ear-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93743 MGI:1890466
definition	note : eosinophil-associated, ribonuclease A family, pseudogene 2 pseudo : _no_value

name	Ang-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11728 MGI:104986
definition	note : angiogenin, ribonuclease A family, pseudogene 1 pseudo : _no_value

name	Ear2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13587 MGI:108020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041393 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041422 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG666638 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666638 MGI:3646502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	4930503E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74954 MGI:1922204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666647 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666647 MGI:3643591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	EG624862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624862 MGI:3646742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 113 ESTs, 7 Proteins

name	EG666660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666660 MGI:3643828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	EG666667 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666667 MGI:3643831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG546250 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546250 MGI:3643645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG666675 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666675 MGI:3646979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	LOC100041494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041497 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	EG666678 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666678 MGI:3648583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	LOC676402 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs

name	BC061237 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385138 MGI:2682320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG666707 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666707 MGI:3644638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	LOC100042570 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 118 ESTs, 7 Proteins

name	LOC666723 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	LOC673290 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG666725 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666725 MGI:3644430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG624966 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624966 MGI:3647825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG666744 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666744 MGI:3648993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Ptgdr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19214 MGI:102966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptger2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19217 MGI:97794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041591 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	5730420B22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70561 MGI:1917811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041611 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	6330416L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70713 MGI:1917963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ero1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50527 MGI:1354385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67089 MGI:1914339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Styx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56291 MGI:1891150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnpnat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54342 MGI:1858963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218952 MGI:2385001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382884 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382884 MGI:3645516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins

name	Ddhd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114874 MGI:2150302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	EG666561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396990 GeneID:666561 MGI:3648126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666561 transcript_id : XM_984613.1

name	LOC673132 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265447 GeneID:673132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : hypothetical LOC673132 transcript_id : XM_001476105.1

name	EG623592 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265550 GeneID:623592 MGI:3646923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 50 ESTs, 1 Protein product : predicted gene, EG623592 transcript_id : XM_891634.3

name	Ear1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33636772 GeneID:13586 MGI:108021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 1 transcript_id : NM_007894.2

name	Ear10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426866 GeneID:93725 MGI:1890464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 10 transcript_id : NM_053112.1

name	EG666451 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265553 GeneID:666451 MGI:3648791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 49 ESTs, 1 Protein product : predicted gene, EG666451, transcript variant 1 transcript_id : XM_988902.2

name	Ang3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265556 GeneID:11730 MGI:1201793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : angiogenin, ribonuclease A family, member 3 transcript_id : XM_001478112.1

name	EG630952 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396995 GeneID:630952 MGI:3646399
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG630952 transcript_id : XM_984982.1

name	LOC100041356 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265452 GeneID:100041356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041356 transcript_id : XM_001476232.1

name	LOC100041364 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265454 GeneID:100041364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041364 transcript_id : XM_001476245.1

name	LOC100041371 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265456 GeneID:100041371
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041371 transcript_id : XM_001476263.1

name	LOC100041376 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265458 GeneID:100041376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041376 transcript_id : XM_001476280.1

name	Ear2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328111 GeneID:13587 MGI:108020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 2 transcript_id : NM_007895.2

name	LOC100041393 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265460 GeneID:100041393
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041393 transcript_id : XM_001476317.1

name	LOC100041422 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265462 GeneID:100041422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001476355.1

name	EG666638 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265465 GeneID:666638 MGI:3646502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666638 transcript_id : XM_985112.2

name	4930503E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371426 GeneID:74954 MGI:1922204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930503E14 gene transcript_id : NM_029131.2

name	EG666647 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397002 GeneID:666647 MGI:3643591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG666647 transcript_id : XM_985174.1

name	EG624862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397004 GeneID:624862 MGI:3646742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 113 ESTs, 7 Proteins product : predicted gene, EG624862 transcript_id : XM_889408.2

name	EG666660 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397006 GeneID:666660 MGI:3643828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG666660 transcript_id : XM_985247.1

