MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-150C06
Chromosome	14 (Build37)
Map Location	43,247,839 - 43,249,000
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC666155, EG666156, LOC100040642, LOC100041729, LOC624277, LOC100041810, EG666186, LOC100041722, LOC100041841, EG666207, LOC666214, LOC632737, EG623168, LOC100041849, 1700016D02Rik, LOC100040726, LOC666228, LOC666233, LOC100041930, EG666152, EG385234, LOC100041950, LOC100041910, LOC674032, EG666239, LOC100040759, LOC100040771, EG666253, EG666264, LOC100040787, EG666280, EG666285, LOC666298, LOC100042031
Downstream gene	EG666318, EG546249, LOC100040863, LOC100040875, LOC100040890, LOC100042055, LOC635209, 1700091H14Rik, EG666415, LOC100040976, LOC100040983, LOC100042114, LOC666370, EG666376, LOC100041025, EG666396, LOC100041046, LOC100042130, LOC624893, LOC100041069, EG666420, LOC666436, EG638353, LOC666454, LOC100041106, EG638262, EG640992, EG666471, LOC666481, LOC100041143, EG666485, 1700049E17Rik, LOC666492, 1700001F09Rik, LOC673380, LOC100042326, EG666502, LOC545039, LOC100041227, LOC100041235, LOC100042342, LOC666322, EG666556
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666156 MGI:3648778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins

name	LOC100040642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins

name	LOC624277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	EG666186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666186 MGI:3644387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC100041722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins pseudo : _no_value

name	LOC100041841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	EG666207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666207 MGI:3647449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC666214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins pseudo : _no_value

name	LOC632737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG623168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623168 MGI:3645739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041849 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins

name	1700016D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75535 MGI:1922785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100040726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein pseudo : _no_value

name	LOC666228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC666233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein pseudo : _no_value

name	LOC100041930 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG666152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666152 MGI:3648771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG385234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385234 MGI:3645898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041910 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins

name	LOC674032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	EG666239 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666239 MGI:3643149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100040759 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein pseudo : _no_value

name	LOC100040771 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG666253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666253 MGI:3645411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	EG666264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666264 MGI:3648646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 11 Proteins pseudo : _no_value

name	LOC100040787 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666280 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666280 MGI:3647991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 Proteins

name	EG666285 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666285 MGI:3647989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins

name	LOC666298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042031 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	EG666318 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666318 MGI:3647083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG546249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546249 MGI:3646763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 5 Proteins pseudo : _no_value

name	LOC100040863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040875 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 5 Proteins

name	LOC100040890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100042055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 4 Proteins

name	LOC635209 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635209
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	1700091H14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73553 MGI:1920803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	EG666415 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666415 MGI:3642978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100040976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100040983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042114 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins

name	LOC666370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG666376 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666376 MGI:3646354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100041025 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666396 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666396 MGI:3646131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins

name	LOC100041046 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041046
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042130 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins

name	LOC624893 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100041069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG666420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666420 MGI:3645750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC666436 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins pseudo : _no_value

name	EG638353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638353 MGI:3646628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 5 Proteins pseudo : _no_value

name	LOC666454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins

name	EG638262 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638262 MGI:3648176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 14 Proteins pseudo : _no_value

name	EG640992 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640992 MGI:3645493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG666471 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666471 MGI:3648566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC666481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 15 Proteins pseudo : _no_value

name	LOC100041143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG666485 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666485 MGI:3646865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	1700049E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73415 MGI:1920665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC666492 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666492
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1700001F09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71826 MGI:1919076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC673380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100042326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	EG666502 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666502 MGI:3647466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC545039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins pseudo : _no_value

name	LOC100041227 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC100041235 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041235
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 1 Protein

name	LOC666322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG666556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666556 MGI:3644714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265394 GeneID:666156 MGI:3648778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins product : predicted gene, EG666156 transcript_id : XM_982027.2

name	LOC100041729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265491 GeneID:100041729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins product : hypothetical protein LOC100041729 transcript_id : XM_001477654.1

name	LOC100041810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265499 GeneID:100041810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : hypothetical protein LOC100041810 transcript_id : XM_001477696.1

