MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-169G20
Chromosome	14 (Build37)
Map Location	5,437,953 - 5,556,899
singlet/doublet	doublet
Overlap gene	LOC100041158, LOC100041501, LOC100041515
Upstream gene	2610042L04Rik, LOC100041139, LOC100041151, LOC100041177, LOC100041162, LOC100040889, LOC100040900, LOC100040917, LOC100040928, EG666560, LOC666555, EG666549, LOC100041262, LOC665981, LOC100041283, LOC100040996, LOC673676, LOC100041007, LOC100041317, LOC100041306, LOC100041024, LOC100041336, EG666815, LOC666808, EG666800, LOC100041374, 4930555G01Rik, EG666772, LOC666765, LOC100041401, LOC100041105, EG666750, LOC666743, LOC100041447, LOC673138, LOC666740, LOC641258, LOC673685
Downstream gene	LOC100041184, EG666706, LOC100041195, LOC100041545, LOC100041565, LOC100041215, LOC100041226, ENSMUSG00000057445, LOC100041598, LOC100041243, EG666684, LOC100041268, LOC100041279, LOC100041651, LOC100041287, LOC100041299, LOC666637, EG622640, LOC100041333, LOC100041678, LOC100041702, LOC100041363, LOC100041721, LOC100041784, LOC100041735, LOC100041406, LOC100041825, LOC100041421, LOC100041817
Link	Open Mouse BAC browser

Click to get alignment info.

name	2610042L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:554327 MGI:1914305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 7 Proteins

name	LOC100041139 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 7 Proteins

name	LOC100041151 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 95 ESTs, 7 Proteins

name	LOC100041177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 31 ESTs, 9 Proteins

name	LOC100041162 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein pseudo : _no_value

name	LOC100040889 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040889
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100040900 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040900
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040917 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040917
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040928 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins

name	EG666560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666560 MGI:3648127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	LOC666555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG666549 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 10 Proteins

name	LOC100041262 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 1 Protein pseudo : _no_value

name	LOC665981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 30 ESTs, 9 Proteins

name	LOC100041283 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein pseudo : _no_value

name	LOC100040996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC673676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 17 Proteins

name	LOC100041007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 13 ESTs, 9 Proteins

name	LOC100041306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein pseudo : _no_value

name	LOC100041024 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041336 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins

name	EG666815 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666815 MGI:3646944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins pseudo : _no_value

name	LOC666808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG666800 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 28 ESTs, 10 Proteins

name	LOC100041374 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 2 Proteins pseudo : _no_value

name	4930555G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108978 MGI:1922055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666772 MGI:3647811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins pseudo : _no_value

name	LOC666765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 26 ESTs, 10 Proteins

name	LOC100041401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein pseudo : _no_value

name	LOC100041105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666750 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666750 MGI:3648017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 10 Proteins

name	LOC666743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041447 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 8 Proteins pseudo : _no_value

name	LOC673138 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC641258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:641258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC673685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041158 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041501 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041515 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein pseudo : _no_value

name	LOC100041184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins

name	EG666706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041226 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	ENSMUSG00000057445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622931 MGI:3704419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein

name	LOC100041598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666684 MGI:3644039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 1 Protein pseudo : _no_value

name	LOC100041268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	LOC100041279 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein pseudo : _no_value

name	LOC100041651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 22 ESTs, 8 Proteins

name	LOC100041287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein pseudo : _no_value

name	EG622640 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 21 ESTs, 10 Proteins

name	LOC100041363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 26 ESTs, 9 Proteins

name	LOC100041735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein pseudo : _no_value

name	LOC100041406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041139 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264903 GeneID:100041139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 7 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001476172.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264909 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 7 Proteins product : similar to 2610042L04Rik, transcript variant 2 transcript_id : XM_001476203.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264913 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 89 ESTs, 2 Proteins product : similar to 2610042L04Rik, transcript variant 4 transcript_id : XM_001476236.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264907 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 2 Proteins product : similar to 2610042L04Rik, transcript variant 1 transcript_id : XM_001476183.1

