MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-106G12
Chromosome	14 (Build37)
Map Location	51,142,265 - 51,143,437
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Slc35f4, 3632451O06Rik, LOC667006, Olfr722, Olfr723, Olfr724, LOC100041975, Olfr725, LOC100042882, Olfr726, Olfr727, Olfr728, Olfr729, Olfr730, Olfr731, Olfr732, Olfr733, Olfr734, Olfr735, Tlr11, Olfr736, Olfr737-ps1, Olfr738, Olfr739, Olfr740, Olfr741, GA_x5J8B7U07Q4-325-757, GA_x5J8B7TYL6J-3-280, Olfr742
Downstream gene	Olfr743-ps1, Olfr744, Olfr745, Olfr746, Olfr747, Olfr748, Olfr749, Ttc5, Gm288, Rpph1, Parp2, Tep1, EG546611, Osgep, Apex1, Tmem55b, Pnp, LOC667034, LOC667210, Rnase10, Rnase9, Rnase11, Rnase12, Olfr750, GA_x5J8B7W5WBF-6267395-6266441, Rnase4, Ang1, Gm75, Rnase6, Rnase1, Ear5, Ear-ps1, Ang2, Ear14, Ear11, LOC100042187, EG633215, LOC100042203, LOC633238, EG638695, Vmn2r-ps110, LOC100042224, Vmn2r88, LOC100042247, V2r10, LOC100043041
Link	Open Mouse BAC browser

Click to get alignment info.

name	Slc35f4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75288 MGI:1922538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3632451O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67419 MGI:1914669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Olfr722 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258487 MGI:3030556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr723 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259147 MGI:3030557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr724 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258485 MGI:3030558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Olfr725 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258314 MGI:3030559
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Olfr726 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258313 MGI:3030560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr727 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258316 MGI:3030561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr728 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258039 MGI:3030562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258275 MGI:3030563
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr730 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258486 MGI:3030564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr731 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258360 MGI:3030565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr732 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258659 MGI:3030566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr733 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258657 MGI:3030567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr734 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258658 MGI:3030568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr735 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257909 MGI:3030569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239081 MGI:3045226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258660 MGI:3030570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr737-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257997 MGI:3030571
definition	gene_synonym : MOR0-11P note : olfactory receptor 737, pseudogene 1 pseudo : _no_value

name	Olfr738 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258662 MGI:3030572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr739 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258663 MGI:3030573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr740 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258661 MGI:3030574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr741 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258233 MGI:3030575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7U07Q4-325-757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257858
definition	note : olfactory receptor GA_x5J8B7U07Q4-325-757 pseudo : _no_value

name	GA_x5J8B7TYL6J-3-280 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257741
definition	note : olfactory receptor GA_x5J8B7TYL6J-3-280 pseudo : _no_value

name	Olfr742 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258422 MGI:3030576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr743-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404219 MGI:3030577
definition	gene_synonym : GA_x6K02T2PMLR-6243196-6244132 note : olfactory receptor 743, pseudogene 1 pseudo : _no_value

name	Olfr744 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257884 MGI:3030578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr745 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258296 MGI:3030579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr746 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258295 MGI:3030580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr747 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258264 MGI:3030581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr748 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258113 MGI:3030582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr749 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56858 MGI:3030583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219022 MGI:2683584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gm288 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239083 MGI:2685134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins

name	Rpph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:85029 MGI:1934664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11546 MGI:1341112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21745 MGI:109573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546611 MGI:3644593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Osgep (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66246 MGI:1913496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apex1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11792 MGI:88042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem55b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219024 MGI:2448501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18950 MGI:97365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 170 ESTs, 9 Proteins

name	LOC667210 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 4 Proteins pseudo : _no_value

name	Rnase10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75019 MGI:1922269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnase9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328401 MGI:3057273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnase11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497113 MGI:3528583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnase12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497106 MGI:3528588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404319 MGI:3030584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W5WBF-6267395-6266441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257797
definition	note : olfactory receptor GA_x5J8B7W5WBF-6267395-6266441 pseudo : _no_value

name	Rnase4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58809 MGI:1926217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ang1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11727 MGI:88022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm75 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219026 MGI:2684921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnase6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78416 MGI:1925666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnase1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19752 MGI:97919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54159 MGI:1858598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53887 MGI:1858247
definition	gene_synonym : mR6p note : eosinophil-associated, ribonuclease A family, pseudogene 1 pseudo : _no_value

name	Ang2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11731 MGI:104984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503847 MGI:3528616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ear11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93726 MGI:1890465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG633215 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633215 MGI:3649093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042203 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC633238 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 19 Proteins pseudo : _no_value

name	EG638695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638695 MGI:3643454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vmn2r-ps110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042224 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Vmn2r88 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100042247 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	V2r10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22301 MGI:1316707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043041 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Slc35f4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363008 GeneID:75288 MGI:1922538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member F4 transcript_id : NM_029238.2

name	3632451O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802264 GeneID:67419 MGI:1914669
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3632451O06 gene transcript_id : NM_026142.2

name	Olfr722 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328366 GeneID:258487 MGI:3030556
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 722 transcript_id : NM_146494.2

name	Olfr723 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372133 GeneID:259147 MGI:3030557
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 723 transcript_id : NM_001011530.1

name	Olfr724 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238971 GeneID:258485 MGI:3030558
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 724 transcript_id : NM_146492.1

name	LOC100041975 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265522 GeneID:100041975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041975 transcript_id : XM_001477309.1

name	Olfr725 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129656 GeneID:258314 MGI:3030559
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 725 transcript_id : NM_146317.1

name	LOC100042882 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265627 GeneID:100042882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100042882 transcript_id : XM_001478893.1

name	Olfr726 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247412 GeneID:258313 MGI:3030560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 726 transcript_id : NM_146316.2