name	EG666186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396935 GeneID:666186 MGI:3644387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666186 transcript_id : XM_982176.1

name	LOC100041841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265503 GeneID:100041841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041841, transcript variant 1 transcript_id : XM_001477713.1

name	LOC100041841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265505 GeneID:100041841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100041841, transcript variant 2 transcript_id : XM_001477723.1

name	EG666207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396937 GeneID:666207 MGI:3647449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666207 transcript_id : XM_982314.1

name	LOC632737 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265396 GeneID:632737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CDNA sequence BC061237 transcript_id : XM_001475077.1

name	EG623168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396921 GeneID:623168 MGI:3645739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG623168 transcript_id : XM_891604.2

name	LOC100041849 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265507 GeneID:100041849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins product : hypothetical protein LOC100041849 transcript_id : XM_001477735.1

name	1700016D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396940 GeneID:75535 MGI:1922785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 1700016D02 gene transcript_id : XM_982411.1

name	LOC100041930 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265517 GeneID:100041930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to Predicted gene, EG545047 transcript_id : XM_001477840.1

name	EG666152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396929 GeneID:666152 MGI:3648771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG666152 transcript_id : XM_988677.1

name	LOC100041950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265520 GeneID:100041950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041950 transcript_id : XM_001477872.1

name	LOC100041910 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265512 GeneID:100041910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins product : hypothetical protein LOC100041910 transcript_id : XM_001477788.1

name	LOC674032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265515 GeneID:674032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to CDNA sequence BC061237 transcript_id : XM_001477825.1

name	EG666239 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396942 GeneID:666239 MGI:3643149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG666239 transcript_id : XM_982515.1

name	EG666253 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265398 GeneID:666253 MGI:3645411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : predicted gene, EG666253 transcript_id : XM_982603.2

name	EG666280 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265400 GeneID:666280 MGI:3647991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 Proteins product : predicted gene, EG666280 transcript_id : XM_982721.2

name	EG666285 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265402 GeneID:666285 MGI:3647989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : predicted gene, EG666285 transcript_id : XM_982757.2

name	LOC100042031 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265524 GeneID:100042031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to CDNA sequence BC061237 transcript_id : XM_001477912.1

name	EG666318 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396952 GeneID:666318 MGI:3647083
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG666318 transcript_id : XM_983023.1

name	LOC100040875 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265408 GeneID:100040875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001475427.1

name	LOC100042055 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265526 GeneID:100042055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 4 Proteins product : hypothetical protein LOC100042055 transcript_id : XM_001477921.1

name	1700091H14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265413 GeneID:73553 MGI:1920803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 1700091H14 gene transcript_id : XM_983279.2

name	EG666415 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265415 GeneID:666415 MGI:3642978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : predicted gene, EG666415 transcript_id : XM_983688.2

name	LOC100040976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265418 GeneID:100040976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001475591.1

name	LOC100042114 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265529 GeneID:100042114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins product : hypothetical protein LOC100042114 transcript_id : XM_001477944.1

name	EG666376 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265421 GeneID:666376 MGI:3646354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : predicted gene, EG666376 transcript_id : XM_983444.2

name	EG666396 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265425 GeneID:666396 MGI:3646131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins product : predicted gene, EG666396 transcript_id : XM_983581.2

name	LOC100042130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265531 GeneID:100042130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 10 ESTs, 4 Proteins product : hypothetical protein LOC100042130 transcript_id : XM_001477972.1

name	EG666420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396966 GeneID:666420 MGI:3645750
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666420 transcript_id : XM_983726.1

name	LOC100041106 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265428 GeneID:100041106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to CDNA sequence BC061237 transcript_id : XM_001475808.1

name	EG666471 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396978 GeneID:666471 MGI:3648566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666471 transcript_id : XM_984060.1

name	LOC100041143 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265432 GeneID:100041143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100041143 transcript_id : XM_001475870.1

name	EG666485 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265434 GeneID:666485 MGI:3646865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG666485 transcript_id : XM_984157.2

name	1700049E17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265438 GeneID:73415 MGI:1920665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : RIKEN cDNA 1700049E17 gene transcript_id : XM_001475911.1