name	LOC100041151 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264911 GeneID:100041151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 88 ESTs, 7 Proteins product : similar to 2610042L04Rik, transcript variant 3 transcript_id : XM_001476220.1

name	LOC100041177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264920 GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 20 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476288.1

name	LOC100041177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264918 GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 29 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476268.1

name	LOC100041177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264922 GeneID:100041177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_001476306.1

name	LOC100040928 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264871 GeneID:100040928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001475502.1

name	LOC666555 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396529 GeneID:666555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical LOC666555 transcript_id : XM_984581.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264934 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 2 Proteins product : predicted gene, EG666549, transcript variant 1 transcript_id : XM_001476364.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396527 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 8 Proteins product : predicted gene, EG666549, transcript variant 4 transcript_id : XM_984543.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264936 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : predicted gene, EG666549, transcript variant 2 transcript_id : XM_001476379.1

name	EG666549 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264938 GeneID:666549 MGI:3647882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins product : predicted gene, EG666549, transcript variant 3 transcript_id : XM_001476394.1

name	LOC665981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264943 GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 19 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476439.1

name	LOC665981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396462 GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 28 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_987294.1

name	LOC665981 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264945 GeneID:665981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476451.1

name	LOC100040996 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264874 GeneID:100040996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to diacylglycerol kinase, eta transcript_id : XM_001475622.1

name	LOC673676 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264965 GeneID:673676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to Predicted gene, EG432825 transcript_id : XM_001476642.1

name	LOC100041317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264955 GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001476517.1

name	LOC100041317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264953 GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 8 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001476500.1

name	LOC100041317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264957 GeneID:100041317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001476536.1

name	LOC100041336 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264967 GeneID:100041336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001476676.1

name	LOC666808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396556 GeneID:666808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : similar to RIKEN cDNA 1700110I01 gene transcript_id : XM_986110.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264959 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 2 Proteins product : predicted gene, EG666800, transcript variant 1 transcript_id : XM_001476557.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396554 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 8 Proteins product : predicted gene, EG666800, transcript variant 4 transcript_id : XM_986074.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264961 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : predicted gene, EG666800, transcript variant 2 transcript_id : XM_001476570.1

name	EG666800 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264963 GeneID:666800 MGI:3643799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 3 Proteins product : predicted gene, EG666800, transcript variant 3 transcript_id : XM_001476584.1

name	4930555G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381650 GeneID:108978 MGI:1922055
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930555G01 gene transcript_id : NM_175393.3

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264972 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001476808.1

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94396550 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 24 ESTs, 9 Proteins product : similar to Predicted gene, EG432825, transcript variant 3 transcript_id : XM_985877.1

name	LOC666765 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264974 GeneID:666765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001476830.1

name	EG666750 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264976 GeneID:666750 MGI:3648017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 10 Proteins product : predicted gene, EG666750 transcript_id : XM_985778.2

name	LOC666740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264901 GeneID:666740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : hypothetical LOC666740 transcript_id : XM_985716.2

name	LOC641258 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264905 GeneID:641258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475869.1

name	LOC100041158 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264915 GeneID:100041158
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001475892.1

name	LOC100041184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264924 GeneID:100041184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001475932.1

name	EG666706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264991 GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : predicted gene, EG666706, transcript variant 1 transcript_id : XM_985542.2

name	LOC100041215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264927 GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475986.1

name	LOC100041226 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264929 GeneID:100041226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476002.1

name	LOC100041598 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265001 GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 29 ESTs, 7 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477003.1

name	LOC100041598 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264999 GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477020.1

name	LOC100041243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264932 GeneID:100041243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476033.1

name	LOC100041651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265005 GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477044.1

name	LOC100041651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265007 GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 20 ESTs, 7 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477032.1

name	LOC100041287 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264949 GeneID:100041287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476104.1

name	EG622640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265015 GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 8 Proteins product : predicted gene, EG622640, transcript variant 2 transcript_id : XM_889197.3