name	Olfr727 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129658 GeneID:258316 MGI:3030561
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 727 transcript_id : NM_146319.1

name	Olfr728 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801383 GeneID:258039 MGI:3030562
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 728 transcript_id : NM_001011809.1

name	Olfr729 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129730 GeneID:258275 MGI:3030563
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 729 transcript_id : NM_146278.1

name	Olfr730 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174775 GeneID:258486 MGI:3030564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 730 transcript_id : NM_146493.2

name	Olfr731 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529466 GeneID:258360 MGI:3030565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 731 transcript_id : NM_146363.2

name	Olfr732 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239003 GeneID:258659 MGI:3030566
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 732 transcript_id : NM_146665.1

name	Olfr733 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239005 GeneID:258657 MGI:3030567
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 733 transcript_id : NM_146663.1

name	Olfr734 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239001 GeneID:258658 MGI:3030568
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 734 transcript_id : NM_146664.1

name	Olfr735 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801295 GeneID:257909 MGI:3030569
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 735 transcript_id : NM_001011754.1

name	Tlr11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45429991 GeneID:239081 MGI:3045226
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 11 transcript_id : NM_205819.1

name	Olfr736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239345 GeneID:258660 MGI:3030570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 736 transcript_id : NM_146666.1

name	Olfr738 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239349 GeneID:258662 MGI:3030572
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 738 transcript_id : NM_146420.1

name	Olfr739 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122056743 GeneID:258663 MGI:3030573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 739 transcript_id : NM_146668.2

name	Olfr740 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239351 GeneID:258661 MGI:3030574
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 740 transcript_id : NM_146667.1

name	Olfr741 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821671 GeneID:258233 MGI:3030575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 741 transcript_id : NM_207133.2

name	Olfr742 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239347 GeneID:258422 MGI:3030576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 742 transcript_id : NM_146430.1

name	Olfr744 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801269 GeneID:257884 MGI:3030578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 744 transcript_id : NM_001011738.1

name	Olfr745 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129690 GeneID:258296 MGI:3030579
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 745 transcript_id : NM_146299.1

name	Olfr746 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129688 GeneID:258295 MGI:3030580
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 746 transcript_id : NM_146298.1

name	Olfr747 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112982847 GeneID:258264 MGI:3030581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 747 transcript_id : NM_207156.2

name	Olfr748 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801435 GeneID:258113 MGI:3030582
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 748 transcript_id : NM_001011837.1

name	Olfr749 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9938009 GeneID:56858 MGI:3030583
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 749 transcript_id : NM_020288.1

name	Ttc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358947 GeneID:219022 MGI:2683584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 5 transcript_id : NM_001080949.1

name	Ttc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358951 GeneID:219022 MGI:2683584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 5 transcript_id : NM_177625.3

name	Gm288 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265636 GeneID:239083 MGI:2685134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : gene model 288, (NCBI) transcript_id : XM_139038.5

name	Parp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475961 GeneID:11546 MGI:1341112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 2 transcript_id : NM_009632.2

name	Tep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350001 GeneID:21745 MGI:109573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : telomerase associated protein 1 transcript_id : NM_009351.2

name	Osgep (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662767 GeneID:66246 MGI:1913496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : O-sialoglycoprotein endopeptidase transcript_id : NM_133676.2

name	Apex1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753085 GeneID:11792 MGI:88042
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apurinic/apyrimidinic endonuclease 1 transcript_id : NM_009687.1

name	Tmem55b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802872 GeneID:219024 MGI:2448501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 55b transcript_id : NM_001033271.2

name	Pnp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368657 GeneID:18950 MGI:97365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purine-nucleoside phosphorylase transcript_id : NM_013632.3

name	LOC667034 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265644 GeneID:667034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 166 ESTs, 8 Proteins product : similar to purine nucleoside phosphorylase, transcript variant 2 transcript_id : XM_992906.2

name	LOC667034 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397054 GeneID:667034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 96 ESTs, 9 Proteins product : similar to purine nucleoside phosphorylase, transcript variant 1 transcript_id : XM_992876.1

name	Rnase10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362945 GeneID:75019 MGI:1922269
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 10 (non-active) transcript_id : NM_029145.2

name	Rnase9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200344 GeneID:328401 MGI:3057273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 9 (non-active) transcript_id : NM_183032.2

name	Rnase11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858546 GeneID:497113 MGI:3528583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 11 (non-active) transcript_id : NM_001011877.1

name	Rnase12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858540 GeneID:497106 MGI:3528588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 12 (non-active) transcript_id : NM_001011875.1

name	Olfr750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430567 GeneID:404319 MGI:3030584
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 750 transcript_id : NM_207558.1

name	Rnase4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801947 GeneID:58809 MGI:1926217
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family 4 transcript_id : NM_021472.3

name	Rnase4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802794 GeneID:58809 MGI:1926217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family 4 transcript_id : NM_201239.2

name	Ang1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254650 GeneID:11727 MGI:88022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiogenin, ribonuclease A family, member 1 transcript_id : NM_007447.2

name	Gm75 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45356140 GeneID:219026 MGI:2684921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 75, (NCBI) transcript_id : NM_203508.1

name	Rnase6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45433496 GeneID:78416 MGI:1925666
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 6 transcript_id : NM_030098.1

name	Rnase1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981519 GeneID:19752 MGI:97919
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease, RNase A family, 1 (pancreatic) transcript_id : NM_011271.2

name	Ear5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506558 GeneID:54159 MGI:1858598
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 5 transcript_id : NM_019398.1

name	Ang2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112818585 GeneID:11731 MGI:104984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiogenin, ribonuclease A family, member 2 transcript_id : NM_007449.2

name	Ear14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59933229 GeneID:503847 MGI:3528616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 14 transcript_id : NM_017389.2