name	1700001F09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380583 GeneID:71826 MGI:1919076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700001F09 gene transcript_id : NM_027940.2

name	LOC100042326 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265540 GeneID:100042326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : hypothetical protein LOC100042326 transcript_id : XM_001478043.1

name	EG666502 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396982 GeneID:666502 MGI:3647466
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666502 transcript_id : XM_984287.1

name	LOC100042342 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265542 GeneID:100042342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 1 Protein product : similar to 1700001F09Rik protein transcript_id : XM_001478056.1

name	LOC666322 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265445 GeneID:666322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical LOC666322 transcript_id : XM_001476034.1

name	EG666156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265395 GeneID:666156 MGI:3648778
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_987121.2

name	LOC100041729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265492 GeneID:100041729
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477704.1

name	LOC100041810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265500 GeneID:100041810
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477746.1

name	EG666186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396936 GeneID:666186 MGI:3644387
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987270.1

name	LOC100041841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265504 GeneID:100041841
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477763.1

name	LOC100041841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265506 GeneID:100041841
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477773.1

name	EG666207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396938 GeneID:666207 MGI:3647449
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987408.1

name	LOC632737 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265397 GeneID:632737
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475127.1

name	EG623168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396922 GeneID:623168 MGI:3645739
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_896697.2

name	LOC100041849 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265508 GeneID:100041849
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477785.1

name	1700016D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396941 GeneID:75535 MGI:1922785
definition	codon_start : 1 product : hypothetical protein LOC75535 protein_id : XP_987505.1

name	LOC100041930 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265518 GeneID:100041930
definition	codon_start : 1 product : similar to Predicted gene, EG545047 protein_id : XP_001477890.1

name	EG666152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396930 GeneID:666152 MGI:3648771
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_993771.1

name	LOC100041950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265521 GeneID:100041950
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477922.1

name	LOC100041910 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265513 GeneID:100041910
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477838.1

name	LOC674032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265516 GeneID:674032
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001477875.1

name	EG666239 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396943 GeneID:666239 MGI:3643149
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987609.1

name	EG666253 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265399 GeneID:666253 MGI:3645411
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987697.2

name	EG666280 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265401 GeneID:666280 MGI:3647991
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_987815.2

name	EG666285 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265403 GeneID:666285 MGI:3647989
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_987851.2

name	LOC100042031 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265525 GeneID:100042031
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001477962.1

name	EG666318 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396953 GeneID:666318 MGI:3647083
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988117.1

name	LOC100040875 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265409 GeneID:100040875
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475477.1

name	LOC100042055 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265527 GeneID:100042055
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477971.1

name	1700091H14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265414 GeneID:73553 MGI:1920803
definition	codon_start : 1 product : hypothetical protein LOC73553 protein_id : XP_988373.2

name	EG666415 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265416 GeneID:666415 MGI:3642978
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988782.2

name	LOC100040976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265419 GeneID:100040976
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475641.1

name	LOC100042114 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265530 GeneID:100042114
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477994.1

name	EG666376 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265422 GeneID:666376 MGI:3646354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988538.2

name	EG666396 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265426 GeneID:666396 MGI:3646131
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_988675.2

name	LOC100042130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265532 GeneID:100042130
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478022.1

name	EG666420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396967 GeneID:666420 MGI:3645750
definition	codon_start : 1 product : hypothetical protein protein_id : XP_988820.1

name	LOC100041106 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265429 GeneID:100041106
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475858.1

name	EG666471 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396979 GeneID:666471 MGI:3648566
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_989154.1

name	LOC100041143 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265433 GeneID:100041143
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475920.1

name	EG666485 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265435 GeneID:666485 MGI:3646865
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_989251.2

name	1700049E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265439 GeneID:73415 MGI:1920665
definition	codon_start : 1 product : hypothetical protein LOC73415 protein_id : XP_001475961.1

name	1700001F09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386270 GeneID:71826 MGI:1919076
definition	GO_function : GO:0009055 - electron carrier activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71826 protein_id : NP_082216.1

name	LOC100042326 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265541 GeneID:100042326
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478093.1

name	EG666502 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396983 GeneID:666502 MGI:3647466
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989381.1

name	LOC100042342 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265543 GeneID:100042342
definition	codon_start : 1 product : similar to 1700001F09Rik protein protein_id : XP_001478106.1

name	LOC666322 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265446 GeneID:666322
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476084.1