name	EG666667 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265467 GeneID:666667 MGI:3643831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666667 transcript_id : XM_985276.2

name	EG546250 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397010 GeneID:546250 MGI:3643645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG546250 transcript_id : XM_486530.3

name	EG666675 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265469 GeneID:666675 MGI:3646979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : predicted gene, EG666675 transcript_id : XM_985343.2

name	LOC100041497 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265472 GeneID:100041497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to HN1-like protein transcript_id : XM_001476466.1

name	EG666678 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397014 GeneID:666678 MGI:3648583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : predicted gene, EG666678 transcript_id : XM_985370.1

name	LOC676402 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265581 GeneID:676402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs product : hypothetical LOC676402 transcript_id : XM_001478175.1

name	BC061237 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348583 GeneID:385138 MGI:2682320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC061237 transcript_id : NM_198677.1

name	EG666707 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397023 GeneID:666707 MGI:3644638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : predicted gene, EG666707 transcript_id : XM_985543.1

name	LOC100042570 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265589 GeneID:100042570
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 118 ESTs, 7 Proteins product : similar to E1B 19K/Bcl-2-binding protein homolog transcript_id : XM_001478188.1

name	LOC666723 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397027 GeneID:666723
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : hypothetical LOC666723 transcript_id : XM_985614.1

name	EG624966 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265478 GeneID:624966 MGI:3647825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG624966 transcript_id : XM_889508.3

name	Ptgdr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357272 GeneID:19214 MGI:102966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin D receptor transcript_id : NM_008962.3

name	Ptger2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227232 GeneID:19217 MGI:97794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E receptor 2 (subtype EP2) transcript_id : NM_008964.3

name	5730420B22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372751 GeneID:70561 MGI:1917811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730420B22 gene transcript_id : NM_172597.2

name	LOC100041611 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265482 GeneID:100041611
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to hCG1790059 transcript_id : XM_001476686.1

name	6330416L11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397036 GeneID:70713 MGI:1917963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6330416L11 gene transcript_id : XM_986046.1

name	Ero1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15718668 GeneID:50527 MGI:1354385
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ERO1-like (S. cerevisiae) transcript_id : NM_015774.2

name	Psmc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373033 GeneID:67089 MGI:1914339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, ATPase, 6 transcript_id : NM_025959.3

name	Styx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130655 GeneID:56291 MGI:1891150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoserine/threonine/tyrosine interaction protein transcript_id : NM_019637.3

name	Gnpnat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130756 GeneID:54342 MGI:1858963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucosamine-phosphate N-acetyltransferase 1 transcript_id : NM_019425.2

name	Plekhc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67906178 GeneID:218952 MGI:2385001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family C (with FERM domain) member 1 transcript_id : NM_146054.2

name	EG382884 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397038 GeneID:382884 MGI:3645516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 ESTs, 4 Proteins product : predicted gene, EG382884 transcript_id : XM_356730.5

name	Ddhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955151 GeneID:114874 MGI:2150302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DDHD domain containing 1 transcript_id : NM_001039106.2

name	Ddhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955223 GeneID:114874 MGI:2150302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DDHD domain containing 1 transcript_id : NM_176845.4

name	Ddhd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955211 GeneID:114874 MGI:2150302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DDHD domain containing 1 transcript_id : NM_001042719.1

name	EG666561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396991 GeneID:666561 MGI:3648126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989707.1

name	LOC673132 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265448 GeneID:673132
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476155.1

name	EG623592 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396969 GeneID:623592 MGI:3646923
definition	codon_start : 1 product : similar to LOC635138 protein protein_id : XP_896727.2

name	Ear1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681249 CCDS:CCDS26964.1 GeneID:13586 MGI:108021
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : eosinophil-associated ribonuclease 1 product : eosinophil-associated, ribonuclease A family, member 1 protein_id : NP_031920.1