name	Ear11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981459 GeneID:93726 MGI:1890465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eosinophil-associated, ribonuclease A family, member 11 transcript_id : NM_053113.2

name	EG638695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85986666 GeneID:638695 MGI:3643454
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG638695 transcript_id : NM_001039250.1

name	LOC100042224 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265533 GeneID:100042224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Patatin-like phospholipase domain containing 4 transcript_id : XM_001477754.1

name	V2r10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678530 GeneID:22301 MGI:1316707
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 10 transcript_id : NM_009487.1

name	V2r10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376151 GeneID:22301 MGI:1316707
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 10 transcript_id : NM_009486.2

name	LOC100043041 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265651 GeneID:100043041
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : similar to gag polyprotein transcript_id : XM_001479251.1

name	Slc35f4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037407 CCDS:CCDS26997.1 GeneID:75288 MGI:1922538
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : solute carrier family 35, member F4 protein_id : NP_083514.1

name	3632451O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385650 GeneID:67419 MGI:1914669
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67419 protein_id : NP_080418.1

name	Olfr722 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239000 CCDS:CCDS26998.1 GeneID:258487 MGI:3030556
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5566715-5565789; olfactory receptor MOR241-3 product : olfactory receptor 722 protein_id : NP_666705.1

name	Olfr723 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372134 CCDS:CCDS26999.1 GeneID:259147 MGI:3030557
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-5600424-5599495; olfactory receptor MOR247-3P product : olfactory receptor 723 protein_id : NP_001011530.1

name	Olfr724 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238972 CCDS:CCDS27000.1 GeneID:258485 MGI:3030558
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-5645801-5644872; olfactory receptor MOR247-2 product : olfactory receptor 724 protein_id : NP_666703.1

name	LOC100041975 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265523 GeneID:100041975
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477359.1

name	Olfr725 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129657 GeneID:258314 MGI:3030559
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PMLR-5725741-5724776; olfactory receptor MOR246-3 product : olfactory receptor 725 protein_id : NP_666429.1

name	LOC100042882 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265628 GeneID:100042882
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478943.1

name	Olfr726 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247413 CCDS:CCDS27002.1 GeneID:258313 MGI:3030560
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5775299-5774334; olfactory receptor MOR246-4 product : olfactory receptor 726 protein_id : NP_666428.2

name	Olfr727 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129659 CCDS:CCDS27003.1 GeneID:258316 MGI:3030561
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-5817082-5818056; olfactory receptor MOR246-2 product : olfactory receptor 727 protein_id : NP_666431.1

name	Olfr728 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801384 CCDS:CCDS27004.1 GeneID:258039 MGI:3030562
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5831021-5830086; olfactory receptor MOR246-1P product : olfactory receptor 728 protein_id : NP_001011809.1

name	Olfr729 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129731 CCDS:CCDS27005.1 GeneID:258275 MGI:3030563
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5839874-5838903; olfactory receptor MOR246-6 product : olfactory receptor 729 protein_id : NP_666390.1

name	Olfr730 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174776 CCDS:CCDS27006.1 GeneID:258486 MGI:3030564
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5881670-5880717; olfactory receptor MOR247-1 product : olfactory receptor 730 protein_id : NP_666704.2

name	Olfr731 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529467 CCDS:CCDS27007.1 GeneID:258360 MGI:3030565
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5936117-5935137; olfactory receptor MOR246-5 product : olfactory receptor 731 protein_id : NP_666475.2

name	Olfr732 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239004 CCDS:CCDS27008.1 GeneID:258659 MGI:3030566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-5975274-5974348; olfactory receptor MOR241-1 product : olfactory receptor 732 protein_id : NP_666876.1

name	Olfr733 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239006 CCDS:CCDS27009.1 GeneID:258657 MGI:3030567
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-5992342-5991416; olfactory receptor MOR241-2 product : olfactory receptor 733 protein_id : NP_666874.1

name	Olfr734 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239002 CCDS:CCDS27010.1 GeneID:258658 MGI:3030568
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6013665-6012724; olfactory receptor MOR242-1 product : olfactory receptor 734 protein_id : NP_666875.1

name	Olfr735 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801296 CCDS:CCDS27011.1 GeneID:257909 MGI:3030569
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6042130-6041183; olfactory receptor MOR243-1 product : olfactory receptor 735 protein_id : NP_001011754.1

name	Tlr11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45429992 CCDS:CCDS27012.1 GeneID:239081 MGI:3045226
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0009617 - response to bacterium [Evidence IMP] codon_start : 1 product : toll-like receptor 11 protein_id : NP_991388.1

name	Olfr736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239346 CCDS:CCDS27013.1 GeneID:258660 MGI:3030570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6089963-6090901; olfactory receptor MOR106-5 product : olfactory receptor 736 protein_id : NP_666877.1

name	Olfr738 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239350 CCDS:CCDS27014.1 GeneID:258662 MGI:3030572
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6110726-6111661; olfactory receptor MOR106-3 product : olfactory receptor 738 protein_id : NP_666532.1

name	Olfr739 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122056744 CCDS:CCDS27015.1 GeneID:258663 MGI:3030573
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6121675-6122604; olfactory receptor MOR106-2 product : olfactory receptor 739 protein_id : NP_666879.2

name	Olfr740 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239352 CCDS:CCDS27016.1 GeneID:258661 MGI:3030574
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6167145-6168080; olfactory receptor MOR106-4 product : olfactory receptor 740 protein_id : NP_666878.1

name	Olfr741 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821672 CCDS:CCDS27017.1 GeneID:258233 MGI:3030575
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6197851-6198786; olfactory receptor MOR106-10 product : olfactory receptor 741 protein_id : NP_997016.2

name	Olfr742 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239348 CCDS:CCDS27018.1 GeneID:258422 MGI:3030576
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6224293-6225228; olfactory receptor MOR106-6 product : olfactory receptor 742 protein_id : NP_666641.1

