MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-156C22
Chromosome	14 (Build37)
Map Location	4,758,249 - 4,881,457
singlet/doublet	doublet
Overlap gene	LOC100041262, LOC665981, LOC100041283, LOC100040996, LOC673676
Upstream gene	LOC100040880, LOC100040615, LOC100040923, LOC100040621, LOC100040641, LOC100040652, LOC100040935, LOC100040852, LOC100040674, LOC100040906, LOC100040688, LOC100040701, LOC100040897, LOC100041012, LOC100041019, ENSMUSG00000068790, LOC100041054, LOC666442, LOC100040793, LOC100041076, LOC100040801, LOC666336, LOC100041100, LOC100040808, LOC100041119, 2610042L04Rik, LOC100041139, LOC100041151, LOC100041177, LOC100041162, LOC100040889, LOC100040900, LOC100040917, LOC100040928, EG666560, LOC666555, EG666549
Downstream gene	LOC100041007, LOC100041317, LOC100041306, LOC100041024, LOC100041336, EG666815, LOC666808, EG666800, LOC100041374, 4930555G01Rik, EG666772, LOC666765, LOC100041401, LOC100041105, EG666750, LOC666743, LOC100041447, LOC673138, LOC666740, LOC641258, LOC673685, LOC100041158, LOC100041501, LOC100041515, LOC100041184, EG666706, LOC100041195, LOC100041545, LOC100041565, LOC100041215
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040880 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 1 Protein pseudo : _no_value

name	LOC100040615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040923 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 10 Proteins

name	LOC100040621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100040652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040935 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040852 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein pseudo : _no_value

name	LOC100040674 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040906 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins pseudo : _no_value

name	LOC100040688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040701 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100040897 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 9 Proteins

name	LOC100041012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 1 Protein pseudo : _no_value

name	LOC100041019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 16 Proteins

name	ENSMUSG00000068790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545007 MGI:3704420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041054 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 8 ESTs, 11 Proteins

name	LOC666442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein pseudo : _no_value

name	LOC100040793 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100041076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 25 ESTs, 9 Proteins

name	LOC100040801 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC666336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 143 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 15 Proteins pseudo : _no_value

name	LOC100040808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041119 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 25 ESTs, 9 Proteins

name	2610042L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:554327 MGI:1914305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 7 Proteins

name	LOC100041139 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 7 Proteins

name	LOC100041151 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 95 ESTs, 7 Proteins

name	LOC100041177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 31 ESTs, 9 Proteins

name	LOC100041162 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein pseudo : _no_value

name	LOC100040889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100040900 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040928 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins

name	EG666560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666560 MGI:3648127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	LOC666555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG666549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 10 Proteins

name	LOC100041262 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 1 Protein pseudo : _no_value

name	LOC665981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 30 ESTs, 9 Proteins

name	LOC100041283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein pseudo : _no_value

name	LOC100040996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC673676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 17 Proteins

name	LOC100041007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 13 ESTs, 9 Proteins

name	LOC100041306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein pseudo : _no_value

name	LOC100041024 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins

name	EG666815 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666815 MGI:3646944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins pseudo : _no_value

name	LOC666808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG666800 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 28 ESTs, 10 Proteins

name	LOC100041374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 2 Proteins pseudo : _no_value

name	4930555G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108978 MGI:1922055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666772 MGI:3647811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins pseudo : _no_value

name	LOC666765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 26 ESTs, 10 Proteins

name	LOC100041401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein pseudo : _no_value

name	LOC100041105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666750 MGI:3648017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 10 Proteins

name	LOC666743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041447 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 8 Proteins pseudo : _no_value

name	LOC673138 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC641258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC673685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041158 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041501 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein pseudo : _no_value

name	LOC100041184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins

name	EG666706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100040923 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264869 GeneID:100040923
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 10 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475847.1

name	LOC100040701 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264834 GeneID:100040701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100040701 transcript_id : XM_001475101.1

name	LOC100040897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264864 GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001475800.1

name	LOC100040897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264862 GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 8 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001475780.1

name	LOC100040897 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264866 GeneID:100040897
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001475818.1

name	LOC100041019 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264877 GeneID:100041019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 16 Proteins product : hypothetical protein LOC100041019 transcript_id : XM_001475922.1

name	ENSMUSG00000068790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480141 GeneID:545007 MGI:3704420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, ENSMUSG00000068790 transcript_id : NM_001029930.1

name	LOC100041054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264882 GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 3 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001475992.1

name	LOC100041054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264880 GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 10 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001475976.1

name	LOC100041054 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264884 GeneID:100041054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001476009.1

name	LOC100040793 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264846 GeneID:100040793
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to diacylglycerol kinase, eta transcript_id : XM_001475278.1

name	LOC100041076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264888 GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476049.1

name	LOC100041076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264886 GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476025.1

name	LOC100041076 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264890 GeneID:100041076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001476064.1

