MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-184M07
Chromosome	14 (Build37)
Map Location	54,040,501 - 54,084,461
singlet/doublet	doublet
Overlap gene	LOC328483
Upstream gene	OTTMUSG00000015242, Olfr1509, Olfr1508, Olfr1507, LOC671621, EG633692, LOC100042372, EG667441, LOC100042384, Trav5-1, EG667449, LOC671652, Trav6-2, LOC100042410, LOC546612, LOC627394, LOC100042419, Gm701, LOC382180, EG386506, LOC667476, LOC671927, LOC667481, LOC100042444, LOC640196, LOC627273, LOC100043177, LOC640931, EG627232, LOC100043186, LOC100042470, EG328482, LOC100042479, EG667525, LOC100043197, LOC100038850, LOC667542, EG667547, LOC100043214, EG667562, LOC100043202, LOC667574, Gm26, EG667583, Gm1489, C920008G01Rik, LOC667596, EG667604, LOC547329, LOC639655, LOC634322, EG636127, OTTMUSG00000015163, EG667626, LOC620297, LOC100042560, EG667635, LOC100043218, LOC100042568, LOC100043204, EG627424, LOC100043258, LOC100042574, LOC100042579, LOC100043269, LOC100043270, LOC100043274, EG667681, LOC100042593, EG193574, EG547424, LOC100042601, LOC100043282, A130082M07Rik, LOC100042607, LOC100042614, LOC100042621, LOC100043319, EG547328, LOC100043308
Downstream gene	EG667765, EG630061, LOC630086, EG436467, LOC100043322, OTTMUSG00000015124, A430107P09Rik, OTTMUSG00000015049, LOC100043325, A730076H11Rik, LOC627777, A630038E17Rik, EG626545, Dad1, Abhd4, Olfr49, EG666623, LOC667819, LOC100042642, 5330426L24Rik, Oxa1l, Slc7a7, Mrpl52, Mmp14, Lrp10
Link	Open Mouse BAC browser

Click to get alignment info.

name	OTTMUSG00000015242 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627171 MGI:3651476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Olfr1509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57271 MGI:3031343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1508 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57270 MGI:3031342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57269 MGI:3031341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG633692 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633692 MGI:3644290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC100042372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG667441 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667441 MGI:3644489
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins

name	LOC100042384 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Trav5-1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG667449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667449 MGI:3644497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC671652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	Trav6-2 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100042410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	LOC546612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC627394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins

name	LOC100042419 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Gm701 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277146 MGI:2685547
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC382180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG386506 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386506 MGI:3647344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins

name	LOC667476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC671927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC667481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100042444 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC640196 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC627273 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 13 Proteins

name	LOC100043177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 25 Proteins

name	LOC640931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	EG627232 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627232 MGI:3643503
definition	note : predicted gene, EG627232 pseudo : _no_value

name	LOC100043186 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100042470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG328482 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328482 MGI:3704129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins

name	LOC100042479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins

name	EG667525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667525 MGI:3647073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 651 ESTs, 8 Proteins

name	LOC100043197 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins

name	LOC100038850 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667542 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	EG667547 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667547 MGI:3643151
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	LOC100043214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins

name	EG667562 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667562 MGI:3643203
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC667574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	Gm26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195296 MGI:2684872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	EG667583 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667583 MGI:3704130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	Gm1489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385047 MGI:2686335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	C920008G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320734 MGI:2444626
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins

name	LOC667596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins

name	EG667604 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667604 MGI:3647760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC547329 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC639655 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:639655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC634322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins

name	EG636127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636127 MGI:3644878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	OTTMUSG00000015163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279872 MGI:3649609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	EG667626 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667626 MGI:3647936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC620297 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC100042560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG667635 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667635 MGI:3644782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins

name	LOC100043218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 26 Proteins

name	LOC100042568 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	LOC100043204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 11 Proteins

name	EG627424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627424 MGI:3645758
definition	note : predicted gene, EG627424 pseudo : _no_value

name	LOC100043258 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC100042574 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042579 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins

name	LOC100043269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 651 ESTs, 8 Proteins

name	LOC100043270 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins

name	LOC100043274 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 14 Proteins

name	EG667681 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667681 MGI:3704131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC100042593 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042593
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG193574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:193574 MGI:3645258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins

name	EG547424 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547424 MGI:3649172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042601 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042601
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100043282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	A130082M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279882 MGI:3583949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins

name	LOC100042607 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC100042614 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	LOC100042621 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins

name	LOC100043319 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG547328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547328 MGI:3645598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100043308 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 10 Proteins

name	LOC328483 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:328483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins

name	EG667765 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667765 MGI:3704132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	EG630061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630061 MGI:3648929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC630086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	EG436467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436467 MGI:3646773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	LOC100043322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins

name	OTTMUSG00000015124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667567 MGI:3702149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 8 Proteins

name	A430107P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320898 MGI:2444988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000015049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213480 MGI:3702133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins

name	LOC100043325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	A730076H11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211027 MGI:2684925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	LOC627777 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	A630038E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219065 MGI:2444676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 2 Proteins

name	EG626545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626545 MGI:3704133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Dad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13135 MGI:101912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105501 MGI:1915938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr49 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18348 MGI:1333764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666623 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666623 MGI:3643351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC667819 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	LOC100042642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	5330426L24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78285 MGI:1925535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST

name	Oxa1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69089 MGI:1916339
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20540 MGI:1337120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl52 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68836 MGI:1916086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17387 MGI:101900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65107 MGI:1929480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11464992 GeneID:57271 MGI:3031343
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1509 transcript_id : NM_020514.1