name	Olfr744 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801270 CCDS:CCDS27019.1 GeneID:257884 MGI:3030578
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6326342-6327313; olfactory receptor MOR106-13P; odorant receptor S3; G-protein-coupled receptor product : olfactory receptor 744 protein_id : NP_001011738.1

name	Olfr745 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129691 CCDS:CCDS27020.1 GeneID:258296 MGI:3030579
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6361495-6362481; olfactory receptor MOR106-11 product : olfactory receptor 745 protein_id : NP_666411.1

name	Olfr746 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129689 CCDS:CCDS27021.1 GeneID:258295 MGI:3030580
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6372116-6373060; olfactory receptor MOR106-12 product : olfactory receptor 746 protein_id : NP_666410.1

name	Olfr747 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112982848 CCDS:CCDS27022.1 GeneID:258264 MGI:3030581
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PMLR-6420220-6419279; olfactory receptor MOR106-7 product : olfactory receptor 747 protein_id : NP_997039.2

name	Olfr748 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801436 CCDS:CCDS27023.1 GeneID:258113 MGI:3030582
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6454789-6455712; olfactory receptor MOR106-9P product : olfactory receptor 748 protein_id : NP_001011837.1

name	Olfr749 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9938010 GeneID:56858 MGI:3030583
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GA_x6K02T2PMLR-6484046-6483105 product : odorant receptor S1 protein_id : NP_064684.1

name	Ttc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358948 GeneID:219022 MGI:2683584
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : tetratricopeptide repeat domain 5 isoform a protein_id : NP_001074418.1

name	Ttc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244012 GeneID:219022 MGI:2683584
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : tetratricopeptide repeat domain 5 isoform b protein_id : NP_808293.1

name	Gm288 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38076082 GeneID:239083 MGI:2685134
definition	codon_start : 1 product : similar to Cyclin B1 interacting protein 1 protein_id : XP_139038.2

name	Parp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752992 CCDS:CCDS27025.1 GeneID:11546 MGI:1341112
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IMP]; GO:0006281 - DNA repair [Evidence TAS]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 note : ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) 2; ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2; ADP-ribosyltransferase (NAD+, poly(ADP-ribose) polymerase)-like 2 product : poly (ADP-ribose) polymerase family, member 2 protein_id : NP_033762.1

name	Tep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678285 GeneID:21745 MGI:109573
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0016363 - nuclear matrix [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003723 - RNA binding [Evidence IMP] [Evidence IEA] GO_process : GO:0000723 - telomere maintenance [Evidence IEA]; GO:0007004 - telomere maintenance via telomerase [Evidence IGI] codon_start : 1 product : telomerase associated protein 1 protein_id : NP_033377.1

name	Osgep (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662768 CCDS:CCDS27026.1 GeneID:66246 MGI:1913496
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : O-sialoglycoprotein endopeptidase protein_id : NP_598437.2

name	Apex1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753086 CCDS:CCDS27027.1 GeneID:11792 MGI:88042
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS]; GO:0005840 - ribosome [Evidence ISS] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence ISS]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA] [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence ISS]; GO:0004528 - phosphodiesterase I activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0004523 - ribonuclease H activity [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0006284 - base-excision repair [Evidence ISS]; GO:0006281 - DNA repair [Evidence IEA]; GO:0030503 - regulation of cell redox homeostasis [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 function : DNA repair enzyme product : apurinic/apyrimidinic endonuclease 1 protein_id : NP_033817.1

name	Tmem55b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84095197 CCDS:CCDS27028.1 GeneID:219024 MGI:2448501
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : transmembrane protein 55b protein_id : NP_001028443.1

name	Pnp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305395 CCDS:CCDS27029.1 GeneID:18950 MGI:97365
definition	GO_function : GO:0004731 - purine-nucleoside phosphorylase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016763 - transferase activity, transferring pentosyl groups [Evidence IEA] GO_process : GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA]; GO:0042278 - purine nucleoside metabolism [Evidence IC] codon_start : 1 note : purine-nucleoside phopshorylase product : purine-nucleoside phosphorylase protein_id : NP_038660.1

name	LOC667034 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397057 GeneID:667034
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_998000.1

name	LOC667034 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397055 GeneID:667034
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_997970.1

name	Rnase10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037393 CCDS:CCDS27030.1 GeneID:75019 MGI:1922269
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ribonuclease A family, member 10 product : RNase 10 protein_id : NP_083421.1

name	Rnase9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200345 GeneID:328401 MGI:3057273
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : epididymal RNase; ribonuclease A family, member 9; epididymis-specific RNase-like product : ribonuclease, RNase A family, 9 (non-active) protein_id : NP_898853.2

name	Rnase11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858547 CCDS:CCDS27031.1 GeneID:497113 MGI:3528583
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : ribonuclease 11 product : ribonuclease, RNase A family, 11 (non-active) protein_id : NP_001011877.1

name	Rnase12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858541 CCDS:CCDS27032.1 GeneID:497106 MGI:3528588
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : ribonuclease 12 product : ribonuclease, RNase A family, 12 (non-active) protein_id : NP_001011875.1

name	Olfr750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430568 CCDS:CCDS27033.1 GeneID:404319 MGI:3030584
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PMLR-6808276-6807281 product : olfactory receptor 750 protein_id : NP_997441.1