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 5 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 4 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 3 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 2 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 1 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 4 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 3 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 2 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 1 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 1 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 2 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 3 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 4 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 5 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 6 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 6 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 5 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 4 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 3 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 2 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 1 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 1 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 2 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 3 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 4 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 5 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 6 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 5 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 4 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 3 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 2 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 1 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 1 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 2 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 3 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 4 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 5 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 5 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 4 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 3 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 2 pseudo : _no_value

name	LOC100040787 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040787
definition	number : 1 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 1 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 2 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 3 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 4 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 5 pseudo : _no_value

name	LOC666298 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666298
definition	number : 6 pseudo : _no_value

name	LOC100040890 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040890
definition	number : 3 pseudo : _no_value

name	LOC100040890 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040890
definition	number : 2 pseudo : _no_value

name	LOC100040890 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040890
definition	number : 1 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 1 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 2 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 3 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 4 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 5 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 6 pseudo : _no_value

name	LOC635209 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635209
definition	number : 7 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 4 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 3 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 2 pseudo : _no_value

name	LOC100040983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040983
definition	number : 1 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 1 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 2 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 3 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 4 pseudo : _no_value

name	LOC666370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666370
definition	number : 5 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 4 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 3 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 2 pseudo : _no_value

name	LOC100041025 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041025
definition	number : 1 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 4 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 3 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 2 pseudo : _no_value

name	LOC100041046 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041046
definition	number : 1 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 1 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 2 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 3 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 4 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 5 pseudo : _no_value

name	LOC624893 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624893
definition	number : 6 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 5 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 4 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 3 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 2 pseudo : _no_value

name	LOC100041069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041069
definition	number : 1 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 4 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 3 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 2 pseudo : _no_value

name	LOC666454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666454
definition	number : 1 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 4 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 3 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 2 pseudo : _no_value

name	EG640992 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:640992
definition	number : 1 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 6 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 5 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 4 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 3 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 2 pseudo : _no_value

name	LOC666492 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666492
definition	number : 1 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 1 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 2 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 3 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 4 pseudo : _no_value

name	LOC673380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673380
definition	number : 5 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 4 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 3 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 2 pseudo : _no_value

name	LOC100041235 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041235
definition	number : 1 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 4 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 3 pseudo : _no_value

name	EG666556 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666556
definition	number : 2 pseudo : _no_value

name	LOC100041722 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265488 GeneID:100041722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins product : hypothetical protein LOC100041722 pseudo : _no_value transcript_id : XR_033330.1

name	LOC666214 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94396939 GeneID:666214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins product : hypothetical LOC666214 pseudo : _no_value transcript_id : XR_001846.1

name	LOC666233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265511 GeneID:666233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : similar to Predicted gene, EG434459 pseudo : _no_value transcript_id : XR_035685.1

name	EG385234 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265519 GeneID:385234 MGI:3645898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG385234 transcript_id : XR_035340.1

name	EG666264 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396946 GeneID:666264 MGI:3648646
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 11 Proteins product : predicted gene, EG666264 pseudo : _no_value transcript_id : XR_002297.1

name	EG546249 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265406 GeneID:546249 MGI:3646763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 5 Proteins product : predicted gene, EG546249 pseudo : _no_value transcript_id : XR_032222.1

name	LOC100040863 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265407 GeneID:100040863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 7 Proteins product : hypothetical protein LOC100040863 pseudo : _no_value transcript_id : XR_032231.1

name	LOC666436 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265528 GeneID:666436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins product : hypothetical LOC666436 pseudo : _no_value transcript_id : XR_033458.1

name	EG638353 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265427 GeneID:638353 MGI:3646628
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 54 ESTs, 5 Proteins product : predicted gene, EG638353 pseudo : _no_value transcript_id : XR_032418.1