name	LOC100040801 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264850 GeneID:100040801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100040801 transcript_id : XM_001475295.1

name	LOC100041119 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264896 GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001476132.1

name	LOC100041119 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264894 GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 8 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001476114.1

name	LOC100041119 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264898 GeneID:100041119
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001476147.1

name	LOC100041139 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264903 GeneID:100041139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001476172.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264909 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 7 Proteins product : similar to 2610042L04Rik, transcript variant 2 transcript_id : XM_001476203.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264913 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 89 ESTs, 2 Proteins product : similar to 2610042L04Rik, transcript variant 4 transcript_id : XM_001476236.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264907 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 2 Proteins product : similar to 2610042L04Rik, transcript variant 1 transcript_id : XM_001476183.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264911 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 88 ESTs, 7 Proteins product : similar to 2610042L04Rik, transcript variant 3 transcript_id : XM_001476220.1

name	LOC100041177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264920 GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476288.1

name	LOC100041177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264918 GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 29 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476268.1

name	LOC100041177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264922 GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001476306.1

name	LOC100040928 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264871 GeneID:100040928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001475502.1

name	LOC666555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396529 GeneID:666555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC666555 transcript_id : XM_984581.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264934 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 2 Proteins product : predicted gene, EG666549, transcript variant 1 transcript_id : XM_001476364.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396527 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 8 Proteins product : predicted gene, EG666549, transcript variant 4 transcript_id : XM_984543.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264936 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : predicted gene, EG666549, transcript variant 2 transcript_id : XM_001476379.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264938 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins product : predicted gene, EG666549, transcript variant 3 transcript_id : XM_001476394.1

name	LOC665981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264943 GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476439.1

name	LOC665981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396462 GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 28 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_987294.1

name	LOC665981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264945 GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476451.1

name	LOC100040996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264874 GeneID:100040996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to diacylglycerol kinase, eta transcript_id : XM_001475622.1

name	LOC673676 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264965 GeneID:673676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to Predicted gene, EG432825 transcript_id : XM_001476642.1

name	LOC100041317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264955 GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001476517.1

name	LOC100041317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264953 GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 8 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001476500.1

name	LOC100041317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264957 GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001476536.1

name	LOC100041336 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264967 GeneID:100041336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001476676.1

name	LOC666808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396556 GeneID:666808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : similar to RIKEN cDNA 1700110I01 gene transcript_id : XM_986110.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264959 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 2 Proteins product : predicted gene, EG666800, transcript variant 1 transcript_id : XM_001476557.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396554 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 8 Proteins product : predicted gene, EG666800, transcript variant 4 transcript_id : XM_986074.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264961 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : predicted gene, EG666800, transcript variant 2 transcript_id : XM_001476570.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264963 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins product : predicted gene, EG666800, transcript variant 3 transcript_id : XM_001476584.1

name	4930555G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381650 GeneID:108978 MGI:1922055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930555G01 gene transcript_id : NM_175393.3

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264972 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476808.1

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396550 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 24 ESTs, 9 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_985877.1

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264974 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476830.1

name	EG666750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264976 GeneID:666750 MGI:3648017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 10 Proteins product : predicted gene, EG666750 transcript_id : XM_985778.2

name	LOC666740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264901 GeneID:666740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : hypothetical LOC666740 transcript_id : XM_985716.2

name	LOC641258 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264905 GeneID:641258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475869.1

name	LOC100041158 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264915 GeneID:100041158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001475892.1

name	LOC100041184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264924 GeneID:100041184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475932.1

name	EG666706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264991 GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : predicted gene, EG666706, transcript variant 1 transcript_id : XM_985542.2

name	LOC100041215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264927 GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475986.1

name	LOC100040923 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264870 GeneID:100040923
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475897.1

name	LOC100040701 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264835 GeneID:100040701
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475151.1

name	LOC100040897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264867 GeneID:100040897
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001475868.1

name	LOC100040897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264865 GeneID:100040897
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001475850.1

name	LOC100040897 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264863 GeneID:100040897
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001475830.1

name	LOC100041019 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264878 GeneID:100041019
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475972.1

name	ENSMUSG00000068790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480142 GeneID:545007 MGI:3704420
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC545007 protein_id : NP_001025101.1

name	LOC100041054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264885 GeneID:100041054
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476059.1

name	LOC100041054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264883 GeneID:100041054
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476042.1

name	LOC100041054 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264881 GeneID:100041054
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476026.1

name	LOC100040793 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264847 GeneID:100040793
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475328.1

name	LOC100041076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264891 GeneID:100041076
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001476114.1

name	LOC100041076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264889 GeneID:100041076
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476099.1

name	LOC100041076 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264887 GeneID:100041076
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476075.1

name	LOC100040801 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264851 GeneID:100040801
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475345.1

name	LOC100041119 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264899 GeneID:100041119
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476197.1

name	LOC100041119 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264897 GeneID:100041119
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476182.1