name	Ang1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680688 CCDS:CCDS27034.1 GeneID:11727 MGI:88022
definition	GO_component : GO:0005605 - basal lamina [Evidence ISS]; GO:0005615 - extracellular space [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003779 - actin binding [Evidence ISS]; GO:0005507 - copper ion binding [Evidence ISS]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0008201 - heparin binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS]; GO:0004540 - ribonuclease activity [Evidence ISS] GO_process : GO:0030041 - actin filament polymerization [Evidence ISS]; GO:0001525 - angiogenesis [Evidence IEA] [Evidence ISS]; GO:0043006 - calcium-dependent phospholipase A2 activation [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006651 - diacylglycerol biosynthesis [Evidence ISS]; GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0048662 - negative regulation of smooth muscle cell proliferation [Evidence ISS]; GO:0007202 - phospholipase C activation [Evidence ISS]; GO:0001938 - positive regulation of endothelial cell proliferation [Evidence ISS]; GO:0050714 - positive regulation of protein secretion [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence ISS]; GO:0009303 - rRNA transcription [Evidence ISS] codon_start : 1 product : angiogenin, ribonuclease A family, member 1 protein_id : NP_031473.1

name	Rnase4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47679082 CCDS:CCDS27035.1 GeneID:58809 MGI:1926217
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : ribonuclease 4 product : ribonuclease, RNase A family 4 protein_id : NP_067447.2

name	Rnase4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47679097 CCDS:CCDS27035.1 GeneID:58809 MGI:1926217
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : ribonuclease 4 product : ribonuclease, RNase A family 4 protein_id : NP_957691.1

name	Gm75 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45356141 CCDS:CCDS27036.1 GeneID:219026 MGI:2684921
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 product : epididymal secretory protein 3 protein_id : NP_987104.1

name	Rnase6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45433497 CCDS:CCDS27037.1 GeneID:78416 MGI:1925666
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ribonuclease A family, member 6 product : ribonuclease, RNase A family, 6 protein_id : NP_084374.1

name	Rnase1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981520 CCDS:CCDS27038.1 GeneID:19752 MGI:97919
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : ribonuclease 1, pancreatic product : pancreatic ribonuclease protein_id : NP_035401.2

name	Ear5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506559 CCDS:CCDS27039.1 GeneID:54159 MGI:1858598
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : murine ribonuclease 5; eosinophil-associated ribonuclease 5 product : eosinophil-associated, ribonuclease A family, member 5 protein_id : NP_062271.1

name	Ang2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112818586 CCDS:CCDS27040.1 GeneID:11731 MGI:104984
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 note : angiogenin related protein product : angiogenin, ribonuclease A family, member 2 precursor protein_id : NP_031475.2

name	Ear14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59933230 GeneID:503847 MGI:3528616
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004522 - pancreatic ribonuclease activity [Evidence IEA] codon_start : 1 product : eosinophil-associated, ribonuclease A family, member 14 protein_id : NP_059085.2

name	Ear11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981460 CCDS:CCDS27041.1 GeneID:93726 MGI:1890465
definition	GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0004540 - ribonuclease activity [Evidence ISS] codon_start : 1 note : eosinophil-associated ribonuclease 11 product : eosinophil-associated, ribonuclease A family, member 11 protein_id : NP_444343.2

name	EG638695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986667 GeneID:638695 MGI:3643454
definition	codon_start : 1 product : hypothetical protein LOC638695 protein_id : NP_001034339.1

name	LOC100042224 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265534 GeneID:100042224
definition	codon_start : 1 product : similar to Patatin-like phospholipase domain containing 4 protein_id : XP_001477804.1

name	V2r10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678531 GeneID:22301 MGI:1316707
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; vomeronasal organ family 2, receptor, 10; vomeronasal 2, receptor, 11; vomeronasal organ family 2, receptor, 11 product : vomeronasal 2, receptor, 10 isoform 2 protein_id : NP_033513.1

name	V2r10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678529 GeneID:22301 MGI:1316707
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; vomeronasal organ family 2, receptor, 10; vomeronasal 2, receptor, 11; vomeronasal organ family 2, receptor, 11 product : vomeronasal 2, receptor, 10 isoform 1 protein_id : NP_033512.1

name	LOC100043041 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265652 GeneID:100043041
definition	codon_start : 1 product : similar to gag polyprotein protein_id : XP_001479301.1

name	LOC667006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667006
definition	number : 1 pseudo : _no_value

name	LOC667006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667006
definition	number : 2 pseudo : _no_value

name	LOC667006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667006
definition	number : 3 pseudo : _no_value

name	LOC667006 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667006
definition	number : 4 pseudo : _no_value

name	EG546611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546611
definition	number : 6 pseudo : _no_value

name	EG546611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546611
definition	number : 5 pseudo : _no_value

name	EG546611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546611
definition	number : 4 pseudo : _no_value

name	EG546611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546611
definition	number : 3 pseudo : _no_value

name	EG546611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546611
definition	number : 2 pseudo : _no_value

name	EG546611 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546611
definition	number : 1 pseudo : _no_value

name	LOC100042187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042187
definition	number : 1 pseudo : _no_value

name	EG633215 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633215
definition	number : 1 pseudo : _no_value

name	LOC100042203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042203
definition	number : 3 pseudo : _no_value

name	LOC100042203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042203
definition	number : 2 pseudo : _no_value

name	LOC100042203 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042203
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671357
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671357
definition	number : 2 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 1 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 2 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 3 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 4 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 5 pseudo : _no_value

name	Vmn2r88 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669149
definition	number : 6 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 1 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 2 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 3 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 4 pseudo : _no_value

name	LOC100042247 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042247
definition	number : 5 pseudo : _no_value

name	Rpph1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:46402165 GeneID:85029 MGI:1934664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease P RNA component H1 transcript_id : NR_002142.1

name	LOC667210 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265645 GeneID:667210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 4 Proteins product : similar to Coiled-coil domain containing 12 pseudo : _no_value transcript_id : XR_034058.1

name	LOC633238 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265650 GeneID:633238
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 19 Proteins product : similar to cyclin-dependent kinase 8 pseudo : _no_value transcript_id : XR_034121.1