name	EG638262 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396975 GeneID:638262 MGI:3648176
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 14 Proteins product : predicted gene, EG638262 pseudo : _no_value transcript_id : XR_001875.1

name	LOC666481 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265535 GeneID:666481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 15 Proteins product : hypothetical LOC666481 pseudo : _no_value transcript_id : XR_033489.1

name	LOC545039 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265539 GeneID:545039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 14 Proteins product : hypothetical LOC545039 pseudo : _no_value transcript_id : XR_033508.1

name	LOC100041227 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265442 GeneID:100041227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to CDNA sequence BC061237 pseudo : _no_value transcript_id : XR_032515.1

clone name	B6Ng01-189P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-150C06.b	B6Ng01-150C06.g
ACC	DH946297	DH946298
length	1,140	816
definition	DH946297\|Mus musculus domesticus DNA, BAC clone: B6Ng01-150C06, 5' end.	DH946298\|Mus musculus domesticus DNA, BAC clone: B6Ng01-150C06, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttaatttagaccatgatgccccgagcttaaagaaaaccatctct gcctgtgaattctggggctccaggagtgtgacaccatacctggctaaaaa cactggcctaagagtgaaggctttggacttgttttctgtttgtttgtttg tttgtttgttttactgtttttttaattaggtattttcctcatttacattt ccaatgctataccaaaagtcccccatacttcccccccacactaccctacc aacccactcccactttttggccctggcattcccctgtactggggcatata aagtttgcaagtccaatgggcctctctttccagtgatggccgactaggcc atcttttgatacatatgcagatagagtcaagagctccgggatactggtta gttcataacgttgttccacccatagggttgcagatcccttcagctccttg ggtattttctctagctcctccattgggggccctgtgatccatccaatagc tgactgtgagcatccacttatgtgtttgctaggtccaggtgtagtctcac tagagacagctataccagggtcctatcagcaaaatcttgctagtgtatgc aatggtgtcagcatttggaggctgattatgggatggatccctggatatgg tagtctctagtccttttgtctcatctccaaactttgtctctgtaacttct tccatgggtgtttaatacataaaaatgtagatatttcactcagtacggat ttaaaaagaacctctactcagctggatcagtatatgcagtgtatatagct tcagcaaaatatccaaataaacgaccagaagaaaggaagagaaaataaat atcaaatcccttaaatcataccaccaaaattctaagccccaaagcaacaa acccaaccacatcaacaaacaaatatcagttaaactgtattctcttgggg cagtttagtggcactgactacacatgtggtcaatcttgagacaggtagta aggcagtttcagatgtatagcctatcaaggcagtgttgccattgtttctt tgggggctttgtagttagtcttctaaggacaggatgagactattcaggaa tttgcttcaagtctttacttacttactacctcccttaaat	gaattcaagaagttactctccagagatcctaataaccctattaaagaatg gggtacagagctaaacagaaaattctcaactgatgaatcttgaatggctg agatgtacttaagaaatgttcaacatctttagtcatcagggaaatgcaaa tcaaattgaccctaagtttccacttcacagcactcagatgggacaagaac aaaactcagctgacaggtgattctggcaagaatgtgaagaaagaagaaca tccctccattcctgctgggactgcaagttggaaaaaccactttggagatc aatctggcaattcttgagaaagttggaaatggttctacctcaagtacagg tataccaccatggtacatatacccaaaagattctccaatgtattaaaaag acacatgcaccactatgttcatagcagccttatttataatgaccagactc tgaaaacaacccagatgtccctcacagaagaatagatacagaaaatattg tacagtgtacaggagtactactcagcctttaaaaacattacttcatgaaa ttcaaaggccaatgtttggaagttgaaatatcatcatgagtgtggtatcc tagtcacaaaaggatacacatggtatgtagttattgataagtggaaattg gtcaaaaaatgcatggaatgcccacaatacaactaacagaccacgggaaa ccagagaagaaggaagatcacaccagagtgtgaatgctacagttctactc agaagggggaagcaaagaatgtttggaagtaggaggagagaaggatctgg gagggagagaagagta