name	LOC100041119 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264895 GeneID:100041119
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476164.1

name	LOC100041139 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264904 GeneID:100041139
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001476222.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264908 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 1 protein_id : XP_001476233.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264910 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 2 protein_id : XP_001476253.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264912 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 3 protein_id : XP_001476270.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264914 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 4 protein_id : XP_001476286.1

name	LOC100041177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264923 GeneID:100041177
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001476356.1

name	LOC100041177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264921 GeneID:100041177
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476338.1

name	LOC100041177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264919 GeneID:100041177
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476318.1

name	LOC100040928 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264872 GeneID:100040928
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001475552.1

name	LOC666555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396530 GeneID:666555
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989675.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264937 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476429.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264935 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476414.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396528 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 4 protein_id : XP_989637.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264939 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476444.1

name	LOC665981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264946 GeneID:665981
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476501.1

name	LOC665981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264944 GeneID:665981
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476489.1

name	LOC665981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396463 GeneID:665981
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_992388.1

name	LOC100040996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264875 GeneID:100040996
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475672.1

name	LOC673676 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264966 GeneID:673676
definition	codon_start : 1 product : similar to Predicted gene, EG432825 protein_id : XP_001476692.1

name	LOC100041317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264958 GeneID:100041317
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476586.1

name	LOC100041317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264956 GeneID:100041317
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476567.1

name	LOC100041317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264954 GeneID:100041317
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476550.1

name	LOC100041336 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264968 GeneID:100041336
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001476726.1

name	LOC666808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396557 GeneID:666808
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991204.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264962 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476620.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264960 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476607.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396555 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 4 protein_id : XP_991168.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264964 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476634.1

name	4930555G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425104 GeneID:108978 MGI:1922055
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC108978 protein_id : NP_780602.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264975 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476880.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264973 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476858.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396551 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_990971.1

name	EG666750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264977 GeneID:666750 MGI:3648017
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_990872.2

name	LOC666740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264902 GeneID:666740
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990810.2

name	LOC641258 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264906 GeneID:641258
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001475919.1

name	LOC100041158 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264916 GeneID:100041158
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475942.1

name	LOC100041184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264925 GeneID:100041184
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475982.1

name	EG666706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264992 GeneID:666706 MGI:3644639
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_990636.2

name	LOC100041215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264928 GeneID:100041215
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476036.1

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 4 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 3 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 2 pseudo : _no_value

name	LOC100040615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040615
definition	number : 1 pseudo : _no_value

name	LOC100040621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040621
definition	number : 1 pseudo : _no_value

name	LOC100040641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040641
definition	number : 1 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 5 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 4 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 3 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 2 pseudo : _no_value

name	LOC100040652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040652
definition	number : 1 pseudo : _no_value

name	LOC100040674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040674
definition	number : 3 pseudo : _no_value

name	LOC100040674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040674
definition	number : 2 pseudo : _no_value

name	LOC100040674 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040674
definition	number : 1 pseudo : _no_value

name	LOC100040688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040688
definition	number : 2 pseudo : _no_value

name	LOC100040688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040688
definition	number : 1 pseudo : _no_value

name	LOC100040808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040808
definition	number : 2 pseudo : _no_value

name	LOC100040808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040808
definition	number : 1 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 4 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 3 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 2 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 1 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 1 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 2 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 3 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 4 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 4 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 3 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 2 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 1 pseudo : _no_value

name	LOC100041007 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041007
definition	number : 3 pseudo : _no_value

name	LOC100041007 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041007
definition	number : 2 pseudo : _no_value

name	LOC100041007 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041007
definition	number : 1 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 4 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 3 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 2 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 1 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 4 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 3 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 2 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 1 pseudo : _no_value

name	LOC666743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666743
definition	number : 2 pseudo : _no_value

name	LOC666743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666743
definition	number : 1 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 1 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 2 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 3 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 4 pseudo : _no_value

name	LOC100040880 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264861 GeneID:100040880
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 97 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032411.1

name	LOC100040935 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264873 GeneID:100040935
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 pseudo : _no_value transcript_id : XR_032473.1

name	LOC100040852 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264853 GeneID:100040852
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein product : hypothetical protein LOC100040852 pseudo : _no_value transcript_id : XR_032351.1

name	LOC100040906 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264868 GeneID:100040906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032452.1

name	LOC100041012 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264876 GeneID:100041012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 81 ESTs, 1 Protein product : hypothetical protein LOC100041012 pseudo : _no_value transcript_id : XR_032479.1

name	LOC666442 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264879 GeneID:666442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 98 ESTs, 1 Protein product : hypothetical LOC666442 pseudo : _no_value transcript_id : XR_032500.1

name	LOC666336 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264892 GeneID:666336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 143 ESTs, 6 Proteins product : hypothetical LOC666336 pseudo : _no_value transcript_id : XR_032547.1

name	LOC100041100 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264893 GeneID:100041100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 15 Proteins product : hypothetical protein LOC100041100 pseudo : _no_value transcript_id : XR_032556.1