clone name	MSMg01-353I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438L17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-290J24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-290L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-311F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-527N17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-116E16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-148F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178B15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-340A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-064A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-182L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-049G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-404A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-191P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-512B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-149B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-193H09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-359E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154C08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-275F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-423H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-267L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-457F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-054H21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-157A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-106G12.b	B6Ng01-106G12.g
ACC	DH914157	DH914158
length	785	1,169
definition	DH914157\|Mus musculus domesticus DNA, BAC clone: B6Ng01-106G12, 5' end.	DH914158\|Mus musculus domesticus DNA, BAC clone: B6Ng01-106G12, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaccctaggaataccgaatggcttttgaagcacctgaaaaaat gttcagcctccttaatcatcagggaaatgcaaatcaaaacaaccctgaga ttccatctcacaccagtcagaatgactaagatcaaaaattcaggtgacag cagatgctggcgaggatgtggagaaagagggacactctgccattgttggt gggattgcaaacttgtacaaccactctggaaatcagtctggtggttcctc agaaaattgtacatagtactaccagacgaccccgcaacacctctcctggg catatacccagaagatgttccaaccggtaagaaggacacatgctcctcca tgttcatagcagccttatttataatatccagggatccattccataatcag actccaaacgatgacaccattgcatacactagcaagagtttgctgaaagg accctgatatagctgtctcttgtgagactaggccagggcctagcaaagac ataagtggatgctcacagtcagctattcaatggatcacagggccccaatg gaggagctagacaaagtatccaaggagctaaagagatctgcaaccctgtt ggtgcaacaacattatgaactaaccagtaccccggagctcttgactctag ctgcatatgtatcaaatgatgacctagttggccatcactggaatgagagg tccattggacatgcaaactttatatgccccagtacaggggaacgccaggg gccaaaaagtgggaatggggtgggtaggggagtgg	gaattcttctcaaatgtgtatttaattgccataatccatgctggggtctc attttccatgacattactgcttttagatagatgttcttgagagtttaatt ttataagtacaataaagagcactaagtggactccagctgcttaacaaata ctatttatctaattctcaaaacaaatgacatgggcaggactgttaccatc cattttccaacacatgaagaagttgtatcttgtctaacatacacagcaca aaggctgaccttaaccctgatggtctagctctggaacctgggcatttcca cacatacatttcgggccaatgaagccatggaatatgctgacatatatatt gtctgaattggtggaaagttaactagtaaaaatgtaaaacatgacctcta cttggtttatgagacagctttaacgggaaagaaaataaccataaaaaaca cctaggacattaaagtatcgtccagaattccacagagccctgacctccta cttctaaatcccgatttgtgggacacaacagaaagtagtcaataccagaa ggaacagatcaattcacaacaatatgttagcaaaggagattcatatttaa gcactaactgacaaagaataagtaacagcagtctagtgaaaacttaactt ttccttaactcacatataactttattaacattgaaagctttcaaaagttt cctactttgcaggagactatcttatagcttatccttgggaaactaccctg agagggagcttcataaaaccacacactgcatgatgttaataaaaactcaa cagctccaacctcaatacagataagaaataatttatctacatggatgcct ttagcctagaagcacaaacgcaggttgtctcaaaaagaccattaacactt gaaatgcttaccattgtattttattgattgcacattaaagaaattgttta aatttataaatttatcaaacctctgtgaatgtgtgaaagttaaatatctt tttgtcctcaaggcattataaaagcttgttgtcttggaaagtaagtctga agaagcaggaaaacagtcttcaggagaggaaactgtaaatttactatgag ttagtccttggagaaatcaattaacaggcttataaaggggggatcttttt tattcacctctgaaactaa