name	EG622640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265013 GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG622640, transcript variant 1 transcript_id : XM_001477087.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265022 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 19 ESTs, 9 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477101.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265018 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477115.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265020 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001477131.1

name	LOC100041784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265037 GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477242.1

name	LOC100041784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265039 GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477252.1

name	LOC100041825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265048 GeneID:100041825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477338.1

name	LOC100041139 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264904 GeneID:100041139
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001476222.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264908 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 1 protein_id : XP_001476233.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264910 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 2 protein_id : XP_001476253.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264912 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 3 protein_id : XP_001476270.1

name	LOC100041151 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264914 GeneID:100041151
definition	codon_start : 1 product : similar to 2610042L04Rik isoform 4 protein_id : XP_001476286.1

name	LOC100041177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264923 GeneID:100041177
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_001476356.1

name	LOC100041177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264921 GeneID:100041177
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476338.1

name	LOC100041177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264919 GeneID:100041177
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476318.1

name	LOC100040928 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264872 GeneID:100040928
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001475552.1

name	LOC666555 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396530 GeneID:666555
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989675.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264937 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476429.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264935 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476414.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396528 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 4 protein_id : XP_989637.1

name	EG666549 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264939 GeneID:666549 MGI:3647882
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476444.1

name	LOC665981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264946 GeneID:665981
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476501.1

name	LOC665981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264944 GeneID:665981
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476489.1

name	LOC665981 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396463 GeneID:665981
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_992388.1

name	LOC100040996 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264875 GeneID:100040996
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475672.1

name	LOC673676 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264966 GeneID:673676
definition	codon_start : 1 product : similar to Predicted gene, EG432825 protein_id : XP_001476692.1

name	LOC100041317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264958 GeneID:100041317
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476586.1

name	LOC100041317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264956 GeneID:100041317
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476567.1

name	LOC100041317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264954 GeneID:100041317
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476550.1

name	LOC100041336 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264968 GeneID:100041336
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001476726.1

name	LOC666808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396557 GeneID:666808
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991204.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264962 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001476620.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264960 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001476607.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396555 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 4 protein_id : XP_991168.1

name	EG666800 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264964 GeneID:666800 MGI:3643799
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001476634.1

name	4930555G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425104 GeneID:108978 MGI:1922055
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC108978 protein_id : NP_780602.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264975 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001476880.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264973 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001476858.1

name	LOC666765 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396551 GeneID:666765
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 3 protein_id : XP_990971.1

name	EG666750 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264977 GeneID:666750 MGI:3648017
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_990872.2

name	LOC666740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264902 GeneID:666740
definition	codon_start : 1 product : hypothetical protein protein_id : XP_990810.2

name	LOC641258 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264906 GeneID:641258
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001475919.1

name	LOC100041158 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264916 GeneID:100041158
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001475942.1

name	LOC100041184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264925 GeneID:100041184
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001475982.1

name	EG666706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264992 GeneID:666706 MGI:3644639
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_990636.2

name	LOC100041215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264928 GeneID:100041215
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476036.1

name	LOC100041226 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264930 GeneID:100041226
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476052.1

name	LOC100041598 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265000 GeneID:100041598
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477070.1

name	LOC100041598 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265002 GeneID:100041598
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477053.1

name	LOC100041243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264933 GeneID:100041243
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476083.1

name	LOC100041651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265006 GeneID:100041651
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477094.1

name	LOC100041651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265008 GeneID:100041651
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477082.1

name	LOC100041287 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264950 GeneID:100041287
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476154.1

name	EG622640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265014 GeneID:622640 MGI:3646283
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477137.1

name	EG622640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952965 GeneID:622640 MGI:3646283
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_894290.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265019 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477165.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265021 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001477181.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265023 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477151.1

name	LOC100041784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265040 GeneID:100041784
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477302.1

name	LOC100041784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265038 GeneID:100041784
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477292.1

name	LOC100041825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265049 GeneID:100041825
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477388.1