name	Olfr1508 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821657 GeneID:57270 MGI:3031342
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1508 transcript_id : NM_020513.2

name	Olfr1507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048447 GeneID:57269 MGI:3031341
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1507 transcript_id : NM_020512.1

name	EG633692 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397073 GeneID:633692 MGI:3644290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : predicted gene, EG633692 transcript_id : XM_990534.1

name	LOC100042372 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265544 GeneID:100042372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to unnamed protein product transcript_id : XM_001478064.1

name	EG667449 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265546 GeneID:667449 MGI:3644497
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG667449 transcript_id : XM_990610.2

name	LOC671652 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265548 GeneID:671652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to TRAV7-1 transcript_id : XM_001478118.1

name	LOC100042410 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265551 GeneID:100042410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to TRAV7D-2 transcript_id : XM_001478136.1

name	LOC627394 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265670 GeneID:627394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins product : similar to T-cell receptor alpha precursor transcript_id : XM_207041.7

name	LOC100042419 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265554 GeneID:100042419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to T cell receptor alpha transcript_id : XM_001478155.1

name	LOC382180 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265558 GeneID:382180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to T-cell receptor alpha chain transcript_id : XM_001478172.1

name	EG386506 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82954105 GeneID:386506 MGI:3647344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 8 Proteins product : predicted gene, EG386506 transcript_id : XM_359354.4

name	LOC667476 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397082 GeneID:667476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to TRAV8D-1 transcript_id : XM_990762.1

name	LOC671927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265560 GeneID:671927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to TRAV9-1 transcript_id : XM_001478200.1

name	LOC667481 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265562 GeneID:667481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : similar to T cell receptor alpha MD13 transcript_id : XM_990789.2

name	LOC100042444 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265564 GeneID:100042444
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to TRAV6-6 transcript_id : XM_001478230.1

name	LOC640196 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265566 GeneID:640196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to T-cell receptor alpha-chain precursor VJC transcript_id : XM_001478240.1

name	LOC100043177 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265676 GeneID:100043177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 25 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_001479512.1

name	LOC640931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265568 GeneID:640931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : similar to TRAV13D-1 transcript_id : XM_001478254.1

name	LOC100043186 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265678 GeneID:100043186
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : hypothetical protein LOC100043186 transcript_id : XM_001479521.1

name	LOC100042470 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265570 GeneID:100042470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100042470 transcript_id : XM_001478272.1

name	LOC100042479 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265572 GeneID:100042479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to T-cell receptor alpha chain (lysozyme peptide specific) - mouse transcript_id : XM_001478285.1

name	EG667525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397092 GeneID:667525 MGI:3647073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 651 ESTs, 8 Proteins product : predicted gene, EG667525 transcript_id : XM_991053.1

name	LOC100043197 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265682 GeneID:100043197
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins product : similar to T cell receptor V alpha 8.5 transcript_id : XM_001479539.1

name	LOC100038850 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265365 GeneID:100038850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038850 transcript_id : XM_001471582.1

name	LOC667542 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265574 GeneID:667542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_991132.2

name	LOC100043214 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265690 GeneID:100043214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins product : similar to T cell receptor alpha chain TCRalphaJ12A transcript_id : XM_001479584.1

name	LOC100043202 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265686 GeneID:100043202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : hypothetical protein LOC100043202 transcript_id : XM_001479551.1

name	LOC667574 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265695 GeneID:667574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to A430107P09Rik protein transcript_id : XM_991287.2

name	Gm26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51768682 GeneID:195296 MGI:2684872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : gene model 26, (NCBI) transcript_id : XM_111555.4

name	EG667583 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397117 GeneID:667583 MGI:3704130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : predicted gene, EG667583 transcript_id : XM_991341.1

name	LOC667596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397119 GeneID:667596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins product : similar to TRAV13-3 transcript_id : XM_991386.1

name	EG667604 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397121 GeneID:667604 MGI:3647760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG667604 transcript_id : XM_991409.1

name	LOC547329 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265575 GeneID:547329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to T-cell receptor alpha chain transcript_id : XM_001478379.1

name	LOC639655 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265577 GeneID:639655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to T-cell receptor alpha chain transcript_id : XM_916174.3

name	EG636127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265579 GeneID:636127 MGI:3644878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG636127 transcript_id : XM_911417.3

name	EG667626 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265583 GeneID:667626 MGI:3647936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG667626 transcript_id : XM_991545.2

name	LOC620297 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265585 GeneID:620297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to TRAV6D-6 transcript_id : XM_001478422.1

name	EG667635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397130 GeneID:667635 MGI:3644782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG667635, transcript variant 2 transcript_id : XM_991597.1

name	EG667635 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265697 GeneID:667635 MGI:3644782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG667635, transcript variant 1 transcript_id : XM_001479619.1

name	LOC100043218 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265693 GeneID:100043218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 26 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_001479593.1

name	LOC100042568 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265587 GeneID:100042568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to TRAV13D-1 transcript_id : XM_001478435.1

name	LOC100043204 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265688 GeneID:100043204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 11 Proteins product : similar to T-cell receptor alpha transcript_id : XM_001479556.1

name	LOC100043258 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265699 GeneID:100043258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : hypothetical protein LOC100043258 transcript_id : XM_001479624.1

name	LOC100042574 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265591 GeneID:100042574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100042574 transcript_id : XM_001478450.1

name	LOC100042579 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265593 GeneID:100042579
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : similar to T-cell receptor alpha chain (lysozyme peptide specific) - mouse transcript_id : XM_001478458.1

name	LOC100043269 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265701 GeneID:100043269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 651 ESTs, 8 Proteins product : similar to ribosomal protein S19 transcript_id : XM_001479631.1