quality values	Open. Hide. 10 21 6 14 19 55 47 38 19 52 55 55 61 61 52 23 18 13 13 12 13 59 59 59 31 27 35 22 9 12 10 12 11 9 12 11 45 59 52 59 59 61 59 59 59 61 59 61 55 44 59 59 59 59 59 59 59 61 59 61 61 59 59 59 59 61 61 59 61 59 59 49 61 59 34 55 55 44 59 50 41 41 59 59 59 52 52 59 44 59 59 59 61 59 49 59 41 35 32 59 59 61 61 61 59 61 59 61 59 59 59 59 44 59 59 52 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 59 59 59 59 59 59 61 61 61 61 59 61 61 61 59 61 59 59 61 59 59 61 61 61 59 59 59 59 44 44 55 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 59 61 61 61 61 61 59 61 59 52 59 59 59 55 61 61 59 59 61 59 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 59 61 61 61 59 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 59 52 52 52 59 49 52 61 61 59 59 59 59 59 61 59 61 61 61 59 49 59 52 59 52 59 59 59 61 61 45 61 59 59 59 59 59 59 59 59 59 59 59 59 59 61 61 61 61 61 59 59 59 59 59 61 61 61 61 59 59 55 55 59 59 59 52 59 59 59 52 59 49 59 52 43 52 52 39 61 61 61 61 61 59 61 61 59 61 59 61 61 61 59 59 59 59 52 59 61 61 61 59 59 59 59 59 59 59 52 59 59 52 41 59 43 43 61 61 61 59 59 59 52 59 59 37 50 44 35 37 49 33 35 44 36 52 59 59 49 49 59 59 59 52 59 43 30 19 44 36 45 59 61 59 61 52 45 52 30 44 36 59 45 49 59 61 61 59 59 59 59 61 61 61 61 61 61 59 59 61 61 59 43 59 59 59 59 59 59 61 61 59 61 59 61 61 59 59 59 61 59 61 52 59 36 59 52 59 36 52 49 59 61 59 61 36 28 49 29 33 27 52 52 52 52 52 52 52 52 43 36 36 36 33 43 43 43 41 49 52 52 52 52 49 19 37 49 52 33 43 52 43 37 43 37 28 52 43 26 37 37 37 24 31 35 30 37 43 41 55 37 19 21 13 14 11 55 37 24 43 23 22 29 49 43 49 43 34 49 37 55 55 50 50 55 31 55 55 50 55 55 55 39 50 50 39 43 31 21 21 19 19 32 35 36 50 61 61 43 53 53 47 43 50 50 50 61 50 47 38 35 42 33 45 33 29 34 34 31 13 14 10 8 14 18 13 19 19 24 30 28 47 34 39 61 47 43 26 47 27 39 52 28 30 19 47 47 53 53 42 31 61 30 40 27 24 22 31 22 13 10 21 18 21 14 12 11 20 20 20 26 20 10 31 17 21 16 31 34 24 43 40 35 36 25 47 47 26 38 29 45 45 27 45 28 45 28 28 16 16 33 32 43 29 35 36 30 30 22 30 35 38 21 26 38 32 42 21 53 31 39 34 23 23 20 28 29 16 37 29 35 42 27 47 24 26 37 34 30 23 28 29 13 12 14 34 19 14 22 27 27 26 38 31 23 26 31 30 30 19 21 10 16 22 20 16 7 13 37 31 14 23 17 28 23 22 27 14 12 16 8	Open. Hide. 61 61 52 59 34 38 23 22 27 22 19 18 19 23 35 61 40 59 59 59 59 59 61 59 61 61 61 59 59 59 59 59 59 61 61 55 44 59 59 61 59 59 61 61 61 55 59 61 59 59 41 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 59 61 59 59 59 59 59 59 59 61 61 59 59 61 61 61 61 61 61 59 61 61 55 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 52 61 59 59 59 61 61 61 61 61 61 61 61 61 59 59 59 55 59 61 61 61 61 61 61 43 52 59 43 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 52 59 52 59 59 59 59 61 59 59 59 50 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 19 16 9 12 13 19 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 55 52 55 52 61 61 61 61 61 61 55 61 61 61 52 43 55 55 52 52 55 55 52 52 52 52 61 61 61 61 52 55 55 61 55 55 61 61 55 61 55 61 52 55 55 55 61 50 47 55 55 55 55 61 61 55 50 55 55 50 50 61 55 55 61 55 61 61 61 61 55 61 61 61 61 61 61 61 55 50 61 55 61 47 55 50 55 38 55 55 50 37 61 61 61 47 55 50 49 52 53 45 53 53 53 61 61 53 50 61 53 53 61 61 61 61 52 43 53 47 43 39 43 47 52 53 35 50 43 52 53 39 39 53 50 61 61 50 61 38 32 37 20 35 50 53 61 53 42 43 31 61 53 39 61 61 43 61 47 34 40 34 35 34 45 61 61 36 47 61 61 53 50 39 61 61 53 53 61 27 61 37 42 47 43 47 43 42 45 50 42 45 50 53 32 39 45 35 53 38 47 47 42 45 43 30 38 34 45 50 57 53 36 47 46 47 50 50 38 47 46 45 35 50 39 43 38 50 28 53 47 47 47 46 42 46 45 27 53 43 30 39 18 28 47 47 37 25 17 47 53 24 33 29 53 47 20 26 42 42 28 29 34 24 31 18 9 15 17 50 38 23 12 32 26 10 31 21 31 45 45 42 33 45 34 36 24 18 26 50 38 21 21 33 32 30 30 38 53 57 52 57 19 23 32 28 45 47 53 32 26 38 16 32 13 32 38 45 17 33 30 27 42 13 17 36 37 36 17 8 9 33 21 12 30 21 24 27 39 23 24 24 37 22 10 50 37 38 38 27 23 21 53 47 37 30 31 28 37 20 30 37 23 17 33 33 17 14 15 16 11 17 8 14 20 15 12 31 29 24 6 30 28 9 26 13 34 34 36 20 10 16 10 30 21 33 28 27 10 22 24 18 29 23 30 40 28 34 21 27 11 10 20 10 17 23 20 19 33 9 28 25 8 24 13 20 7 40 28 23 15 36 8 6 7 5 12 14 9 19 28 23 20 45 45 45 18 12 18 6 6 6 5 13 6 9 9 7 6 16 23 32 32 46 25 21 10 10 24 29 14 20 14 11 32 21 43 18 14 28 28 46 28 25 16 31 18 13 27 29 18 11 6 13 17 33 31 31 51 18 22 24 39 15 5 14 21 11 5 10 6 35 32 29 30 29 14 19 14 27 5 10 39 35 10 15 15 21 27 14 5 5 8 10 11 9 5 9 15 18 6 8 5 8 6 20 9 31 12 7 11 14 13 23 17 7 5 10 23 34 46 43 41 6 14 7 20 36 13 22 7 5 6 9 20 26 20 17 5 6 10 51 51 29 21 23 17 17 25 8 7 7 5 9 5 6 20 15 34 51 9 7 6 12 9 9 7 9 7 7 6 16 6 23 22 14 13 6 9 16 27 38 38 26 22 17 7 8 11 13 38 19 13 23 12 7 5 20 9 19 18 30 12 9 6 6 6 13 30 20 12 6 4 6 10 13 9 3 13 6 6 13 22 22 11 11 20 27 14 18 13 8 6 3 3 3 4 6 6 6 16 4 5 4 6 17 8 23 23 7 29 5 5 6 25 31 13 14 22 14 7 7 3 4 29 10 9 14 36 17 22 17 6 6 8 15 5 12 13 4 4 2 3 9 27 11 7 5 4 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_51142265_51143437
seq2: B6Ng01-106G12.g_69_1237