name	Ear10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426867 CCDS:CCDS26965.1 GeneID:93725 MGI:1890464
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence ISS] [Evidence IDA] codon_start : 1 note : eosinophil-associated ribonuclease 10 product : eosinophil-associated, ribonuclease A family, member 10 protein_id : NP_444342.1

name	EG666451 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396972 GeneID:666451 MGI:3648791
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_993996.1

name	Ang3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265557 GeneID:11730 MGI:1201793
definition	codon_start : 1 product : angiogenin, ribonuclease A family, member 3 protein_id : XP_001478162.1

name	EG630952 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396996 GeneID:630952 MGI:3646399
definition	codon_start : 1 product : similar to angiogenin ribonuclease 6 protein_id : XP_990076.1

name	LOC100041356 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265453 GeneID:100041356
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476282.1

name	LOC100041364 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265455 GeneID:100041364
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476295.1

name	LOC100041371 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265457 GeneID:100041371
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476313.1

name	LOC100041376 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265459 GeneID:100041376
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476330.1

name	Ear2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681251 CCDS:CCDS26968.1 GeneID:13587 MGI:108020
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] [Evidence IDA] codon_start : 1 note : eosinophil-associated ribonuclease 2; eosinophil-derived neurotoxin; eosinophil-derived neurotoxin, liver; ribonuclease, RNase A family, 2 (liver,eosinophil-derived neurotoxin); eosinophil-associated ribonuclease 13 product : eosinophil-associated, ribonuclease A family, member 2 protein_id : NP_031921.1

name	LOC100041393 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265461 GeneID:100041393
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476367.1

name	LOC100041422 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265463 GeneID:100041422
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001476405.1

name	EG666638 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265466 GeneID:666638 MGI:3646502
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_990206.2

name	4930503E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729771 GeneID:74954 MGI:1922204
definition	codon_start : 1 product : hypothetical protein LOC74954 protein_id : NP_083407.1

name	EG666647 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397003 GeneID:666647 MGI:3643591
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990268.1

name	EG624862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397005 GeneID:624862 MGI:3646742
definition	codon_start : 1 product : similar to E1B 19K/Bcl-2-binding protein homolog protein_id : XP_894501.2

name	EG666660 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397007 GeneID:666660 MGI:3643828
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990341.1

name	EG666667 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265468 GeneID:666667 MGI:3643831
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_990370.2

name	EG546250 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397011 GeneID:546250 MGI:3643645
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486530.3

name	EG666675 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265470 GeneID:666675 MGI:3646979
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990437.2

name	LOC100041497 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265473 GeneID:100041497
definition	codon_start : 1 product : similar to HN1-like protein protein_id : XP_001476516.1

name	EG666678 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397015 GeneID:666678 MGI:3648583
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990464.1

name	LOC676402 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265582 GeneID:676402
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478225.1

name	BC061237 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348584 GeneID:385138 MGI:2682320
definition	codon_start : 1 product : hypothetical protein LOC385138 protein_id : NP_941079.1

name	EG666707 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397024 GeneID:666707 MGI:3644638
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990637.1

name	LOC100042570 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265590 GeneID:100042570
definition	codon_start : 1 product : similar to E1B 19K/Bcl-2-binding protein homolog protein_id : XP_001478238.1

name	LOC666723 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397028 GeneID:666723
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990708.1

name	EG624966 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265479 GeneID:624966 MGI:3647825
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_894601.3

name	Ptgdr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543521 CCDS:CCDS26971.1 GeneID:19214 MGI:102966
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004956 - prostaglandin D receptor activity [Evidence IDA]; GO:0001785 - prostaglandin J receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004960 - thromboxane receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : prostaglandin D receptor protein_id : NP_032988.2

name	Ptger2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679529 CCDS:CCDS26972.1 GeneID:19217 MGI:97794
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004960 - thromboxane receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : EP2 receptor; prostaglandin E receptor EP2 subtype; prostaglandin E receptor 2 (EP2 subtype); prostaglandin E receptor subtype EP2 product : prostaglandin E receptor 2 (subtype EP2) protein_id : NP_032990.1