name	LOC100043270 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265703 GeneID:100043270
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 28 Proteins product : similar to T cell receptor V alpha 8.5 transcript_id : XM_001479634.1

name	LOC100043274 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265705 GeneID:100043274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 4 ESTs, 14 Proteins product : similar to A430107P09Rik protein transcript_id : XM_001479640.1

name	EG667681 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265595 GeneID:667681 MGI:3704131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG667681 transcript_id : XM_991852.2

name	EG193574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397144 GeneID:193574 MGI:3645258
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 9 Proteins product : predicted gene, EG193574 transcript_id : XM_110073.5

name	LOC100043282 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265707 GeneID:100043282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : hypothetical protein LOC100043282 transcript_id : XM_001479646.1

name	LOC100042607 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265596 GeneID:100042607
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to Tcell receptor alpha chain transcript_id : XM_001478486.1

name	LOC100042614 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265598 GeneID:100042614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : similar to TRAV5D-4 transcript_id : XM_001478499.1

name	LOC100042621 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265600 GeneID:100042621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins product : similar to T-cell receptor alpha chain V region transcript_id : XM_001478512.1

name	LOC100043319 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265723 GeneID:100043319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100043319 transcript_id : XM_001479729.1

name	EG547328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82954146 GeneID:547328 MGI:3645598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG547328 transcript_id : XM_622800.2

name	LOC100043308 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265715 GeneID:100043308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 10 Proteins product : similar to TCR V alpha chain transcript_id : XM_001479692.1

name	LOC328483 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265722 GeneID:328483
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 7 Proteins product : similar to T-cell receptor alpha chain V region CTL-F3 precursor transcript_id : XM_283255.7

name	LOC630086 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265720 GeneID:630086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : similar to OTTMUSG00000015204 protein transcript_id : XM_001479712.1

name	LOC100043322 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265725 GeneID:100043322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to T cell receptor V alpha 8.5 transcript_id : XM_001479731.1

name	OTTMUSG00000015124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397106 GeneID:667567 MGI:3702149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 8 Proteins product : predicted gene, OTTMUSG00000015124, transcript variant 2 transcript_id : XM_994498.1

name	A430107P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801826 GeneID:320898 MGI:2444988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430107P09 gene transcript_id : NM_177288.4

name	LOC100043325 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265727 GeneID:100043325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043325 transcript_id : XM_001479735.1

name	LOC627777 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265711 GeneID:627777
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC627777 transcript_id : XM_001479684.1

name	EG626545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397123 GeneID:626545 MGI:3704133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG626545, transcript variant 2 transcript_id : XM_900951.2

name	Dad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351016 GeneID:13135 MGI:101912
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defender against cell death 1 transcript_id : NM_010015.3

name	Abhd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527301 GeneID:105501 MGI:1915938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 4 transcript_id : NM_134076.1

name	Olfr49 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754931 GeneID:18348 MGI:1333764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 49 transcript_id : NM_010991.1

name	Oxa1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343620 GeneID:69089 MGI:1916339
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidase assembly 1-like transcript_id : NM_026936.2

name	Slc7a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370571 GeneID:20540 MGI:1337120
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 transcript_id : NM_011405.3

name	Mrpl52 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387454 GeneID:68836 MGI:1916086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L52 transcript_id : NM_026851.2

name	Mmp14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982190 GeneID:17387 MGI:101900
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 14 (membrane-inserted) transcript_id : NM_008608.2

name	Lrp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58530883 GeneID:65107 MGI:1929480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : low-density lipoprotein receptor-related protein 10 transcript_id : NM_022993.3

name	OTTMUSG00000015242 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:627171 MGI:3651476
definition	codon_start : 1 exception : rearrangement required for product

name	Olfr1509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11464993 CCDS:CCDS27060.1 GeneID:57271 MGI:3031343
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR244-3; GA_x6K02T2RJGY-534312-533386; gene for odorant receptor MOR83 product : odorant receptor MOR83 protein_id : NP_065260.1

name	Olfr1508 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048450 CCDS:CCDS27061.1 GeneID:57270 MGI:3031342
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR244-2; GA_x6K02T2RJGY-520647-521579; gene for odorant receptor MOR10 product : odorant receptor MOR10 protein_id : NP_065259.1

name	Olfr1507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048448 CCDS:CCDS27062.1 GeneID:57269 MGI:3031341
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : olfactory receptor MOR244-1; GA_x6K02T2RJGY-491851-492792; gene for odorant receptor MOR28 product : odorant receptor MOR28 protein_id : NP_065258.1

name	EG633692 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397074 GeneID:633692 MGI:3644290
definition	codon_start : 1 product : similar to ATPase, H+ transporting, lysosomal accessory protein 2 protein_id : XP_995628.1

name	LOC100042372 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265545 GeneID:100042372
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478114.1

name	EG667441 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667441 MGI:3644489
definition	codon_start : 1 exception : rearrangement required for product

name	Trav5-1 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:633740
definition	codon_start : 1 exception : rearrangement required for product

name	EG667449 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265547 GeneID:667449 MGI:3644497
definition	codon_start : 1 product : similar to T-cell receptor alpha-chain protein_id : XP_995704.2

name	LOC671652 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265549 GeneID:671652
definition	codon_start : 1 product : similar to TRAV7-1 protein_id : XP_001478168.1

name	Trav6-2 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:436539
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100042410 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265552 GeneID:100042410
definition	codon_start : 1 product : similar to TRAV7D-2 protein_id : XP_001478186.1

name	LOC627394 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82954113 GeneID:627394
definition	codon_start : 1 product : hypothetical protein protein_id : XP_207041.2