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 4 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 3 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 2 pseudo : _no_value

name	LOC100040889 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040889
definition	number : 1 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 1 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 2 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 3 pseudo : _no_value

name	LOC100040900 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040900
definition	number : 4 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 4 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 3 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 2 pseudo : _no_value

name	LOC100040917 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040917
definition	number : 1 pseudo : _no_value

name	LOC100041007 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041007
definition	number : 3 pseudo : _no_value

name	LOC100041007 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041007
definition	number : 2 pseudo : _no_value

name	LOC100041007 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041007
definition	number : 1 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 4 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 3 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 2 pseudo : _no_value

name	LOC100041024 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041024
definition	number : 1 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 4 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 3 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 2 pseudo : _no_value

name	LOC100041105 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041105
definition	number : 1 pseudo : _no_value

name	LOC666743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666743
definition	number : 2 pseudo : _no_value

name	LOC666743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666743
definition	number : 1 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 1 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 2 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 3 pseudo : _no_value

name	LOC673138 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673138
definition	number : 4 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 1 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 2 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 3 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 1 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 2 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 3 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 5 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 4 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 3 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 2 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 1 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 4 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 3 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 2 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 1 pseudo : _no_value

name	LOC100041421 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041421
definition	number : 2 pseudo : _no_value

name	LOC100041421 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041421
definition	number : 1 pseudo : _no_value

name	2610042L04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264900 GeneID:554327 MGI:1914305
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 93 ESTs, 7 Proteins product : RIKEN cDNA 2610042L04 gene transcript_id : XR_032590.1

name	LOC100041162 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264917 GeneID:100041162
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein product : hypothetical protein LOC100041162 pseudo : _no_value transcript_id : XR_032642.1

name	EG666560 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396531 GeneID:666560 MGI:3648127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : predicted gene, EG666560 pseudo : _no_value transcript_id : XR_001891.1

name	LOC100041262 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264941 GeneID:100041262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032726.1

name	LOC100041283 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264948 GeneID:100041283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032767.1

name	LOC100041306 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264951 GeneID:100041306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein product : hypothetical protein LOC100041306 pseudo : _no_value transcript_id : XR_032779.1

name	EG666815 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94396558 GeneID:666815 MGI:3646944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins product : predicted gene, EG666815 pseudo : _no_value transcript_id : XR_001921.1

name	LOC100041374 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264969 GeneID:100041374
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 76 ESTs, 2 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032888.1

name	EG666772 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264970 GeneID:666772 MGI:3647811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins product : predicted gene, EG666772 pseudo : _no_value transcript_id : XR_032904.1

name	LOC100041401 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264971 GeneID:100041401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein product : hypothetical protein LOC100041401 pseudo : _no_value transcript_id : XR_032912.1

name	LOC100041447 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264982 GeneID:100041447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825 pseudo : _no_value transcript_id : XR_032958.1

name	LOC673685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264988 GeneID:673685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical LOC673685 pseudo : _no_value transcript_id : XR_032967.1

name	LOC100041501 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264989 GeneID:100041501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041501 pseudo : _no_value transcript_id : XR_032973.1

name	LOC100041515 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264990 GeneID:100041515
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 92 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032977.1

name	LOC100041195 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264926 GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032499.1

name	LOC100041545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264994 GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041545 pseudo : _no_value transcript_id : XR_033000.1

name	LOC100041565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264995 GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical protein LOC100041565 pseudo : _no_value transcript_id : XR_033011.1

name	ENSMUSG00000057445 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264931 GeneID:622931 MGI:3704419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : predicted gene, ENSMUSG00000057445 transcript_id : XR_032520.1

name	EG666684 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264940 GeneID:666684 MGI:3644039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 1 Protein product : predicted gene, EG666684 pseudo : _no_value transcript_id : XR_032534.1

name	LOC100041268 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264942 GeneID:100041268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032545.1

name	LOC100041279 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264947 GeneID:100041279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein product : hypothetical protein LOC100041279 pseudo : _no_value transcript_id : XR_032551.1

name	LOC666637 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264952 GeneID:666637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein product : hypothetical LOC666637 pseudo : _no_value transcript_id : XR_032568.1

name	LOC100041678 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265012 GeneID:100041678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033046.1