name	5730420B22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27501462 CCDS:CCDS26973.1 GeneID:70561 MGI:1917811
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC70561 protein_id : NP_766185.1

name	LOC100041611 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265483 GeneID:100041611
definition	codon_start : 1 product : similar to hCG1790059 protein_id : XP_001476736.1

name	6330416L11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397037 GeneID:70713 MGI:1917963
definition	codon_start : 1 product : G protein-coupled receptor 137C protein_id : XP_991140.1

name	Ero1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657067 GeneID:50527 MGI:1354385
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IDA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006457 - protein folding [Evidence ISS] [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0030968 - unfolded protein response [Evidence IDA] codon_start : 1 product : ERO1-like protein_id : NP_056589.1

name	Psmc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754103 CCDS:CCDS26974.1 GeneID:67089 MGI:1914339
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 product : proteasome 26S ATPase subunit 6 protein_id : NP_080235.2

name	Styx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46852143 CCDS:CCDS26975.1 GeneID:56291 MGI:1891150
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : protein tyrosine phosphatase-like unspliced c-terminal product and spliced c-terminal end STYX; STNS (alternatively spliced intron of Styx) product : phosphoserine/threonine/tyrosine interaction protein protein_id : NP_062611.2

name	Gnpnat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506761 CCDS:CCDS26976.1 GeneID:54342 MGI:1858963
definition	GO_component : GO:0005793 - ER-Golgi intermediate compartment [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004343 - glucosamine 6-phosphate N-acetyltransferase activity [Evidence IDA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006048 - UDP-N-acetylglucosamine biosynthesis [Evidence TAS] codon_start : 1 note : glucosamine-6-phosphate acetyltransferase product : glucosamine-phosphate N-acetyltransferase 1 protein_id : NP_062298.1

name	Plekhc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906179 CCDS:CCDS26977.1 GeneID:218952 MGI:2385001
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : mitogen inducible 2 product : pleckstrin homology domain containing, family C (with FERM domain) member 1 protein_id : NP_666166.2

name	EG382884 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38076099 GeneID:382884 MGI:3645516
definition	codon_start : 1 product : hypothetical protein protein_id : XP_356730.1

name	Ddhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955152 CCDS:CCDS26978.1 GeneID:114874 MGI:2150302
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; phosphatidic acid-preferring phospholipase A1 product : DDHD domain containing 1 isoform 1 protein_id : NP_001034195.2

name	Ddhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955224 GeneID:114874 MGI:2150302
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; phosphatidic acid-preferring phospholipase A1 product : DDHD domain containing 1 isoform 2 protein_id : NP_789815.3

name	Ddhd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111955212 GeneID:114874 MGI:2150302
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; phosphatidic acid-preferring phospholipase A1 product : DDHD domain containing 1 isoform 3 protein_id : NP_001036184.1

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 4 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 3 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 2 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 1 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 4 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 3 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 2 pseudo : _no_value

name	LOC676304 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676304
definition	number : 1 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 1 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 2 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 3 pseudo : _no_value

name	LOC100041300 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041300
definition	number : 4 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 1 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 2 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 3 pseudo : _no_value

name	LOC624717 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624717
definition	number : 4 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 6 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 5 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 4 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 3 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 2 pseudo : _no_value

name	LOC672977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672977
definition	number : 1 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 5 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 4 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 3 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 2 pseudo : _no_value

name	EG666590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666590
definition	number : 1 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 1 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 2 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 3 pseudo : _no_value

name	LOC100041327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041327
definition	number : 4 pseudo : _no_value

name	LOC672161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672161
definition	number : 1 pseudo : _no_value

name	LOC672161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672161
definition	number : 2 pseudo : _no_value

name	LOC672161 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672161
definition	number : 3 pseudo : _no_value

name	EG666621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666621
definition	number : 1 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 1 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 2 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 3 pseudo : _no_value

name	LOC100041494 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041494
definition	number : 4 pseudo : _no_value