name	LOC100042419 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265555 GeneID:100042419
definition	codon_start : 1 product : similar to T cell receptor alpha protein_id : XP_001478205.1

name	Gm701 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:277146 MGI:2685547
definition	codon_start : 1 exception : rearrangement required for product

name	LOC382180 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265559 GeneID:382180
definition	codon_start : 1 product : similar to T-cell receptor alpha chain protein_id : XP_001478222.1

name	EG386506 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954106 GeneID:386506 MGI:3647344
definition	codon_start : 1 product : similar to Solute carrier family 45, member 4 protein_id : XP_359354.2

name	LOC667476 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397083 GeneID:667476
definition	codon_start : 1 product : similar to TRAV8D-1 protein_id : XP_995856.1

name	LOC671927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265561 GeneID:671927
definition	codon_start : 1 product : similar to TRAV9-1 protein_id : XP_001478250.1

name	LOC667481 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265563 GeneID:667481
definition	codon_start : 1 product : similar to T cell receptor alpha MD13 protein_id : XP_995883.2

name	LOC100042444 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265565 GeneID:100042444
definition	codon_start : 1 product : similar to TRAV6-6 protein_id : XP_001478280.1

name	LOC640196 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265567 GeneID:640196
definition	codon_start : 1 product : similar to T-cell receptor alpha-chain precursor VJC protein_id : XP_001478290.1

name	LOC627273 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:627273
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043177 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265677 GeneID:100043177
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_001479562.1

name	LOC640931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265569 GeneID:640931
definition	codon_start : 1 product : similar to TRAV13D-1 protein_id : XP_001478304.1

name	LOC100043186 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265679 GeneID:100043186
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479571.1

name	LOC100042470 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265571 GeneID:100042470
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478322.1

name	EG328482 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:328482 MGI:3704129
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100042479 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265573 GeneID:100042479
definition	codon_start : 1 product : similar to T-cell receptor alpha chain (lysozyme peptide specific) - mouse protein_id : XP_001478335.1

name	EG667525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397093 GeneID:667525 MGI:3647073
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996147.1

name	LOC100043197 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265683 GeneID:100043197
definition	codon_start : 1 product : similar to T cell receptor V alpha 8.5 protein_id : XP_001479589.1

name	LOC100038850 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265366 GeneID:100038850
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471632.1

name	LOC667542 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397097 GeneID:667542
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_996226.1

name	LOC100043214 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265691 GeneID:100043214
definition	codon_start : 1 product : similar to T cell receptor alpha chain TCRalphaJ12A protein_id : XP_001479634.1

name	LOC100043202 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265687 GeneID:100043202
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479601.1

name	LOC667574 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265696 GeneID:667574
definition	codon_start : 1 product : hypothetical protein protein_id : XP_996381.2

name	Gm26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51768683 GeneID:195296 MGI:2684872
definition	codon_start : 1 product : similar to Tcell receptor alpha chain protein_id : XP_111555.4

name	EG667583 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397118 GeneID:667583 MGI:3704130
definition	codon_start : 1 product : similar to TRAV5D-4 protein_id : XP_996435.1

name	Gm1489 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:385047 MGI:2686335
definition	codon_start : 1 exception : rearrangement required for product

name	C920008G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:320734 MGI:2444626
definition	codon_start : 1 exception : rearrangement required for product

name	LOC667596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397120 GeneID:667596
definition	codon_start : 1 product : similar to TRAV13-3 protein_id : XP_996480.1

name	EG667604 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397122 GeneID:667604 MGI:3647760
definition	codon_start : 1 product : similar to TRAV8-2 protein_id : XP_996503.1

name	LOC547329 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265576 GeneID:547329
definition	codon_start : 1 product : similar to T-cell receptor alpha chain protein_id : XP_001478429.1

name	LOC639655 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265578 GeneID:639655
definition	codon_start : 1 product : similar to T-cell receptor alpha chain protein_id : XP_921267.3

name	LOC634322 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:634322
definition	codon_start : 1 exception : rearrangement required for product

name	LOC634322 (CDS detail)
type	CDS
link	vega ensembl
xref	GeneID:634322
definition	codon_start : 1 exception : rearrangement required for product

name	EG636127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265580 GeneID:636127 MGI:3644878
definition	codon_start : 1 product : similar to TRAV7D-4 protein_id : XP_916510.2

name	OTTMUSG00000015163 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:279872 MGI:3649609
definition	codon_start : 1 exception : rearrangement required for product note : overriding stop codons transl_except : (pos:53721935..53721937,aa:OTHER) transl_except : (pos:53721968..53721970,aa:OTHER)

name	EG667626 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265584 GeneID:667626 MGI:3647936
definition	codon_start : 1 product : similar to T cell receptor alpha chain protein_id : XP_996639.2

name	LOC620297 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265586 GeneID:620297
definition	codon_start : 1 product : similar to TRAV6D-6 protein_id : XP_001478472.1

name	EG667635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397131 GeneID:667635 MGI:3644782
definition	codon_start : 1 product : similar to T cell receptor alpha chain isoform 2 protein_id : XP_996691.1

name	EG667635 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265698 GeneID:667635 MGI:3644782
definition	codon_start : 1 product : similar to T cell receptor alpha chain isoform 1 protein_id : XP_001479669.1

name	LOC100043218 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265694 GeneID:100043218
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_001479643.1

name	LOC100042568 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265588 GeneID:100042568
definition	codon_start : 1 product : similar to TRAV13D-1 protein_id : XP_001478485.1

name	LOC100043204 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265689 GeneID:100043204
definition	codon_start : 1 product : similar to T-cell receptor alpha protein_id : XP_001479606.1

name	LOC100043258 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265700 GeneID:100043258
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479674.1