name	2610042L04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264900 GeneID:554327 MGI:1914305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 7 Proteins product : RIKEN cDNA 2610042L04 gene transcript_id : XR_032590.1

name	LOC100041162 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264917 GeneID:100041162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein product : hypothetical protein LOC100041162 pseudo : _no_value transcript_id : XR_032642.1

name	EG666560 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396531 GeneID:666560 MGI:3648127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : predicted gene, EG666560 pseudo : _no_value transcript_id : XR_001891.1

name	LOC100041262 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264941 GeneID:100041262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032726.1

name	LOC100041283 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264948 GeneID:100041283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032767.1

name	LOC100041306 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264951 GeneID:100041306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein product : hypothetical protein LOC100041306 pseudo : _no_value transcript_id : XR_032779.1

name	EG666815 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396558 GeneID:666815 MGI:3646944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins product : predicted gene, EG666815 pseudo : _no_value transcript_id : XR_001921.1

name	LOC100041374 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264969 GeneID:100041374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 2 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032888.1

name	EG666772 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264970 GeneID:666772 MGI:3647811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins product : predicted gene, EG666772 pseudo : _no_value transcript_id : XR_032904.1

name	LOC100041401 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264971 GeneID:100041401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein product : hypothetical protein LOC100041401 pseudo : _no_value transcript_id : XR_032912.1

name	LOC100041447 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264982 GeneID:100041447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825 pseudo : _no_value transcript_id : XR_032958.1

name	LOC673685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264988 GeneID:673685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical LOC673685 pseudo : _no_value transcript_id : XR_032967.1

name	LOC100041501 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264989 GeneID:100041501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041501 pseudo : _no_value transcript_id : XR_032973.1

name	LOC100041515 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264990 GeneID:100041515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032977.1

name	LOC100041195 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264926 GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032499.1

name	LOC100041545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264994 GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041545 pseudo : _no_value transcript_id : XR_033000.1

name	LOC100041565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264995 GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical protein LOC100041565 pseudo : _no_value transcript_id : XR_033011.1