name	LOC434476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434476
definition	number : 4 pseudo : _no_value

name	LOC434476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434476
definition	number : 3 pseudo : _no_value

name	LOC434476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434476
definition	number : 2 pseudo : _no_value

name	LOC434476 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434476
definition	number : 1 pseudo : _no_value

name	LOC673290 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673290
definition	number : 1 pseudo : _no_value

name	LOC673290 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673290
definition	number : 2 pseudo : _no_value

name	LOC673290 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673290
definition	number : 3 pseudo : _no_value

name	LOC673290 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673290
definition	number : 4 pseudo : _no_value

name	EG666725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666725
definition	number : 5 pseudo : _no_value

name	EG666725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666725
definition	number : 4 pseudo : _no_value

name	EG666725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666725
definition	number : 3 pseudo : _no_value

name	EG666725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666725
definition	number : 2 pseudo : _no_value

name	EG666725 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666725
definition	number : 1 pseudo : _no_value

name	EG666744 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666744
definition	number : 5 pseudo : _no_value

name	EG666744 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666744
definition	number : 4 pseudo : _no_value

name	EG666744 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666744
definition	number : 3 pseudo : _no_value

name	EG666744 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666744
definition	number : 2 pseudo : _no_value

name	EG666744 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666744
definition	number : 1 pseudo : _no_value

name	LOC100041591 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041591
definition	number : 1 pseudo : _no_value

name	LOC100041591 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041591
definition	number : 2 pseudo : _no_value

name	LOC100041591 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041591
definition	number : 3 pseudo : _no_value

name	LOC100041591 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041591
definition	number : 4 pseudo : _no_value

name	LOC100041591 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041591
definition	number : 5 pseudo : _no_value