seq1  GAATTCTTCTCAAATGTGTATTTAATTGCCATAATCCATGCTGGGGTCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCTCAAATGTGTATTTAATTGCCATAATCCATGCTGGGGTCTC  50

seq1  ATTTTCCATGACATTACTGCTTTTAGATAGATGTTCTTGAGAGTTTAATT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCCATGACATTACTGCTTTTAGATAGATGTTCTTGAGAGTTTAATT  100

seq1  TTATAAGTACAATAAAGAGCACTAAGTGGACTCCAGCTGCTTAACAAATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAGTACAATAAAGAGCACTAAGTGGACTCCAGCTGCTTAACAAATA  150

seq1  CTATTTATCTAATTCTCAAAACAAATGACATGGGCAGGACTGTTACCATC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTATCTAATTCTCAAAACAAATGACATGGGCAGGACTGTTACCATC  200

seq1  CATTTTCCAACACATGAAGAAGTTGTATCTTGTCTAACATACACAGCACA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTCCAACACATGAAGAAGTTGTATCTTGTCTAACATACACAGCACA  250

seq1  AAGGCTGACCTTAACCCTGATGGTCTAGCTCTGGAACCTGGGCATTTCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGCTGACCTTAACCCTGATGGTCTAGCTCTGGAACCTGGGCATTTCCA  300

seq1  CACATACATTTCGGGCCAATGAAGCCATGGAATATGCTGACATATATATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATACATTTCGGGCCAATGAAGCCATGGAATATGCTGACATATATATT  350

seq1  GTCTGAATTGGTGGAAAGTTAACTAGTAAAAATGTAAAACATGACCTCTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGAATTGGTGGAAAGTTAACTAGTAAAAATGTAAAACATGACCTCTA  400

seq1  CTTGGTTTATGAGACAGCTTTAACGGGAAAGAAAATAACCATAAAAAACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGTTTATGAGACAGCTTTAACGGGAAAGAAAATAACCATAAAAAACA  450

seq1  CCTAGGACATTAAAGTATCGTCCAGAATTCCACAGAGCCCTGACCTCCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGGACATTAAAGTATCGTCCAGAATTCCACAGAGCCCTGACCTCCTA  500

seq1  CTTCTAAATCCCGATTTGTGGGACACAACAGAAAGTAGTCAATACCAGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTAAATCCCGATTTGTGGGACACAACAGAAAGTAGTCAATACCAGAA  550

seq1  GGAACAGATCAATTCACAACAATATGTTAGCAAAGGAGATTCATATTTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACAGATCAATTCACAACAATATGTTAGCAAAGGAGATTCATATTTAA  600

seq1  GCACTAACTGACAAAGAATAAGTAACAGCAGTCTAGTGAAAACTTAACTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTAACTGACAAAGAATAAGTAACAGCAGTCTAGTGAAAACTTAACTT  650

seq1  TTCCTTAACTCACATATAACTTTATTAACATTGAAAGCTTTCAAAAGTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTTAACTCACATATAACTTTATTAACATTGAAAGCTTTCAAAAGTTT  700

seq1  CCTACTTTGCAGGAGACTATCTTATAGCTTATCCTTGGGAAACTACCCTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTACTTTGCAGGAGACTATCTTATAGCTTATCCTTGGGAAACTACCCTG  750

seq1  AGAGGGAGCTTCATAAAACAACACACTGCATGATGTTAATAAAAACTCAA  800
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  AGAGGGAGCTTCATAAAACCACACACTGCATGATGTTAATAAAAACTCAA  800

seq1  CAGCTCCAACCTCAATACAGATAAGAAATAATTTAATCTACATGGATGCC  850
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  CAGCTCCAACCTCAATACAGATAAGAAATAATTT-ATCTACATGGATGCC  849

seq1  TATAGCCTAGAAGCACAAACGCAGGTTG-CTCAAAAAAGACAATT-ACAC  898
      | |||||||||||||||||||||||||| ||| |||||||| ||| ||||
seq2  TTTAGCCTAGAAGCACAAACGCAGGTTGTCTC-AAAAAGACCATTAACAC  898

seq1  TTTGAAATGCTTA-CATTGTATTTTATTGATTGCACATTAAAGAAA-TGT  946
       |||||||||||| |||||||||||||||||||||||||||||||| |||
seq2  -TTGAAATGCTTACCATTGTATTTTATTGATTGCACATTAAAGAAATTGT  947

seq1  ATAAATTTATAAATTTATCAAA-CTCTGTGAA--TGTGGAAGTTAAATAT  993
       ||||||||||||||||||||| |||||||||  |||| |||||||||||
seq2  TTAAATTTATAAATTTATCAAACCTCTGTGAATGTGTGAAAGTTAAATAT  997

seq1  C-TTTTGTCC-CACAGCATTATAAAAGCTTG-TGTCTGGAAAGGTAGGTC  1040
      | |||||||| ||  |||||||||||||||| ||||| | || ||| |||
seq2  CTTTTTGTCCTCAAGGCATTATAAAAGCTTGTTGTCTTGGAAAGTAAGTC  1047

seq1  TG-AGAAGCCAGGAAAACAGTCTTCAGGAGAGGAAACATGTAAATCTACT  1089
      || ||||| |||||||||||||||||||||||||||| ||||||| ||||
seq2  TGAAGAAG-CAGGAAAACAGTCTTCAGGAGAGGAAAC-TGTAAATTTACT  1095

seq1  AAGGAGTTAGTCCTTGAATGATATCAAATTTATCAGGCTTTATAAAAGGT  1139
       | ||||||||||||| | || |||||  ||| ||||| |||| ||||| 
seq2  -ATGAGTTAGTCCTTGGA-GAAATCAA--TTAACAGGC-TTAT-AAAGGG  1139

seq1  GTGATTTCTTTTTTATTCCACCCTCTGAAACTAA  1173
      | ||  ||||||||||||   |||||||||||||
seq2  GGGA--TCTTTTTTATTC--ACCTCTGAAACTAA  1169

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information