quality values	Open. Hide. 61 47 37 35 61 61 61 61 61 61 61 61 61 59 59 61 61 43 38 61 61 59 59 59 61 39 24 28 16 20 22 22 28 26 27 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 55 55 44 55 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 55 35 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 59 59 61 52 43 41 50 49 52 59 59 59 59 61 59 61 59 59 59 59 59 59 59 59 61 59 59 59 59 59 61 61 59 61 61 59 61 59 61 59 61 61 61 61 59 59 59 52 55 52 55 61 61 61 61 61 55 61 55 61 61 61 61 61 52 52 61 55 52 52 61 61 61 52 52 52 52 55 52 61 61 61 61 61 52 49 39 37 36 39 55 61 55 61 61 61 61 61 61 61 61 55 49 49 41 41 49 49 61 61 61 61 61 43 61 61 55 55 55 55 61 61 61 55 55 55 50 43 38 61 47 49 50 50 50 50 50 49 37 50 55 47 55 47 50 50 50 49 37 49 43 55 55 55 55 55 55 55 55 50 53 61 61 61 50 53 61 50 61 61 61 61 61 61 61 45 52 50 45 53 36 47 41 50 52 47 43 50 50 43 34 53 53 52 43 52 53 45 50 31 32 50 27 50 45 42 45 32 50 45 47 39 50 50 50 45 61 53 45 53 50 50 50 53 52 50 53 43 53 39 40 43 31 38 35 27 47 39 40 40 45 50 47 47 45 41 41 39 27 42 33 47 42 39 50 50 38 34 40 30 38 27 30 45 57 53 50 53 53 45 39 43 34 28 21 28 36 42 50 47 52 53 45 52 53 42 50 52 45 38 57 31 36 43 47 45 28 57 43 57 23 20 53 30 50 39 30 45 42 45 50 50 53 53 47 26 53 27 45 47 31 21 32 32 38 52 53 52 47 29 53 47 32 23 32 57 41 39 52 47 52 45 45 45 53 43 14 57 50 40 50 24 50 42 45 26 24 23 27 32 30 30 45 47 38 45 42 35 28 10 28 42 28 27 10 27 47 35 47 30 32 42 36 36 45 42 42 38 43 23 30 28 35 45 53 38 34 28 30 24 33 53 34 33 45 45 33 24 23 25 31 21 29 28 17 35 24 24 21 17 24 35 52 30 32 30 39 37 42 31 30 29 30 24 20 30 31 24 24 17 38 20 18 37 26 16 44 26 12 44 42 36 38 31 39 30 39 34 37 36 36 37 38 38 39 24 9 37 37 21 46 18 24 36 40 23 15 24 28 40 25 25 22 33 34 29 41 19 47 24 40 33 44 33 35 29 13 35 18 15 40 31 44 34 35 34 33 31 32 31 14 30 25 17 6 39 12 39 14 30 29 24 29 30 41 24 7 12 11 12 9 25 30 20 21 40 28 34 47 44 12 13 23 29 26 38 29 32 22 21 19 30 27 13 46 13 31 29 24 31 12 30 24 30 14 29 29 29 15 30 22 17 20 33 29 35 24 15 24 28 24 30 37 29 26 22 12 11 25 20 29 19 30 19 21 15 22 17 30 25 12 7 11 17 24 12 26 19 29 14 25 17 7 30 11 13 26 29 36 29 23 28 7 10 26 18 10 7 30 7 26 28 43 14 29 20 23 43 25 34 19 39 34 51 41 29 19 28 20 16 46 21 28 12 28 39 33 20 19 29 34 27 46 12 19 23 21 32 7 19 21 40 10 29 28 19 29 19 25 17 31 16 6 13 20 4 10 5 9 5 15 19 31 14 13 29 10 24 23 6 23 18 19 38 20 7 5 9 29 14 21 23 34 9 20 11 20 20 23 16 30 29 19 17 20 20 15 21 10 6 23 7 9 16 26 24 8 11 6 6 16 42 22 28 7 25 12 24 24 22 30 22 10 8 30 21 12 11 29 13 14 9 30 6 7 8 10 11 5 4 4 6 23 12 7 8 7 11 8 14 10 17 6 3 3 3 4 9 11 5 3 3 4 9 6 7 22 30 23 9 5 12 7 7 16 17 4 3 7 8 18 12 13 5 12 9 5 11 13 6 16 3 4 4 4 9 6 14 19 4 10 9 16 3 3 8	Open. Hide. 61 61 55 49 61 49 17 16 19 25 18 14 35 41 35 59 55 59 61 61 59 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 59 59 59 44 59 55 37 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 35 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 46 61 47 52 61 61 61 61 53 57 53 53 57 57 57 57 53 53 53 57 57 53 57 57 53 57 57 57 57 57 57 53 53 57 57 52 57 53 53 53 53 47 53 53 53 50 53 57 53 53 53 53 57 53 57 47 47 47 53 53 53 47 53 53 53 52 57 57 57 57 53 52 57 41 52 57 53 57 52 39 52 53 53 57 57 53 57 47 57 47 57 57 52 53 57 53 57 57 57 53 52 52 53 53 57 57 50 57 57 57 46 57 53 42 57 57 42 50 52 53 46 44 53 50 53 53 50 53 36 57 57 53 38 57 35 34 53 57 53 53 50 53 46 38 38 53 39 57 39 50 53 53 50 42 40 47 53 34 31 47 46 40 38 57 52 50 57 42 40 53 57 39 33 43 34 57 57 57 57 37 36 52 37 37 52 57 46 39 36 29 40 30 46 53 35 52 38 53 47 40 40 40 32 41 44 37 46 44 40 36 40 35 41 36 48 44 37 30 27 25 37 19 53 34 36 57 28 48 51 29 44 31 10 34 30 48 30 29 17 38 30 45 30 45 44 32 30 44 14 47 36 25 47 46 34 30 43 29 31 27 44 28 29 30 44 39 38 31 33 48 39 29 26 48 38 28 46 51 51 29 48 47 25 29 23 24 39 21 46 29 29 30 18 51 40 29 31 32 36 26 33 28 24 29 32 8 41 32 18 39 15 43 18 4 13 30 29 29 35 39 51 34 39 24 46 31 29 17 41 7 19 39 16 39 9 15 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_43247839_43249000
seq2: B6Ng01-150C06.b_48_1187