clone name	B6Ng01-116B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-156C22.b	B6Ng01-156C22.g
ACC	DH950754	DH950755
length	1,088	1,082
definition	DH950754\|Mus musculus domesticus DNA, BAC clone: B6Ng01-156C22, 5' end.	DH950755\|Mus musculus domesticus DNA, BAC clone: B6Ng01-156C22, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(4,758,249 - 4,759,365)	(4,880,370 - 4,881,457)
sequence	gaattcaccatgacctcctcattctgggtaattctccctgaaatgtggat tatatagtttggccaaattcataggactaggccaaagatcaagagccctt gttctgaaagaaaaaaaaaaggagaaatgtcctcatagtttctgtatacc cacacctgtgccataaactactgagagtttagagacctcgtctgtccctc caggcctatgtgggagctcaaacaaccagaaatctaaccacctggacacc cagcctctggagacctttggacaagatagtaagattaataagcttagatg atcctagtacataggaggtagaaggtaacatactgtgagcttggatagtt cagaatccatcctggattcaggtgacccttgaagcctgtgttcttgggac tctttgctcttggggccaggcccaaccacagatcaaatccttactatgaa aaattgaaagtggagattaagcaggtaatgttggacctgcagagcttaca gaatgtgtacactgaggcctcagagacatttgaattcctggcaaagagaa aggctgctataggtaactgtctgtcttgcttgggagcacatgagctgtag aattgccatctctgcttttgatcctgcacaggagactctcgagctctggt tcttgctttctgccacttcacacaggagcctttagatttttctgttgtaa acctgtgggttgaaacactttttggggtaaaaaaaaaaaaaggtcaaagg accctttcacagaggttgtgtatcagacaatcctttatctcagacacttc tattatggcttataacagtacaaaaattatagtacccaagtagcaatgaa ataatcttaagtttgggaggtcactgcattaaagcatccacagcatttgg taaattgagaaaccctggtcttgacagagaactattgtatcatgtgagtc ttctgaccccggggctgagtcagatctgtagagagctagtatcagcagac catatatagcagatccctgtttctcttccatcatagtgcttgccatctcg gatgttctccatagatgacagataggacaactgaagtc	gaattcagtgttcatcctgtgttagggcatgacccaagaagcaaataatc tgctgaattaaggattcaataatcatgtgccaacaggttatgtcatggac taccaagccgagtgcatgccacatcctggctcattcacactgggtcccct tggtgctaattaaacttactatcctgggtagaggacagcagaaccagggg accaaatggagctagctgaccttcaagggcttcccggacaagcatgaagg aatagacttcttttatgacaattttccactacactgtgccacaggcatgg gtccattagatatctgtaatgactttcctcttgtttttaaggcagggatt atcattccttggttcctgttgttatttgaattcccagaggacacaactag tatttacaggagaaaggctttatcacacctcctcccccagaagattcctg tgtgacaccaaggaaacaccaggagcaaacttccctggtgatcactttgg acctctatggactcaacactctcaggacctgcaaactgtgcttcacacaa atcctcagaccccatcaaaggtcccagagccccagtcctgaacaaaacac acacacatctacattcacacacacagacacaattagaatgccaaataaat cctgtgaggtgccatctctcagattataataaacaatatcagagtaaagc cgtgatagcctgcaggcattgcattcacacactgagagacagtaagtgtg agcaggtccttccagctgtttagagcaacaatcagattgcaagcacccca aggtcaagtaaaaaagaagatgataataaacacacagcaccttgtttatc caacaattaaacacctttcaggctacttaattgaatgatgagagatgaca aactccattcattgaaggaaattggggtaacagatggcagaatacagtca tagggtactggtcataatttcctacctgtagtttaaatcctcatacatgt aacattcaggatttcaaacatttccttcctctcaatggctgatttcttta tggcaatacagtcttctactttaatatatttg
quality values	Open. Hide. 61 43 39 38 61 33 24 61 37 31 61 61 47 61 61 61 61 55 61 47 49 61 61 61 61 23 25 20 19 14 18 21 25 43 43 49 61 61 61 61 61 61 61 59 59 59 61 61 61 59 61 59 59 61 61 59 55 61 61 61 61 59 61 59 61 61 59 52 49 41 32 30 30 26 36 59 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 37 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 61 61 61 61 59 59 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 52 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 61 55 55 61 55 61 49 55 55 55 55 55 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 50 50 55 50 55 55 50 50 61 61 61 61 55 61 55 55 61 55 61 61 55 55 55 55 50 61 55 50 61 61 61 61 61 61 61 61 61 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 53 52 61 61 61 61 61 61 61 53 53 61 61 61 61 52 61 53 53 61 52 61 61 61 61 52 61 53 61 61 53 52 45 61 43 61 53 61 61 61 61 61 61 61 61 53 47 46 52 61 61 61 61 57 57 50 57 52 57 47 53 53 47 33 53 53 47 52 45 53 57 53 57 53 53 53 53 53 57 57 53 57 57 57 52 52 53 57 46 53 53 57 57 50 53 45 46 35 47 50 53 57 53 52 57 57 57 47 57 52 57 52 38 53 53 39 47 45 53 53 52 52 53 57 53 53 53 57 57 53 47 47 43 39 47 46 47 45 52 50 43 57 36 30 37 36 57 42 53 53 38 47 43 57 38 47 53 46 34 21 46 45 41 57 57 52 57 57 53 50 50 34 26 35 26 47 57 46 42 42 43 50 53 45 25 53 52 28 34 35 31 37 57 42 42 52 19 57 57 57 57 42 50 52 35 52 52 42 30 53 37 26 38 50 57 34 42 57 53 25 33 34 40 53 46 39 27 37 31 57 57 57 53 47 57 57 53 28 32 57 57 57 57 57 57 57 57 57 57 57 41 30 53 20 37 48 53 33 31 44 30 10 26 17 33 53 31 28 23 33 20 16 48 24 40 26 40 40 27 48 33 33 44 37 40 35 41 22 13 25 30 33 30 32 51 30 30 29 28 29 26 28 23 40 20 24 38 48 39 38 36 34 27 33 32 32 35 38 29 33 32 31 29 18 31 32 24 28 29 27 36 29 46 51 51 27 31 39 28 29 29 33 28 28 25 30 25 21 39 28 30 28 20 29 22 27 28 29 46 51 34 25 28 28 23 29 14 29 25 34 28 34 51 31 34 51 32 41 21 24 15 24 21 31 34 35 28 24 25 39 24 43 36 27 29 29 29 34 34 18 26 25 29 29 28 28 51 31 17 28 20 34 51 33 20 31 28 31 28 39 35 26 17 30 19 24 23 27 9 27 23 26 28 20 16 12 19 19 7 19 22 17 24 20 30 18 9 11 16 30 31 27 22 26 13 25 22 16 6 30 15 23 14 10 16 28 26 20 26 22 11 28 31 22 14 25 23 7 3 5 22 6 6 6 16 23 25 30 13 27 9 19 5 15 11 25 29 30 17 35 11 24 28 23 8 18 10 7 23 11 23 4 12 5 4 12 13 20 26 15 30 23 15 20 11 42 21 7 8 6 21 12 11 8 4 4 4 8 9 10 4 3 5 14 30 5 5 9 4 4 3 12 19 26 14 22 17 6 16 14 11 16 4 7 13 14 5 3 6 23 5 6 5 5 10 5 24 8 6 5 7 15 9 7 19 6 7 5 4 10 8 4 4 3 9 10 6 10	Open. Hide. 55 47 52 49 16 16 11 8 13 21 25 25 18 37 44 44 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 52 28 35 28 49 52 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 44 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 55 61 55 47 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 52 61 55 55 47 55 55 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 55 61 55 61 61 61 55 61 61 55 55 49 55 55 50 55 55 50 55 55 55 55 55 55 43 61 61 50 61 55 55 55 55 55 61 61 61 55 55 55 55 50 55 61 50 53 61 61 61 61 61 61 52 53 61 50 43 61 61 53 61 45 50 50 50 53 53 53 53 53 61 61 61 61 61 61 47 50 38 43 50 50 61 50 50 53 32 50 50 53 61 61 61 53 61 61 46 53 53 40 61 61 53 61 61 61 61 50 53 37 50 61 47 53 53 61 61 45 50 53 53 53 53 39 50 47 47 50 40 53 53 53 53 46 47 47 53 52 47 50 50 50 40 61 42 47 47 47 45 53 50 47 57 53 47 53 34 45 45 43 43 45 57 40 47 42 42 47 34 28 45 45 42 45 50 53 53 46 31 52 57 57 53 53 53 53 53 45 52 38 52 45 53 45 50 45 52 30 47 47 50 45 53 43 53 45 53 45 53 45 45 52 50 32 50 24 45 45 53 36 47 57 53 36 52 24 47 26 53 53 40 45 57 39 52 50 47 38 52 50 53 37 19 37 20 47 30 47 22 50 40 52 45 52 36 47 17 34 32 33 45 45 39 52 37 36 43 47 42 30 38 43 42 52 45 42 36 57 28 36 52 57 31 30 37 47 38 45 53 41 36 43 25 37 45 45 53 32 18 7 33 23 27 45 53 40 38 35 42 44 42 34 53 37 53 33 53 50 53 52 36 57 50 53 37 50 42 22 19 31 50 37 38 25 53 53 36 39 42 30 52 29 17 31 22 32 17 15 20 33 40 44 40 16 57 31 44 33 53 36 29 14 40 44 25 33 40 36 33 13 40 13 33 27 25 16 40 24 26 24 35 40 33 35 23 14 8 31 25 30 24 26 23 26 21 57 57 57 57 41 17 40 33 22 40 17 29 48 28 51 36 31 30 46 32 32 20 30 23 37 28 30 30 30 31 32 29 32 38 28 46 28 27 29 29 32 17 29 29 25 33 39 35 29 51 24 29 16 19 14 23 33 16 21 15 14 24 10 29 26 30 18 29 33 18 29 30 26 18 29 29 29 28 25 30 43 18 30 27 14 9 22 29 24 27 30 35 24 32 20 28 13 14 43 27 19 23 33 29 20 29 31 14 13 39 29 22 26 41 51 46 24 18 39 12 10 12 19 34 15 27 33 25 29 15 46 25 21 24 28 28 29 31 25 23 10 16 29 51 25 17 28 20 14 35 33 9 25 13 23 9 34 9 51 26 25 19 10 27 24 19 19 35 16 28 34 26 39 21 22 51 13 20 28 26 19 25 7 10 12 17 7 5 13 7 25 19 12 8 23 26 21 23 33 26 34 22 38 31 23 6 4 5 18 26 31 42 27 21 28 19 5 5 16 6 6 6 5 6 9 30 18 6 4 7 14 26 10 5 4 8 5 6 5 7 5 5 6 6 10 7 3 4 6 6 3 3 6 3 15 18 8 9 7 11 29 18 8 5 18 5 8 15 9 31 11 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_4758249_4759365
seq2: B6Ng01-156C22.b_38_1125