clone name	MSMg01-274B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-161F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399D13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-317E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-318G17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-156G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001L15
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-077I02.b	B6Ng01-077I02.g
ACC	DH893459	DH893460
length	964	1,203
definition	DH893459\|Mus musculus domesticus DNA, BAC clone: B6Ng01-077I02, 5' end.	DH893460\|Mus musculus domesticus DNA, BAC clone: B6Ng01-077I02, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaggctatgtcctggacaccctcatgcagtggctgccacagtctg cctcctatatactgagacattctggtgcttattaaactcagtatcctgat tccaggacaacacaggttggggttccttagtaagtgatcaaggacttcaa gacctccctcatgggcctggaaggaaacccttctaaaaagttccgaggaa gtctgtgccacaggatctcgcccacctcaaccctgttaccactttttaaa aaatatatatatcttcagaacacagattctcagttgtaggttcttatttc tacacagctacccagagcaaaaaaatcagtatttgctgggaggagactca atatcaggatagctatatataatcctcacgggatttcaatgtgtcatcaa ggtgaacatatagacaaagagcagtgctgactgaggtggggctccctgca catggagacagcatcaccttgcaacaggccccactgtagtcgccagattc caaggatgcatagacccatgggggtcacaagtacatacacacacacagac acaaacacacacagacacacacacaggcacacacacacaattggtcctct atgaggagtccatgtctgtaggcttttgctacactgcatccttggtgtat ttctttaagttccatggatgtctgatagcaaaaatcaagaaaagaatata cccctggacatatttcaagttctgagacatttactactttcatcttagac acaggcaatcacagcttggaggtgctaagcactagggaatccaggaccta cttgcatcacatcagatactagctgacattgccctccaagcacagcatgg ctggctagcttatgccatccagagccagtaggactgcagtatgtgctgag gtacctgactagccacaggggttggggaacaatatcctatcttgagaaca gctgccctgattta	gaattctctgccctgccttaaccacttgttgacattccttgtcctttaag cacgatcttatcagcttccacaacggcatggttcctgctttaagtttgcc attctccagttccctaactaaatatcccttgagtttctcccaagagggga tagttaaggaccctgaacacgcaaaccacggtgctatgtgatctacctct tttacaaagccttctagtgtcttggtggcgactttcaagccacgctgctt caggaccgaccataaggcggtcaccacagagtgggagattcccatactgg tcgctgtccaggcctgactgtgactgagaaccagtcagcaatactggtcg ctgtccaggcctgaccgcgactgagaaccagtcagcagttccagaggtgg aagcaaaacaaaatcgaaagggaaggaataatcgcagtgaaaacaatcaa aagggtgtctaactctggagaaatttcaagactgtactaccttgtagagc tgtaaagtgtcccgtagttctgaacccgccccgtgaaacgggggtctcct aacagtgcctggtgatgataaattctcgagtttctcggtgccacttcttg cccgagttagtatctcgccggcaagaattcactcggacaaccagatccta tggcaaagcttttattgcttcaacataaggaagaccccaaacctggaaaa tggtgctcttatatagcccgcagcgtgacgtttcagcacctgatgtggcg tgacagcacctgattagttgctcgcccatcaccccattactacgccccga gatgggcagtgactgggcgtgaattcactctttgcacttgcgcataaggc ttgtttactagttaggcgtagtggaagccagtgccatctttataatggcg attgctcatctccacaggctccagcatagtctcacagagacagctatatc tgggtcctttagcaaatcttgctagtgtatgcaatgttgtcagcatttgg agtctgattattggatggatccccgaatatgcattcacctagatgtcaat cctttcgtcaaagaatccaaactttgttctctgtaactcctttcatgggt ttttttgtttcatcttaaggagggtccaagtgtcacactttgctcatctt ttggattttcaacgttagacaatgtatcttaaattctagtgggatactct cag