seq1  GAATTCTTAATTTAGACCATGATGCCCCGAGCTTAAAGAAAACCATCTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAATTTAGACCATGATGCCCCGAGCTTAAAGAAAACCATCTCT  50

seq1  GCCTGTGAATTCTGGGGCTCCAGGAGTGTGACACCATACCTGGCTAAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGTGAATTCTGGGGCTCCAGGAGTGTGACACCATACCTGGCTAAAAA  100

seq1  CACTGGCCTAAGAGTGAAGGCTTTGGACTTGTTTTCTGTTTGTTTGTTTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGCCTAAGAGTGAAGGCTTTGGACTTGTTTTCTGTTTGTTTGTTTG  150

seq1  TTTGTTTGTTTTACTGTTTTTTTAATTAGGTATTTTCCTCATTTACATTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTGTTTTACTGTTTTTTTAATTAGGTATTTTCCTCATTTACATTT  200

seq1  CCAATGCTATACCAAAAGTCCCCCATACTTCCCCCCCACACTACCCTACC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATGCTATACCAAAAGTCCCCCATACTTCCCCCCCACACTACCCTACC  250

seq1  AACCCACTCCCACTTTTTGGCCCTGGCATTCCCCTGTACTGGGGCATATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCACTCCCACTTTTTGGCCCTGGCATTCCCCTGTACTGGGGCATATA  300

seq1  AAGTTTGCAAGTCCAATGGGCCTCTCTTTCCAGTGATGGCCGACTAGGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTTGCAAGTCCAATGGGCCTCTCTTTCCAGTGATGGCCGACTAGGCC  350

seq1  ATCTTTTGATACATATGCAGATAGAGTCAAGAGCTCCGGGATACTGGTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTTTGATACATATGCAGATAGAGTCAAGAGCTCCGGGATACTGGTTA  400

seq1  GTTCATAACGTTGTTCCACCCATAGGGTTGCAGATCCCTTCAGCTCCTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCATAACGTTGTTCCACCCATAGGGTTGCAGATCCCTTCAGCTCCTTG  450