seq1  GAATTCACCATGACCTCCTCATTCTGGGTAATTCTCCCTGAAATGTGGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCATGACCTCCTCATTCTGGGTAATTCTCCCTGAAATGTGGAT  50

seq1  TATATAGTTTGGCCAAATTCATAGGACTAGGCCAAAGATCAAGAGCCCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATAGTTTGGCCAAATTCATAGGACTAGGCCAAAGATCAAGAGCCCTT  100

seq1  GTTCTGAAAGAAAAAAAAAAGGAGAAATGTCCTCATAGTTTCTGTATACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGAAAGAAAAAAAAAAGGAGAAATGTCCTCATAGTTTCTGTATACC  150

seq1  CACACCTGTGCCATAAACTACTGAGAGTTTAGAGACCTCGTCTGTCCCTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCTGTGCCATAAACTACTGAGAGTTTAGAGACCTCGTCTGTCCCTC  200

seq1  CAGGCCTATGTGGGAGCTCAAACAACCAGAAATCTAACCACCTGGACACC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCCTATGTGGGAGCTCAAACAACCAGAAATCTAACCACCTGGACACC  250

seq1  CAGCCTCTGGAGACCTTTGGACAAGATAGTAAGATTAATAAGCTTAGATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTCTGGAGACCTTTGGACAAGATAGTAAGATTAATAAGCTTAGATG  300