quality values	Open. Hide. 61 47 22 30 61 38 27 50 61 55 61 55 47 61 61 61 61 61 61 61 49 52 52 55 59 59 23 35 12 27 27 14 11 10 18 55 59 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 44 35 43 30 35 59 49 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 44 44 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 57 53 57 50 57 50 57 52 57 57 57 57 53 53 53 57 53 57 57 53 57 53 53 34 57 57 45 53 53 53 52 53 57 57 57 57 57 53 53 32 47 46 57 47 57 57 57 53 53 53 53 45 53 53 57 53 50 57 53 57 57 52 52 57 45 57 37 34 42 57 52 53 53 57 52 45 57 34 52 53 45 47 38 47 52 57 57 34 57 53 53 53 57 57 41 41 42 57 45 57 57 57 50 53 50 45 47 52 57 41 41 52 45 57 53 42 53 45 52 53 57 57 57 52 34 52 41 39 52 53 42 50 57 53 36 52 43 50 50 53 50 53 50 53 33 52 42 37 38 57 38 40 42 37 37 47 53 57 57 37 42 48 39 48 53 52 20 52 37 40 42 33 29 57 37 38 53 27 40 41 48 40 44 40 53 27 45 33 23 10 57 34 44 40 41 22 33 19 40 28 40 37 33 14 57 44 25 26 28 40 53 30 31 31 36 26 47 35 35 32 44 29 38 34 27 31 35 29 30 23 30 32 36 23 48 31 38 38 35 35 22 48 48 29 47 21 27 29 51 34 34 47 47 31 29 29 21 39 27 29 27 29 29 18 29 35 30 48 48 30 29 30 41 24 29 29 28 29 33 24 29 24 29 27 17 10 29 29 29 28 17 46 26 33 30 23 23 23 29 6 43 41 27 25 26 28 27 20 28 38 34 35 29 29 29 29 25 38 17 29 23 20 20 31 27 33 27 22 29 29 27 31 18 17 29 8 14 44 46 32 13 31 11 36 36 10 33 13 23 14 28 24 27 35 31 38 29 33 25 34 28 13 24 17 8 23 32 19 19 27 34 30 24 22 38 23 28 27 35 17 38 23 7	Open. Hide. 61 61 59 49 61 61 43 49 41 30 35 28 30 41 59 61 61 61 61 61 59 61 59 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 44 55 61 61 61 61 61 61 61 59 61 61 61 61 59 55 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 57 57 57 57 50 53 53 53 53 57 53 57 57 53 57 53 46 57 53 39 53 53 57 57 57 57 57 53 45 53 47 26 47 47 50 53 57 57 39 46 57 53 57 53 53 57 57 57 57 53 57 57 57 57 53 57 53 57 30 42 57 57 53 52 53 47 53 57 57 53 57 38 57 53 41 41 52 50 53 57 53 57 38 52 37 21 57 52 50 53 27 41 47 33 53 53 45 52 53 52 31 43 43 40 38 53 45 57 45 53 52 41 45 47 37 47 39 52 57 38 57 53 57 45 52 53 53 57 40 42 43 57 52 40 52 52 37 27 37 40 38 53 42 52 20 18 33 52 34 53 18 33 33 38 21 35 46 37 53 52 53 36 53 57 57 37 37 57 52 37 53 44 47 44 42 40 37 42 42 42 52 36 37 38 37 38 40 42 36 53 47 52 53 33 33 36 53 53 33 41 28 30 53 37 43 44 40 40 40 29 44 37 30 29 33 53 53 53 23 28 31 31 47 29 33 45 34 44 33 25 32 40 39 39 36 48 33 33 43 39 46 47 31 32 38 31 32 30 48 46 31 27 34 12 27 27 29 30 47 20 30 51 46 31 23 21 13 23 28 30 46 39 29 38 31 34 48 29 29 28 31 46 30 29 28 35 33 27 30 28 39 29 25 32 29 29 8 43 16 31 29 27 40 34 30 30 29 24 28 29 28 20 21 12 21 10 41 13 23 28 51 30 29 34 31 35 22 43 20 29 14 43 25 29 27 28 13 24 29 10 30 38 22 28 39 20 17 21 29 14 32 25 29 13 6 28 34 33 34 43 25 22 38 31 22 16 12 9 10 29 22 28 25 23 21 29 22 30 10 8 31 20 15 27 16 6 32 36 12 10 21 12 17 10 10 28 34 34 33 15 8 25 10 32 7 28 15 28 26 30 31 31 33 20 30 30 28 33 51 31 13 14 11 26 38 22 29 23 28 27 44 28 8 13 34 9 18 27 33 14 9 19 26 15 28 19 28 34 20 33 23 39 6 6 13 10 22 26 25 34 26 38 39 19 30 11 26 16 9 24 10 21 26 21 7 12 8 5 9 9 7 12 15 21 5 11 27 42 42 30 9 30 20 6 11 8 17 6 10 8 5 6 5 6 10 13 20 17 30 13 19 5 16 9 8 11 21 13 18 22 13 19 6 9 5 4 6 4 4 6 23 23 21 12 10 30 15 17 20 9 20 7 4 5 6 6 11 9 7 9 13 9 14 23 15 26 5 26 6 23 11 8 19 14 6 3 3 4 7 30 13 4 14 6 9 3 6 4 3 2 3 3 13 15 3 3 8 3 24 18 4 8 4 18 18 6 7 18 3 3 3 11 7 6 3 14 4 4 2 3 8 5 7 8 9 24 13 8 10 4 7 3 13 20 4 13 6 5 3 1 4 5 5 10 14 12 7 17 9 14 7 13 6 8 6 6 3 16 13 6 12 20 5 4 6 3 12 20 23 6 6 6 3 5 9 8 5 14 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_45230521_45231483
seq2: B6Ng01-077I02.b_44_1007