seq1  GGTATTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGATCCATCCAATAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATTTTCTCTAGCTCCTCCATTGGGGGCCCTGTGATCCATCCAATAGC  500

seq1  TGACTGTGAGCATCCACTTATGTGTTTGCTAGGTCCAGGTGTAGTCTCAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGTGAGCATCCACTTATGTGTTTGCTAGGTCCAGGTGTAGTCTCAC  550

seq1  TAGAGACAGCTATACCAGGGTCCTATCAGCAAAATCTTGCTAGTGTATGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGACAGCTATACCAGGGTCCTATCAGCAAAATCTTGCTAGTGTATGC  600

seq1  AATGGTGTCAGCATTTGGAGGCTGATTATGGGATGGATCCCTGGATATGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGTGTCAGCATTTGGAGGCTGATTATGGGATGGATCCCTGGATATGG  650

seq1  TAGTCTCTAGTCCTTTTGTCTCAGCTCCAAACTTTGTCTCTGTAACTTCT  700
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  TAGTCTCTAGTCCTTTTGTCTCATCTCCAAACTTTGTCTCTGTAACTTCT  700

seq1  TCCATGGGTGTTTAATACATAAAAATGTAGATATTTCACTCAGTACGGAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATGGGTGTTTAATACATAAAAATGTAGATATTTCACTCAGTACGGAT  750

seq1  TTAAAAAGAACCTCTACTCAGCTGGATCAGTATATGCAGTGTATATAGCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAAGAACCTCTACTCAGCTGGATCAGTATATGCAGTGTATATAGCT  800

seq1  TCAGCAAAATATCCAAAT-AACGACCAGAAAAAAGGAAGAGAAAATAAAT  849
      |||||||||||||||||| ||||||||||| |||||||||||||||||||
seq2  TCAGCAAAATATCCAAATAAACGACCAGAAGAAAGGAAGAGAAAATAAAT  850

seq1  ATCAAAT-CCTTAAATCAATACCACCAAAATTCTAAGCCCCAAAGCAAAC  898
      ||||||| ||||||||| |||||||||||||||||||||||||||| |||
seq2  ATCAAATCCCTTAAATC-ATACCACCAAAATTCTAAGCCCCAAAGC-AAC  898

seq1  AAAACCCAAACCAACAATCAAACAAACAAAATATCAAGTTAAACTGTATT  948
      |||  || |||||   ||| ||||||| ||||||| ||||||||||||||
seq2  AAA--CCCAACCA--CATC-AACAAAC-AAATATC-AGTTAAACTGTATT  941

seq1  CTCTTGGGGCAGTTTAGTGGCACTGAACTACAACATGTGGTCAATCTTGA  998
      ||||||||||||||||||||||||| ||||| ||||||||||||||||| 
seq2  CTCTTGGGGCAGTTTAGTGGCACTG-ACTAC-ACATGTGGTCAATCTTG-  988

seq1  AGACAAGGTAGTAAGGCAGTTTCAGATGTAATAGCCTATCAAGGCAAGTG  1048
      |||| |||||||||||||||||||||||| ||||||||||||||| ||||
seq2  AGAC-AGGTAGTAAGGCAGTTTCAGATGT-ATAGCCTATCAAGGC-AGTG  1035

seq1  TTGCCA-TGTTTCTTTGGGGGCTTTGTAAGTTAAGTCTTCATAGGACAAG  1097
      |||||| |||||||||||||||||||| |||| |||||||  ||||| ||
seq2  TTGCCATTGTTTCTTTGGGGGCTTTGT-AGTT-AGTCTTCTAAGGAC-AG  1082

seq1  GATGAGACATATTACAGGATTTTGCTCAAAGTCTTTTAACTTTACTTAAC  1147
      |||||||| |||| ||||| ||||||  ||||||||  || |||||| ||
seq2  GATGAGAC-TATT-CAGGAATTTGCTTCAAGTCTTT--AC-TTACTT-AC  1126

seq1  TCACCTCCATTAAAT  1162
      | |||||| ||||||
seq2  T-ACCTCCCTTAAAT  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information