name	LOC100042574 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265592 GeneID:100042574
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478500.1

name	LOC100042579 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265594 GeneID:100042579
definition	codon_start : 1 product : similar to T-cell receptor alpha chain (lysozyme peptide specific) - mouse protein_id : XP_001478508.1

name	LOC100043269 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265702 GeneID:100043269
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479681.1

name	LOC100043270 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265704 GeneID:100043270
definition	codon_start : 1 product : similar to T cell receptor V alpha 8.5 protein_id : XP_001479684.1

name	LOC100043274 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265706 GeneID:100043274
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479690.1

name	EG667681 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397143 GeneID:667681 MGI:3704131
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_996946.1

name	EG193574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51784308 GeneID:193574 MGI:3645258
definition	codon_start : 1 product : similar to T cell receptor alpha chain TCRalphaJ12A protein_id : XP_110073.2

name	EG547424 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:547424 MGI:3649172
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043282 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265708 GeneID:100043282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479696.1

name	A130082M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:279882 MGI:3583949
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100042607 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265597 GeneID:100042607
definition	codon_start : 1 product : similar to Tcell receptor alpha chain protein_id : XP_001478536.1

name	LOC100042614 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265599 GeneID:100042614
definition	codon_start : 1 product : similar to TRAV5D-4 protein_id : XP_001478549.1

name	LOC100042621 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265601 GeneID:100042621
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478562.1

name	EG547328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954147 GeneID:547328 MGI:3645598
definition	codon_start : 1 product : similar to TRAV13-3 protein_id : XP_622800.2

name	LOC100043319 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265724 GeneID:100043319
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479779.1

name	LOC100043308 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265716 GeneID:100043308
definition	codon_start : 1 product : similar to TCR V alpha chain protein_id : XP_001479742.1

name	LOC328483 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:28480975 GeneID:328483
definition	codon_start : 1 product : hypothetical protein protein_id : XP_283255.1

name	EG667765 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:667765 MGI:3704132
definition	codon_start : 1 exception : rearrangement required for product

name	EG630061 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:630061 MGI:3648929
definition	codon_start : 1 exception : rearrangement required for product

name	LOC630086 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265721 GeneID:630086
definition	codon_start : 1 product : similar to OTTMUSG00000015204 protein protein_id : XP_001479762.1

name	EG436467 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:436467 MGI:3646773
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043322 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265726 GeneID:100043322
definition	codon_start : 1 product : similar to T cell receptor V alpha 8.5 protein_id : XP_001479781.1

name	OTTMUSG00000015124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397107 GeneID:667567 MGI:3702149
definition	codon_start : 1 product : similar to T cell receptor Va 2.5 isoform 2 protein_id : XP_999592.1

name	A430107P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626020 GeneID:320898 MGI:2444988
definition	codon_start : 1 note : T-cell receptor alpha chain; T cell receptor, variable region product : hypothetical protein LOC320898 protein_id : NP_796262.2

name	OTTMUSG00000015049 (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:213480 MGI:3702133
definition	codon_start : 1 exception : rearrangement required for product

name	LOC100043325 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265728 GeneID:100043325
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479785.1

name	LOC627777 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265712 GeneID:627777
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479734.1

name	A630038E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI
xref	GeneID:219065 MGI:2444676
definition	codon_start : 1 exception : rearrangement required for product

name	EG626545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954055 GeneID:626545 MGI:3704133
definition	codon_start : 1 product : similar to TRDV5 isoform 2 protein_id : XP_906044.1

name	Dad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753598 CCDS:CCDS27084.1 GeneID:13135 MGI:101912
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] codon_start : 1 product : defender against cell death 1 protein_id : NP_034145.1

name	Abhd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527302 GeneID:105501 MGI:1915938
definition	GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : abhydrolase domain containing 4 protein_id : NP_598837.1

name	Olfr49 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754932 CCDS:CCDS27085.1 GeneID:18348 MGI:1333764
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR118-1; GA_x6K02T2QVSB-39745261-39746202 product : olfactory receptor 49 protein_id : NP_035121.1

name	Oxa1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037139 CCDS:CCDS27086.1 GeneID:69089 MGI:1916339
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0051205 - protein insertion into membrane [Evidence IEA] codon_start : 1 product : oxidase assembly 1-like protein_id : NP_081212.1

name	Slc7a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625647 CCDS:CCDS27087.1 GeneID:20540 MGI:1337120
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 protein_id : NP_035535.2

name	Mrpl52 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348981 CCDS:CCDS27088.1 GeneID:68836 MGI:1916086
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : mitochondrial ribosomal protein L52 protein_id : NP_081127.1

name	Mmp14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982191 GeneID:17387 MGI:101900
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Membrane type 1-MMP; type 1 matrix metalloprotease 14 product : matrix metalloproteinase 14 (membrane-inserted) protein_id : NP_032634.2

name	Lrp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981254 CCDS:CCDS27089.1 GeneID:65107 MGI:1929480
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005041 - low-density lipoprotein receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IDA]; GO:0006869 - lipid transport [Evidence IDA] codon_start : 1 product : low-density lipoprotein receptor-related protein 10 precursor protein_id : NP_075369.2