seq1  GAATTCAGGCTATGTCCTGGACACCCTCATGCAGTGGCTGCCACAGTCTG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGGCTATGTCCTGGACACCCTCATGCAGTGGCTGCCACAGTCTG  50

seq1  CCTCCTATATACTGAGACATTCTGGTGCTTATTAAACTCAGTATCCTGAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTATATACTGAGACATTCTGGTGCTTATTAAACTCAGTATCCTGAT  100

seq1  TCCAGGACAACACAGGTTGGGGTTCCTTAGTAAGTGATCAAGGACTTCAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGACAACACAGGTTGGGGTTCCTTAGTAAGTGATCAAGGACTTCAA  150

seq1  GACCTCCCTCATGGGCCTGGAAGGAAACCCTTCTAAAAAGTTCCGAGGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTCCCTCATGGGCCTGGAAGGAAACCCTTCTAAAAAGTTCCGAGGAA  200

seq1  GTCTGTGCCACAGGATCTCGCCCACCTCAACCCTGTTACCACTTTTTAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGTGCCACAGGATCTCGCCCACCTCAACCCTGTTACCACTTTTTAAA  250

seq1  AAATATATATATCTTCAGAACACAGATTCTCAGTTGTAGGTTCTTATTTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATATATATCTTCAGAACACAGATTCTCAGTTGTAGGTTCTTATTTC  300

seq1  TACACAGCTACCCAGAGCAAAAAAATCAGTATTTGCTGGGAGGAGACTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACAGCTACCCAGAGCAAAAAAATCAGTATTTGCTGGGAGGAGACTCA  350

seq1  ATATCAGGATAGCTATATATAATCCTCACGGGATTTCAATGTGTCATCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCAGGATAGCTATATATAATCCTCACGGGATTTCAATGTGTCATCAA  400

seq1  GGTGAACATATAGACAAAGAGCAGTGCTGACTGAGGTGGGGCTCCCTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGAACATATAGACAAAGAGCAGTGCTGACTGAGGTGGGGCTCCCTGCA  450

seq1  CATGGAGACAGCATCACCTTGCAACAGGCCCCACTGTAGTCGCCAGATTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGAGACAGCATCACCTTGCAACAGGCCCCACTGTAGTCGCCAGATTC  500

seq1  CAAGGATGCATAGACCCATGGGGGTCACAAGTACATACACACACACAGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGGATGCATAGACCCATGGGGGTCACAAGTACATACACACACACAGAC  550

seq1  ACAAACACACACAGACACACACACAGGCACACACACACAATTGGTCCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACACACACAGACACACACACAGGCACACACACACAATTGGTCCTCT  600

seq1  ATGAGGAGTCCATGTCTGTAGGCTTTTGCTACACTGCATCCTTGGTGTAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGGAGTCCATGTCTGTAGGCTTTTGCTACACTGCATCCTTGGTGTAT  650

seq1  TTCTTTAAGTTCCATGGATGTCTGATAGCAAAAATCAAGAAAAGAATATA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTAAGTTCCATGGATGTCTGATAGCAAAAATCAAGAAAAGAATATA  700

seq1  CCCCTGGACATATTTCAAGTTCTGAGACATTTACTACTTTCATCTTAGAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTGGACATATTTCAAGTTCTGAGACATTTACTACTTTCATCTTAGAC  750

seq1  ACAGGCAATCACAGCTTGGAGGTGCTAAGCACTAGGGAATCCAGGACCTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCAATCACAGCTTGGAGGTGCTAAGCACTAGGGAATCCAGGACCTA  800

seq1  CTTGCATCACATCAGATACTAGCTGACATTGCCCTCCAAGCACAGCATGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCATCACATCAGATACTAGCTGACATTGCCCTCCAAGCACAGCATGG  850

seq1  CTGGCTAGCTTATGCCATCCAGAGCCAGTAGGACTGCAGTATGTGCTGAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTAGCTTATGCCATCCAGAGCCAGTAGGACTGCAGTATGTGCTGAG  900

seq1  GTACCTGACTAGCCACAGGGGTT-GGGAACAATATCCTATCTTGAGAACA  949
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  GTACCTGACTAGCCACAGGGGTTGGGGAACAATATCCTATCTTGAGAACA  950

seq1  GCTGCCCTGATTTA  963
      ||||||||||||||
seq2  GCTGCCCTGATTTA  964

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information