name	LOC100041721 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265024 GeneID:100041721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins product : hypothetical protein LOC100041721 pseudo : _no_value transcript_id : XR_033072.1

name	LOC100041735 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265026 GeneID:100041735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein product : hypothetical protein LOC100041735 pseudo : _no_value transcript_id : XR_033088.1

name	LOC100041817 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265047 GeneID:100041817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 6 Proteins product : similar to Predicted gene, EG432825 pseudo : _no_value transcript_id : XR_033173.1

clone name	B6Ng01-279O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-169G20.b	B6Ng01-169G20.g
ACC	DH960409	DH960410
length	1,232	374
definition	DH960409\|Mus musculus domesticus DNA, BAC clone: B6Ng01-169G20, 5' end.	DH960410\|Mus musculus domesticus DNA, BAC clone: B6Ng01-169G20, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(5,555,659 - 5,556,899)	(5,437,953 - 5,438,300)
sequence	gaattcctggcaaagacaaaggctgctataggtaactgtctgtcttgctt gggagcacatgagctgtagaattgccatctctgattttgatcctgcacag gagactctcgagctctggttcttgctttctgccacttcacacaggagcct ttagatttttctgttgtaaacctgtgggttgaaacactttttggggtaaa aaaaaaggtcaaaggaccctttcacagaggttgtgtatcagacaatcctt tatctcagacacttctattatggcttataacagtacaaaaattatagtac ccaagtagcaatgaaaataatcttaagtttgggaggtcactgcattaaag catccacagcatttggtaaattgagaaaccctggtcttgacagaagaact atttgtatcatgtgaggtcttcttgacccccggggctgagtcaggatcta tagagagctagttaccagcagacccatgtatagcaagtattccccttgtt tctcctttccaattcatagtgcctttgcccattccttcgtgatgtttctc cattaggatggacaggtagggacaactgtagtccacttcttctttttagg aaacatggatccctcttagtgttgggacttttggaagtagcatgagtgtt tctggaatttgctgttctctaatttttgctttctgagtgcagctcaccta gatgtcctgagttcttatctaggtcttcctgagaaccagggtctggtggg gttgatggtgtttcttataagttaataggaaaaggatagcaggggctttg tatgcattgggtgtttgcagaaacctgcagagccaccttctgatggaact gaatcagctgaagaagaaaggtagacatgctgaggaggcacaggaataag aaagtgctggaagatgaggcactggtgctgcagtacttgtgggacttaaa gggctccataagaccaataggagaggccagtgacttccagagtcaggaac aacagtagagacaggcagctttgtcaggctaatggttagctcatctgccc ttgtaacttctagacggctcatccaccttacttgtgctttcatccatcaa tcttatctcatccccacagcaatctaagtacatacttcatgaacagccaa ttgtttctaggtccatgtcagcacaaaattttctaggatgactctgtgaa agtggattatacgcagagcaatccaccctgct	gaattctactgcttcattagatgtcatgtgcttttgagggggaacgttgg ttaggactctgacatgcttaagagattttgttagcacccaaatctctagg gactgtggatgtagtagatgtttcacaaaaataaatatgccatctgagtc aattcatgtgacatacactccaatttcccagggttttcctgtctcacaga ggcaaatatcttttttctatatgtttaattgtataaaacctggataaaat tttctaactgtgcattcctttatagtgtgcatttttccatatatatatat atatatatatatatatatatatatatatatatatatatatatatatatat atatatatatatatatatatatat