seq1  ATCCTAGTACATAGGAGGTAGAAGGTAACATACTGTGAGCTTGGATAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTAGTACATAGGAGGTAGAAGGTAACATACTGTGAGCTTGGATAGTT  350

seq1  CAGAATCCATCCTGGATTCAGGTGACCCTTGAAGCCTGTGTTCTTGGGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATCCATCCTGGATTCAGGTGACCCTTGAAGCCTGTGTTCTTGGGAC  400

seq1  TCTTTGCTCTTGGGGCCAGGCCCAACCACAGATCAAATCCTTACTATGAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGCTCTTGGGGCCAGGCCCAACCACAGATCAAATCCTTACTATGAA  450

seq1  AAATTGAAAGTGGAGATTAAGCAGGTAATGTTGGACCTGCAGAGCTTACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTGAAAGTGGAGATTAAGCAGGTAATGTTGGACCTGCAGAGCTTACA  500

seq1  GAATGTGTACACTGAGGCCTCAGAGACATTTGAATTCCTGGCAAAGAGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGTGTACACTGAGGCCTCAGAGACATTTGAATTCCTGGCAAAGAGAA  550

seq1  AGGCTGCTATAGGTAACTGTCTGTCTTGCTTGGGAGCACATGAGCTGTAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGCTATAGGTAACTGTCTGTCTTGCTTGGGAGCACATGAGCTGTAG  600

seq1  AATTGCCATCTCTGCTTTTGATCCTGCACAGGAGACTCTCGAGCTCTGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGCCATCTCTGCTTTTGATCCTGCACAGGAGACTCTCGAGCTCTGGT  650

seq1  TCTTGCTTTCTGCCACTTCACACAGGAGCCTTTAGATTTTTCTGTTGTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGCTTTCTGCCACTTCACACAGGAGCCTTTAGATTTTTCTGTTGTAA  700

seq1  ACCTGTGGGTTGAAACACTTTTTGGGGT-AAAAAAAAAAAAGGTCAAAGG  749
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  ACCTGTGGGTTGAAACACTTTTTGGGGTAAAAAAAAAAAAAGGTCAAAGG  750

seq1  ACCCTTTCACAGAGGTTGTGTATCAGACAATCCTTTATCTCAGACACTTC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTTTCACAGAGGTTGTGTATCAGACAATCCTTTATCTCAGACACTTC  800

seq1  TATTATGGCTTATAACAGTACAAAAATTATAGTACCCAAGTAGCAATGAA  849
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  TATTATGGCTTATAACAGTACAAAAATTATAGTACCCAAGTAGCAATG-A  849

seq1  AATAATCTTAAGTTTGGGAGGTCACTGCATTAAAGCATCCACAGCATTTG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATCTTAAGTTTGGGAGGTCACTGCATTAAAGCATCCACAGCATTTG  899

seq1  GTAAATTGAGAAACCCTGGTCTTGACAGAAGAACTATTTGTATCATGTGA  949
      |||||||||||||||||||||||||||| ||||||| |||||||||||||
seq2  GTAAATTGAGAAACCCTGGTCTTGACAG-AGAACTA-TTGTATCATGTGA  947

seq1  GGTCTTCTTGACCCCCGGGGCTGAGTCAGGATCTGTAGAGAGCTAGTTAT  999
       |||||| ||| |||||||||||||||| ||||||||||||||||| |||
seq2  -GTCTTC-TGA-CCCCGGGGCTGAGTCA-GATCTGTAGAGAGCTAG-TAT  992

seq1  CAGCAGACCCATATATAGCAAGTATTCCCCTTGTTTCTCCTTTCCAATTC  1049
      ||||||| ||||||||||||  |     || ||||||||  |||||  ||
seq2  CAGCAGA-CCATATATAGCAGAT-----CCCTGTTTCTC--TTCCA--TC  1032

seq1  ATAGTGCCTTTGCCCATTCCTTCGTGATGTTTCTCCATTAGGATGGACAG  1099
      |||||||  ||| ||||    ||| |||| ||||||||   ||| |||||
seq2  ATAGTGC--TTG-CCAT---CTCG-GATG-TTCTCCAT--AGAT-GACAG  1071

seq1  ATAGGGACAACTGTAGTC  1117
      ||| ||||||||| ||||
seq2  ATA-GGACAACTGAAGTC  1088

seq1: chr14_4880370_4881457
seq2: B6Ng01-156C22.g_68_1149 (reverse)

seq1  CAAATATAAATAAAGTAGAAGAACTGAAATTGCATATAAGGAAGATCAG-  49
      ||||||| | ||||||||||| ||||  |||||  |||| ||| ||||| 
seq2  CAAATAT-ATTAAAGTAGAAG-ACTG-TATTGC-CATAAAGAA-ATCAGC  45

seq1  CAATGAGAGGAAGGAAATGTGTGAAATCCTGAATGTTTACATGTATGAGG  99
      || ||||||||||||||||| |||||||||||||| ||||||||||||||
seq2  CATTGAGAGGAAGGAAATGTTTGAAATCCTGAATG-TTACATGTATGAGG  94