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 4 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 3 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 2 pseudo : _no_value

name	LOC671621 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671621
definition	number : 1 pseudo : _no_value

name	LOC100042384 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042384
definition	number : 1 pseudo : _no_value

name	LOC100042384 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042384
definition	number : 2 pseudo : _no_value

name	LOC546612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546612
definition	number : 1 pseudo : _no_value

name	LOC546612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546612
definition	number : 2 pseudo : _no_value

name	EG667547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667547
definition	number : 1 pseudo : _no_value

name	EG667547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667547
definition	number : 2 pseudo : _no_value

name	EG667547 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667547
definition	number : 3 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 4 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 3 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 2 pseudo : _no_value

name	EG667562 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667562
definition	number : 1 pseudo : _no_value

name	LOC100042560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042560
definition	number : 1 pseudo : _no_value

name	LOC100042560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042560
definition	number : 2 pseudo : _no_value

name	LOC100042593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042593
definition	number : 1 pseudo : _no_value

name	LOC100042593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042593
definition	number : 2 pseudo : _no_value

name	LOC100042593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042593
definition	number : 3 pseudo : _no_value

name	LOC100042601 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042601
definition	number : 4 pseudo : _no_value

name	LOC100042601 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042601
definition	number : 3 pseudo : _no_value

name	LOC100042601 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042601
definition	number : 2 pseudo : _no_value

name	LOC100042601 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042601
definition	number : 1 pseudo : _no_value

name	EG666623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666623
definition	number : 1 pseudo : _no_value

name	LOC100042642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042642
definition	number : 1 pseudo : _no_value

name	LOC100042642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042642
definition	number : 2 pseudo : _no_value

name	Trav5-1 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:633740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins standard_name : Trav5-1

name	Trav6-2 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:436539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins standard_name : Trav6-2

name	LOC627273 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:627273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins standard_name : LOC627273

name	Gm1489 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:385047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins standard_name : Gm1489

name	LOC634322 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:634322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs standard_name : LOC634322

name	LOC634322 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:634322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 13 Proteins standard_name : LOC634322

name	EG667765 (CDS detail)
type	V_segment
link	vega ensembl
xref	GeneID:667765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins standard_name : EG667765

name	EG547424 (CDS detail)
type	J_segment
link	vega ensembl
xref	GeneID:547424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein standard_name : EG547424

name	OTTMUSG00000015242 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:627171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein standard_name : OTTMUSG00000015242

name	EG667441 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:667441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 14 Proteins standard_name : EG667441

name	Gm701 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:277146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins standard_name : Gm701

name	EG328482 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:328482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 11 Proteins standard_name : EG328482

name	C920008G01Rik (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:320734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 12 Proteins standard_name : C920008G01Rik

name	OTTMUSG00000015163 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:279872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins standard_name : OTTMUSG00000015163

name	A130082M07Rik (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:279882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 14 Proteins standard_name : A130082M07Rik

name	EG630061 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:630061
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA standard_name : EG630061

name	EG436467 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:436467
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs standard_name : EG436467

name	OTTMUSG00000015049 (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:213480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins standard_name : OTTMUSG00000015049

name	A630038E17Rik (CDS detail)
type	C_region
link	vega ensembl
xref	GeneID:219065
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 2 Proteins standard_name : A630038E17Rik

name	A730076H11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265719 GeneID:211027 MGI:2684925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : RIKEN cDNA A730076H11 gene transcript_id : XR_034339.1

name	LOC667819 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265602 GeneID:667819
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to hCG26831 pseudo : _no_value transcript_id : XR_033747.1

name	5330426L24Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265731 GeneID:78285 MGI:1925535
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST product : RIKEN cDNA 5330426L24 gene transcript_id : XR_035439.1