quality values	Open. Hide. 55 47 25 38 61 61 61 49 61 61 55 55 61 61 61 61 59 52 61 61 55 37 61 61 59 33 28 24 31 20 18 25 28 27 36 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 45 61 59 37 44 35 36 59 52 61 61 61 61 61 61 61 61 61 61 44 37 61 61 61 61 61 61 61 61 61 61 61 59 34 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 59 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 61 61 59 43 55 61 61 61 61 61 55 55 61 59 59 61 59 55 59 59 52 61 61 59 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 47 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 47 61 52 61 61 61 61 61 61 43 61 61 61 53 61 61 53 61 61 61 61 53 61 61 57 57 53 57 57 47 53 53 57 57 57 57 57 57 52 53 53 53 53 53 57 57 53 53 57 53 57 57 57 57 53 53 45 57 53 57 53 53 50 53 57 57 37 53 53 42 42 53 53 53 53 53 40 53 53 33 57 57 57 57 47 25 47 57 57 57 57 53 57 53 45 50 53 53 53 50 52 57 57 53 57 52 30 57 57 52 57 57 57 47 53 33 57 43 47 53 57 52 33 57 52 53 53 41 50 53 43 57 43 57 57 38 38 57 43 46 45 50 52 53 31 52 52 36 50 37 52 52 40 42 33 38 46 52 42 40 34 52 39 44 53 53 53 53 28 57 38 38 52 52 50 36 40 38 32 39 53 40 47 44 44 40 48 40 45 52 31 40 36 31 38 32 24 57 52 35 39 52 53 57 37 53 57 57 53 23 53 38 37 28 44 44 32 48 37 57 53 41 48 44 33 35 23 39 33 53 41 41 36 40 37 28 44 44 57 57 35 28 40 35 24 41 28 33 27 5 39 46 38 36 48 51 39 32 29 30 32 30 32 21 34 30 31 51 45 20 47 30 51 44 27 27 25 25 47 47 37 25 31 29 30 28 28 21 34 22 29 45 18 21 30 29 30 29 29 29 29 25 31 27 24 25 25 29 33 29 18 21 29 29 19 29 41 31 29 33 21 29 33 11 21 46 11 33 18 8 36 27 26 18 24 36 29 28 34 29 36 11 43 43 21 23 17 23 29 12 21 14 29 26 29 26 31 12 43 51 33 29 27 28 24 35 25 19 23 39 15 41 15 34 40 12 31 15 17 21 31 29 33 21 28 22 34 31 25 23 21 23 27 28 39 28 34 20 21 51 23 29 15 31 31 21 51 9 24 44 24 34 33 20 39 27 29 21 14 8 9 14 21 21 30 30 28 25 14 51 16 38 13 23 19 20 14 16 31 35 34 26 29 31 20 33 13 6 13 13 34 34 19 28 15 34 16 12 19 16 25 8 23 8 19 19 29 13 27 28 9 17 25 21 17 24 17 25 44 24 14 15 23 17 23 28 9 25 12 21 21 24 26 6 15 31 14 18 13 30 7 16 8 6 13 16 35 19 22 23 13 5 20 21 10 29 29 26 26 29 10 26 4 3 4 5 11 6 6 8 14 6 9 12 27 8 7 3 11 7 8 9 10 23 24 26 33 8 22 16 29 17 30 8 15 8 4 6 15 12 14 11 9 5 9 11 13 2 2 4 9 6 3 3 4 3 4 11 24 24 5 9 2 4 4 9 10 5 6 6 4 4 20 5 4 6 4 11 24 9 9 4 12 12 5 19 4 10 9 5 9 4 12 5 13 5 9 20 12 6 9 3 3 9 5 5 4 3 4 3 3 9 4 15 4 5 9 3 11 5 4 3 3 8 4 4 1 6 3 2 5 4 3 6 4 6 2 1 4 2 1 7 18 5 3 10 5 10 4 5 4 3 5 4 5 5 6 18 18 5 7 12 8 20 25 7 4 5 6 9	Open. Hide. 61 61 59 49 34 43 23 18 52 27 30 26 26 24 59 59 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 55 55 37 44 55 59 61 61 61 59 61 61 59 59 55 36 35 41 30 55 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 55 61 61 59 59 61 61 61 61 61 61 59 59 61 61 61 61 59 59 59 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 55 50 61 50 50 61 61 50 50 61 61 61 61 50 61 61 61 50 61 61 61 61 61 61 50 61 61 61 50 61 50 50 50 35 24 25 17 32 24 22 22 24 30 27 32 27 22 27 27 26 22 26 21 20 23 23 25 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_5555659_5556899
seq2: B6Ng01-169G20.b_44_1275 (reverse)