seq1  ATTTAAACTACAGGTAGG-AATTATGACCAGTACCCTATTGACTGTATTC  148
      |||||||||||||||||| ||||||||||||||||||| |||||||||||
seq2  ATTTAAACTACAGGTAGGAAATTATGACCAGTACCCTA-TGACTGTATTC  143

seq1  TGCCATCTGTTACCCCAATTTCCTTCAATGAATGGAGTTTGTCATCTCTC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCATCTGTTACCCCAATTTCCTTCAATGAATGGAGTTTGTCATCTCTC  193

seq1  ATCATTCAATTAAGTAGCCCTGAAAGGTGTTTAATTGTTGGATAAACAAG  248
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  ATCATTCAATTAAGTAG-CCTGAAAGGTGTTTAATTGTTGGATAAACAAG  242

seq1  GTGCTGTGTGTTTATTATCATCTTCTTTTTTACTTGACCTTGGGGTGCTT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGTGTGTTTATTATCATCTTCTTTTTTACTTGACCTTGGGGTGCTT  292

seq1  GCAATCTGATTGTTGCTCTAAACAGCTGGAAGGACCTGCTCACACTTACT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATCTGATTGTTGCTCTAAACAGCTGGAAGGACCTGCTCACACTTACT  342

seq1  GTCTCTCAGTGTGTGAATGCAATGCCTGCAGGCTATCACGGCTTTACTCT  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCTCAGTGTGTGAATGCAATGCCTGCAGGCTATCACGGCTTTACTCT  392

seq1  GATATTGTTTATTATAATCTGAGAGATGGCACCTCACAGGATTTATTTGG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATATTGTTTATTATAATCTGAGAGATGGCACCTCACAGGATTTATTTGG  442

seq1  CATTCTAATTGTGTCTGTGTGTGTGAATGTAGATGTGTGTGTGTTTTGTT  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCTAATTGTGTCTGTGTGTGTGAATGTAGATGTGTGTGTGTTTTGTT  492

seq1  CAGGACTGGGGCTCTGGGACCTTTGATGGGGTCTGAGGATTTGTGTGAAG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGACTGGGGCTCTGGGACCTTTGATGGGGTCTGAGGATTTGTGTGAAG  542

seq1  CACAGTTTGCAGGTCCTGAGAGTGTTGAGTCCATAGAGGTCCAAAGTGAT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGTTTGCAGGTCCTGAGAGTGTTGAGTCCATAGAGGTCCAAAGTGAT  592

seq1  CACCAGGGAAGTTTGCTCCTGGTGTTTCCTTGGTGTCACACAGGAATCTT  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAGGGAAGTTTGCTCCTGGTGTTTCCTTGGTGTCACACAGGAATCTT  642

seq1  CTGGGGGAGGAGGTGTGATAAAGCCTTTCTCCTGTAAATACTAGTTGTGT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGGAGGAGGTGTGATAAAGCCTTTCTCCTGTAAATACTAGTTGTGT  692

seq1  CCTCTGGGAATTCAAATAACAACAGGAACCAAGGAATGATAATCCCTGCC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGGGAATTCAAATAACAACAGGAACCAAGGAATGATAATCCCTGCC  742

seq1  TTAAAAACAAGAGGAAAGTCATTACAGATATCTAATGGACCCATGCCTGT  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAACAAGAGGAAAGTCATTACAGATATCTAATGGACCCATGCCTGT  792

seq1  GGCACAGTGTAGTGGAAAATTGTCATAAAAGAAGTCTATTCCTTCATGCT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACAGTGTAGTGGAAAATTGTCATAAAAGAAGTCTATTCCTTCATGCT  842

seq1  TGTCCGGGAAGCCCTTGAAGGTCAGCTAGCTCCATTTGGTCCCCTGGTTC  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCGGGAAGCCCTTGAAGGTCAGCTAGCTCCATTTGGTCCCCTGGTTC  892

seq1  TGCTGTCCTCTACCCAGGATAGTAAGTTTAATTAGCACCAAGGGGACCCA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTCCTCTACCCAGGATAGTAAGTTTAATTAGCACCAAGGGGACCCA  942

seq1  GTGTGAATGAGCCAGGATGTGGCATGCACTCGGCTTGGTAGTCCATGACA  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGAATGAGCCAGGATGTGGCATGCACTCGGCTTGGTAGTCCATGACA  992

seq1  TAACCTGTTGGCACATGATTATTGAATCCTTAATTCAGCAGATTATTTGC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCTGTTGGCACATGATTATTGAATCCTTAATTCAGCAGATTATTTGC  1042

seq1  TTCTTGGGTCATGCCCTAACACAGGATGAACACTGAATTC  1088
      ||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTGGGTCATGCCCTAACACAGGATGAACACTGAATTC  1082

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information