clone name	MSMg01-071D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123A07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-431K20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301K23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-107A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-278K12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-432I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-191I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-508G10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-232M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160P05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-184M07.b	B6Ng01-184M07.g
ACC	GA010059	GA010060
length	1,103	412
definition	B6Ng01-184M07.b	B6Ng01-184M07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(54,083,448 - 54,084,461)	(54,040,501 - 54,040,913)
sequence	gaattctctgaaaggtcaggctgaatcaagtcaacagctgtaccacttca agcccagccttttcagtcccaacctgtttttctcaaatattcatgggcaa aagaatcccaagttcagattttgcttctcaggaaatcaatctaaggcaat gtgttatttcttttaatactgaaacaaatattgaaatatttatcatacta aatcacatagcaaatgaccccaaattagtttcttttctgttactttgata aaatactgagtccaaaaagaaacttatagaagattgtattttggcttagg ttccagaaggataacagtccatcttagtaggaggaacacatgacagcaag cagtagtcatggtagctagagcacaaagttcagcaatcgcatctttaacc acaagcataaatgtagagagtgaacttgaagtggggtgatgctatgactc tcaaagtccagccccaatgactaacttccttcagcaaggcctcctctctt gcatgtccctgaaatctgtgctaccaactgggaagtaagtggtcaatatg tgagaatatgaaaaacattctcactctaaccaccacagacctcttaataa cataatcaatattcaaatcggaacattatcctggatttttgccaaaatgg cataaagccagaaaacataaaataagaagctgaacaaatttttaagtatt tttattctacagcaactttttaatccccctcagtgccatttcatgtatgt ccatattccccctaagctcctctccagacttcatgccacttttttctata gcccactatgtccatagtatgttacccatatctccattatgaggacatac actgaagcatggaaaacttaacagtgaccatactgtgaattagagatgat tatcccatgaatttgaaggaataaatggctcagtggttaagatactagca gctctttctgaggacctgtggtagatttccagcacccacatggcagctca cagctatctgtaaccttggttccaggtgacctgatacccacccacatata tacataacatgcagttaaagcacatgtacataaaaattattttaagaaag aga	atggatatagcttctgagtttacaaggaaacacatcctccagattaactg gctcacatgatctttctactcttcctttgcactgtttcctgagccttagg tgtgggaattttcgaagatgcatgcactgggactaggctccaccatatat atatatatgtatatatatagttagttagttagttagttagttagttagtt agaggaagttaaaggggaattactggatacgtgtgacttgataaggtaaa tgggaaaaagaaattcattgtagggaagggggatggagattaatacagaa gaaggggatgatgattaatggaatggaattgaaaaataaaaaataaaccc tcacacttttggacatctggttttccccctatctatttattttatctatc tatctatctatc
quality values	Open. Hide. 46 31 22 32 62 62 62 62 62 62 47 62 62 62 41 11 47 47 62 62 62 62 62 49 62 59 59 59 59 62 62 59 43 45 43 30 30 28 38 59 40 34 40 27 27 28 32 48 49 56 62 62 62 62 59 59 62 62 54 54 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 48 48 43 43 46 49 62 62 62 62 62 54 59 62 62 54 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 42 49 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 54 58 46 58 58 58 58 49 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 48 54 53 58 54 58 58 58 54 54 54 58 58 58 58 58 54 58 54 52 58 54 54 54 54 58 58 58 49 58 58 58 46 58 53 39 58 58 58 58 58 58 58 51 52 52 51 51 51 58 58 58 58 58 58 38 35 58 58 58 58 51 47 46 26 58 58 41 48 58 46 50 52 51 50 58 58 53 42 58 49 53 58 38 38 44 42 50 58 41 58 58 51 53 50 58 53 58 50 52 53 58 50 51 58 37 26 58 49 41 58 58 58 52 53 49 50 53 39 41 58 58 58 39 50 39 58 52 42 52 50 52 42 52 50 50 50 50 54 49 49 44 29 46 47 49 54 54 54 54 51 39 52 37 34 53 32 54 31 52 54 51 41 42 42 54 40 45 52 54 40 54 35 32 52 49 53 42 51 54 54 54 36 31 33 53 31 53 53 35 34 53 53 39 28 37 25 40 53 24 47 49 35 32 52 52 34 47 32 34 35 51 53 51 49 28 32 40 32 34 24 32 31 53 34 34 32 32 32 36 53 34 34 24 30 53 40 32 34 35 31 51 31 30 30 26 51 30 33 39 31 37 30 31 41 41 26 31 45 38 31 32 51 28 42 31 30 28 31 31 43 19 32 31 42 32 41 18 30 32 31 23 26 9 47 48 31 21 31 42 26 37 30 31 29 25 42 31 28 30 26 32 32 36 34 42 28 35 31 31 25 33 31 31 41 25 31 24 31 41 19 34 31 31 31 48 39 31 31 32 22 31 29 48 33 26 31 27 31 22 21 22 23 28 46 28 31 31 35 18 31 32 31 12 13 26 24 14 14 18 27 25 19 12 17 26 32 32 32 31 31 31 32 42 34 37 48 26 29 29 29 26 19 18 30 13 21 27 31 15 14 25 11 29 22 34 19 48 32 19 29 28 32 32 18 25 43 19 21 22 15 33 20 26 20 32 28 32 33 28 19 19 20 27 28 32 21 32 19 18 32 22 19 22 24 14 14 15 17 26 15 11 16 17 13 27 10 15 19 22 16 20 14 20 21 21 16 23 40 16 14 28 40 19 12 10 9 9 9 16 11 15 9 10 6 9 7 6 7 12 26 22 27 5 8 5 9 28 40 10 18 21 11 3 3 3 8 8 13 20 7 10 7 28 34 40 11 8 12 12 17 28 30 17 7 17 8 8 6 5 5 5 4 5	Open. Hide. 59 59 62 62 59 59 41 49 32 25 28 32 45 28 28 32 54 48 49 49 59 59 59 59 59 62 62 59 62 62 62 62 62 62 62 62 54 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 54 54 59 59 59 62 54 54 54 49 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 59 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 56 54 56 34 59 51 49 62 59 59 59 59 59 62 56 56 62 50 51 46 46 51 59 46 56 59 50 56 46 46 48 49 56 50 34 43 36 28 28 24 24 34 23 30 23 34 23 28 24 20 34 23 23 18 23 23 24 15 17 23 18 39 34 49 34 44 30 27 28 20 13 36 34 30 39 30 41 43 41 34 18 16 19 18 18 16 19 14 23 13 16 18 23 13 13 20 14 30 19 17 29 24 24 22 50 45 11 24 17 18 13 13 14 8 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_54083448_54084461
seq2: B6Ng01-184M07.b_127_1142 (reverse)

seq1  TCTCT---TTAAAATAAATTTTATGTACATTGGTGCTTTACCTGCATG-T  46
      |||||   ||||||||| ||||||||||||  |||||||| ||||||| |
seq2  TCTCTTTCTTAAAATAATTTTTATGTACAT--GTGCTTTAACTGCATGTT  48

seq1  ATGTATATATGTGGGTGGGTATCAGGTCACCTGGAACCAAGGTTACAGAT  96
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATATATGTGGGTGGGTATCAGGTCACCTGGAACCAAGGTTACAGAT  98

seq1  AGCTGTGAGCTGCCATGTGGGTGCTGGAAATCTACCACAGGTCCTCAGAA  146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGTGAGCTGCCATGTGGGTGCTGGAAATCTACCACAGGTCCTCAGAA  148

seq1  AGAGCTGCTAGTATCTTAACCACTGAGCCATTTATTCCTTCAAATTCATG  196
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCTGCTAGTATCTTAACCACTGAGCCATTTATTCCTTCAAATTCATG  198

seq1  GGATAATCATCTCTAATTCACAGTATGGTCACTGTTAAGTTTTCCATGCT  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATAATCATCTCTAATTCACAGTATGGTCACTGTTAAGTTTTCCATGCT  248