seq1  AGCAGAGGTGGATTTGCT-TGCTGATAATCCACTTTCTCACAAGAAGCTC  49
      ||||| |||||| ||||| |||  ||||||||||||| || |      ||
seq2  AGCAG-GGTGGA-TTGCTCTGCGTATAATCCACTTTCACAGA-----GTC  43

seq1  ATTCCCCAGAAATATTTGTGCTTGGACATAGACCT--GAACAATTGGCTG  97
      ||  || |||||  ||||||||  ||||| |||||   ||||||||||||
seq2  AT--CCTAGAAAATTTTGTGCT--GACATGGACCTAGAAACAATTGGCTG  89

seq1  -TCATGAGGTATGTACTTAGATTGCTGTGTGGATGAG-TAAGA-TGATGG  144
       |||||| ||||||||||||||||||||| ||||||| ||||| ||||||
seq2  TTCATGAAGTATGTACTTAGATTGCTGTGGGGATGAGATAAGATTGATGG  139

seq1  ATGAAAGCACAGGT-AGGTGGATGAGCTCGTCTAGAAGTTACAAGGGCAG  193
      ||||||||||| || |||||||||||| ||||||||||||||||||||||
seq2  ATGAAAGCACAAGTAAGGTGGATGAGC-CGTCTAGAAGTTACAAGGGCAG  188

seq1  ATGGAGCTAACCATTAGCCTGACAAAGCTGCCTGTCTCTACCTGTTGTTC  243
      || ||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AT-GAGCTAACCATTAGCCTGACAAAGCTGCCTGTCTCTA-CTGTTGTTC  236

seq1  CTGACTCTGGAAGTCACTGGCCTCTTCCTATTGGTCCTTATGGAGCCCCT  293
      |||||||||||||||||||||||| |||||||||| ||||||||| ||||
seq2  CTGACTCTGGAAGTCACTGGCCTC-TCCTATTGGT-CTTATGGAG-CCCT  283

seq1  TTAAGTCCCACAAGTACTGCAGCACCAGTGCCTCATCTTCCAGCACTTTC  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGTCCCACAAGTACTGCAGCACCAGTGCCTCATCTTCCAGCACTTTC  333

seq1  TTATTCCTGTGCCTCCTCAGCATGTCTACC-TTCTTCTTCAGCTGATTCA  392
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TTATTCCTGTGCCTCCTCAGCATGTCTACCTTTCTTCTTCAGCTGATTCA  383

seq1  GTTCCATCAGAAGGTGGCTCTGCAGGTTTCTGCAAACACCCAATGCATAC  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCATCAGAAGGTGGCTCTGCAGGTTTCTGCAAACACCCAATGCATAC  433

seq1  AAAGCCCCTGCTATCCTTTTCCTATTAACTTATAAGAAACACCATCAACC  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCCCTGCTATCCTTTTCCTATTAACTTATAAGAAACACCATCAACC  483

seq1  CCACCAGACCCTGGTTCTCAGGAAGACCTAGATAAGAACTCAGGACATCT  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCAGACCCTGGTTCTCAGGAAGACCTAGATAAGAACTCAGGACATCT  533

seq1  AGGTGAGCTGCACTCAGAAAGCAAAAATTAGAGAACAGCAAATTCCAGAA  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAGCTGCACTCAGAAAGCAAAAATTAGAGAACAGCAAATTCCAGAA  583

seq1  ACACTCATGCTACTTCCAAAAGTCCCAACACTAAGAGGGATCCATGTTTC  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTCATGCTACTTCCAAAAGTCCCAACACTAAGAGGGATCCATGTTTC  633

seq1  CTAAAAAGAAGAAGTGGACTACAGTTGTCCCTACCTGTCCATCCTAATGG  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAAAGAAGAAGTGGACTACAGTTGTCCCTACCTGTCCATCCTAATGG  683

seq1  AGAAACATCACGAAGGAATGGGCAAAGGCACTATGAATTGGAAAGGAGAA  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACATCACGAAGGAATGGGCAAAGGCACTATGAATTGGAAAGGAGAA  733

seq1  ACAAGGGGAATACTTGCTATACATGGGTCTGCTGGTAACTAGCTCTCTAT  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGGGGAATACTTGCTATACATGGGTCTGCTGGTAACTAGCTCTCTAT  783

seq1  AGATCCTGACTCAGCCCCGGGGGTCAAGAAGACCTCACATGATACAAATA  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCCTGACTCAGCCCCGGGGGTCAAGAAGACCTCACATGATACAAATA  833

seq1  GTTCTTCTGTCAAGACCAGGGTTTCTCAATTTACCAAATGCTGTGGATGC  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTTCTGTCAAGACCAGGGTTTCTCAATTTACCAAATGCTGTGGATGC  883

seq1  TTTAATGCAGTGACCTCCCAAACTTAAGATTATTTTCATTGCTACTTGGG  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATGCAGTGACCTCCCAAACTTAAGATTATTTTCATTGCTACTTGGG  933

seq1  TACTATAATTTTTGTACTGTTATAAGCCATAATAGAAGTGTCTGAGATAA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTATAATTTTTGTACTGTTATAAGCCATAATAGAAGTGTCTGAGATAA  983

seq1  AGGATTGTCTGATACACAACCTCTGTGAAAGGGTCCTTTGACCTTTTTTT  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATTGTCTGATACACAACCTCTGTGAAAGGGTCCTTTGACCTTTTTTT  1033

seq1  TTACCCCAAAAAGTGTTTCAACCCACAGGTTTACAACAGAAAAATCTAAA  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACCCCAAAAAGTGTTTCAACCCACAGGTTTACAACAGAAAAATCTAAA  1083

seq1  GGCTCCTGTGTGAAGTGGCAGAAAGCAAGAACCAGAGCTCGAGAGTCTCC  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCCTGTGTGAAGTGGCAGAAAGCAAGAACCAGAGCTCGAGAGTCTCC  1133

seq1  TGTGCAGGATCAAAATCAGAGATGGCAATTCTACAGCTCATGTGCTCCCA  1192
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCAGGATCAAAATCAGAGATGGCAATTCTACAGCTCATGTGCTCCCA  1183

seq1  AGCAAGACAGACAGTTACCTATAGCAGCCTTTGTCTTTGCCAGGAATTC  1241
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAGACAGACAGTTACCTATAGCAGCCTTTGTCTTTGCCAGGAATTC  1232

seq1: chr14_5437953_5438300
seq2: B6Ng01-169G20.g_68_415

seq1  GAATTCTACTGCTTCATTAGATGTCATGTGCTTTTGAGGGGGAACGTTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACTGCTTCATTAGATGTCATGTGCTTTTGAGGGGGAACGTTGG  50

seq1  TTAGGACTCTGACATGCTTAAGAGATTTTGTTAGCACCCAAATCTCTAGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGACTCTGACATGCTTAAGAGATTTTGTTAGCACCCAAATCTCTAGG  100

seq1  GACTGTGGATGTAGTAGATGTTTCACAAAAATAAATATGCCATCTGAGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGTGGATGTAGTAGATGTTTCACAAAAATAAATATGCCATCTGAGTC  150

seq1  AATTCATGTGACATACACTCCAATTTCCCAGGGTTTTCCTGTCTCACAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCATGTGACATACACTCCAATTTCCCAGGGTTTTCCTGTCTCACAGA  200

seq1  GGCAAATATCTTTTTTCTATATGTTTAATTGTATAAAACCTGGATAAAAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAATATCTTTTTTCTATATGTTTAATTGTATAAAACCTGGATAAAAT  250

seq1  TTTCTAACTGTGCATTCCTTTATAGTGTGCATTTTTCCATATATATATAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTAACTGTGCATTCCTTTATAGTGTGCATTTTTCCATATATATATAT  300

seq1  ATATATATATATATATATATATATATATATATATATATATATATATAT  348
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATATATATATATATATATATATATATATATATATATATATATAT  348

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information