seq1  TCAGTGTATGTCCTCATAATGGAGATATGGGTAACATACTATGGACATAG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTGTATGTCCTCATAATGGAGATATGGGTAACATACTATGGACATAG  298

seq1  TGGGCTATAGAAAAAAGTGGCATGAAGTCTGGAGAGGAGCTTAGGGGGAA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTATAGAAAAAAGTGGCATGAAGTCTGGAGAGGAGCTTAGGGGGAA  348

seq1  TATGGACATACATGAAATGGCACTGAGGGGGATTAAAAAGTTGCTGTAGA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGACATACATGAAATGGCACTGAGGGGGATTAAAAAGTTGCTGTAGA  398

seq1  ATAAAAATACTTAAAAATTTGTTCAGCTTCTTATTTTATGTTTTCTGGCT  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAAATACTTAAAAATTTGTTCAGCTTCTTATTTTATGTTTTCTGGCT  448

seq1  TTATGCCATTTTGGCAAAAATCCAGGATAATGTTCCGATTTGAATATTGA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGCCATTTTGGCAAAAATCCAGGATAATGTTCCGATTTGAATATTGA  498

seq1  TTATGTTATTAAGAGGTCTGTGGTGGTTAGAGTGAGAATGTTTTTCATAT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTTATTAAGAGGTCTGTGGTGGTTAGAGTGAGAATGTTTTTCATAT  548

seq1  TCTCACATATTGACCACTTACTTCCCAGTTGGTAGCACAGATTTCAGGGA  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCACATATTGACCACTTACTTCCCAGTTGGTAGCACAGATTTCAGGGA  598

seq1  CATGCAAGAGAGGAGGCCTTGCTGAAGGAAGTTAGTCATTGGGGCTGGAC  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCAAGAGAGGAGGCCTTGCTGAAGGAAGTTAGTCATTGGGGCTGGAC  648

seq1  TTTGAGAGTCATAGCATCACCCCACTTCAAGTTCACTCTCTACATTTATG  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAGAGTCATAGCATCACCCCACTTCAAGTTCACTCTCTACATTTATG  698

seq1  CTTGTGGTTAAAGATGCGATTGCTGAACTTTGTGCTCTAGCTACCATGAC  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTGGTTAAAGATGCGATTGCTGAACTTTGTGCTCTAGCTACCATGAC  748

seq1  TACTGCTTGCTGTCATGTGTTCCTCCTACTAAGATGGACTGTTATCCTTC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGCTTGCTGTCATGTGTTCCTCCTACTAAGATGGACTGTTATCCTTC  798

seq1  TGGAACCTAAGCCAAAATACAATCTTCTATAAGTTTCTTTTTGGACTCAG  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAACCTAAGCCAAAATACAATCTTCTATAAGTTTCTTTTTGGACTCAG  848

seq1  TATTTTATCAAAGTAACAGAAAAGAAACTAATTTGGGGTCATTTGCTATG  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTATCAAAGTAACAGAAAAGAAACTAATTTGGGGTCATTTGCTATG  898

seq1  TGATTTAGTATGATAAATATTTCAATATTTGTTTCAGTATTAAAAGAAAT  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTTAGTATGATAAATATTTCAATATTTGTTTCAGTATTAAAAGAAAT  948

seq1  AACACATTGCCTTAGATTGATTTCCTGAGAAGCAAAATCTGAACTTGGGA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACATTGCCTTAGATTGATTTCCTGAGAAGCAAAATCTGAACTTGGGA  998

seq1  TTCTTTTGCCCATGAATA  1014
      ||||||||||||||||||
seq2  TTCTTTTGCCCATGAATA  1016

seq1: chr14_54040501_54040913
seq2: B6Ng01-184M07.g_65_482

seq1  GAATTCATGGATATAGCTTCTGAGTTTACAAGGAAACACATCCTCCAGAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGGATATAGCTTCTGAGTTTACAAGGAAACACATCCTCCAGAT  50

seq1  TAACTGGCTCACATGATCTTTCTACTCTTCCTTTGCACTGTTTCCTGAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTGGCTCACATGATCTTTCTACTCTTCCTTTGCACTGTTTCCTGAGC  100

seq1  CTTAGGTGTGGGAATTTTCGAAGATGCATGCACTGGGACTAGGCTCCACC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAGGTGTGGGAATTTTCGAAGATGCATGCACTGGGACTAGGCTCCACC  150

seq1  ATATATATATATATGTATATATATAGTTAGTTAGTTAGTTAGTTAGTTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATATATATATGTATATATATAGTTAGTTAGTTAGTTAGTTAGTTAG  200

seq1  TTAGTTAGAGGAAGTTAAAGGGGAATTACTGGATACGTGTGACTTGATAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTTAGAGGAAGTTAAAGGGGAATTACTGGATACGTGTGACTTGATAA  250

seq1  GGTAAATGGGAAAAAGAAATTCATTGTAGGGAAGGGGGATGGAGATTAAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAAATGGGAAAAAGAAATTCATTGTAGGGAAGGGGGATGGAGATTAAT  300

seq1  ACAGAAGAAGGGGATGATGATTAATGGAATGGAATTGAAAAATAAAAAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAAGAAGGGGATGATGATTAATGGAATGGAATTGAAAAATAAAAAAT  350

seq1  AAACCCTCACACTTTTGGACATCTGGTTTTCCCCCTATCTA-----TCTA  395
      |||||||||||||||||||||||||||||||||||||||||     | ||
seq2  AAACCCTCACACTTTTGGACATCTGGTTTTCCCCCTATCTATTTATTTTA  400

seq1  TCTATCTATCTATCTATC  413
      ||||||||||||||||||
seq2  TCTATCTATCTATCTATC  418

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information