MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-185E06
Chromosome	14 (Build37)	14 (Build37)
Map Location	6,642,320 - 6,642,855	6,030,375 - 6,031,293
singlet/doublet	singlet	singlet
Overlap gene	LOC100041456
Upstream gene	EG666706, LOC100041195, LOC100041545, LOC100041565, LOC100041215, LOC100041226, ENSMUSG00000057445, LOC100041598, LOC100041243, EG666684, LOC100041268, LOC100041279, LOC100041651, LOC100041287, LOC100041299, LOC666637, EG622640, LOC100041333, LOC100041678, LOC100041702, LOC100041363, LOC100041721, LOC100041784, LOC100041735, LOC100041406, LOC100041825, LOC100041421, LOC100041817, LOC100041431, LOC100041438, LOC100041442, LOC100041848
Downstream gene	LOC100041758, LOC100041470, LOC100041804, LOC100041487, LOC100041747, LOC100041507, LOC100041836, LOC100041728, LOC100041774, LOC100041530, LOC100041540, LOC100041840, EG666844, LOC666851, LOC100041569, LOC100041970, LOC100042000, EG666874, B930046C15Rik, LOC100041600, LOC100041958, LOC100041964, LOC546590, LOC666906, LOC100042024, LOC100041664, LOC100042077, LOC100041675, LOC666329, EG666833, LOC100042043, EG666918
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG666706 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041226 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	ENSMUSG00000057445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622931 MGI:3704419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein

name	LOC100041598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 31 ESTs, 8 Proteins

name	LOC100041243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666684 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666684 MGI:3644039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 1 Protein pseudo : _no_value

name	LOC100041268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	LOC100041279 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein pseudo : _no_value

name	LOC100041651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 22 ESTs, 8 Proteins

name	LOC100041287 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein pseudo : _no_value

name	EG622640 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 21 ESTs, 10 Proteins

name	LOC100041363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041363
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041784 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 26 ESTs, 9 Proteins

name	LOC100041735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein pseudo : _no_value

name	LOC100041406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100041817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041431 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041431
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041438 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100041442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041848 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 7 Proteins pseudo : _no_value

name	LOC100041456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein pseudo : _no_value

name	LOC100041804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 30 ESTs, 8 Proteins

name	LOC100041487 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins

name	LOC100041747 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 90 ESTs, 1 Protein pseudo : _no_value

name	LOC100041507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041836 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins

name	LOC100041728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein pseudo : _no_value

name	LOC100041774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 23 ESTs, 9 Proteins

name	LOC100041530 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 105 ESTs, 1 Protein pseudo : _no_value

name	LOC100041540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100041840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins

name	EG666844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666844 MGI:3646015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC666851 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins pseudo : _no_value

name	LOC100041569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs

name	LOC100041970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 24 ESTs, 8 Proteins

name	LOC100042000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs

name	EG666874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666874 MGI:3647183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	B930046C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544998 MGI:2441866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins

name	LOC100041600 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041958 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 1 Protein pseudo : _no_value

name	LOC100041964 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 7 Proteins

name	LOC546590 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC666906 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 16 Proteins

name	LOC100042024 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein pseudo : _no_value

name	LOC100041664 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins

name	LOC100042077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC100041675 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	LOC666329 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins

name	EG666833 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666833 MGI:3647063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042043 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein pseudo : _no_value

name	EG666918 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 22 ESTs, 9 Proteins

name	EG666706 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149264991 GeneID:666706 MGI:3644639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : predicted gene, EG666706, transcript variant 1 transcript_id : XM_985542.2

name	LOC100041215 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264927 GeneID:100041215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001475986.1

name	LOC100041226 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264929 GeneID:100041226
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476002.1

name	LOC100041598 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265001 GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 29 ESTs, 7 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477003.1

name	LOC100041598 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264999 GeneID:100041598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477020.1

name	LOC100041243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264932 GeneID:100041243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476033.1

name	LOC100041651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265005 GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477044.1

name	LOC100041651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265007 GeneID:100041651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 20 ESTs, 7 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477032.1

name	LOC100041287 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264949 GeneID:100041287
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476104.1

name	EG622640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265015 GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 8 Proteins product : predicted gene, EG622640, transcript variant 2 transcript_id : XM_889197.3

name	EG622640 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265013 GeneID:622640 MGI:3646283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG622640, transcript variant 1 transcript_id : XM_001477087.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265022 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 19 ESTs, 9 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477101.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265018 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477115.1

name	LOC100041702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265020 GeneID:100041702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : similar to Predicted gene, EG545013, transcript variant 3 transcript_id : XM_001477131.1

name	LOC100041784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265037 GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 24 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477242.1

name	LOC100041784 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265039 GeneID:100041784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477252.1

name	LOC100041825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265048 GeneID:100041825
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477338.1

name	LOC100041438 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264978 GeneID:100041438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : hypothetical protein LOC100041438 transcript_id : XM_001476390.1

name	LOC100041442 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264980 GeneID:100041442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001476403.1

name	LOC100041456 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264983 GeneID:100041456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to diacylglycerol kinase, eta transcript_id : XM_001476419.1

name	LOC100041804 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265045 GeneID:100041804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 28 ESTs, 7 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477275.1

name	LOC100041804 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265043 GeneID:100041804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477298.1

name	LOC100041487 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264986 GeneID:100041487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 ESTs, 7 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001476447.1

name	LOC100041836 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265050 GeneID:100041836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477361.1

name	LOC100041774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265033 GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 21 ESTs, 8 Proteins product : similar to Predicted gene, EG432825, transcript variant 1 transcript_id : XM_001477197.1

name	LOC100041774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265035 GeneID:100041774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 1 Protein product : similar to Predicted gene, EG432825, transcript variant 2 transcript_id : XM_001477217.1

name	LOC100041840 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265052 GeneID:100041840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 9 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001477400.1

name	LOC100041569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149264996 GeneID:100041569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : hypothetical protein LOC100041569 transcript_id : XM_001476596.1

name	LOC100041970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265070 GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 22 ESTs, 7 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477506.1

name	LOC100041970 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265068 GeneID:100041970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477521.1

name	LOC100042000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265079 GeneID:100042000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001477589.1

name	B930046C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265074 GeneID:544998 MGI:2441866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : RIKEN cDNA B930046C15 gene transcript_id : XM_001477541.1

name	LOC100041964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265066 GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 6 Proteins product : similar to Predicted gene, EG545013, transcript variant 1 transcript_id : XM_001477474.1

name	LOC100041964 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265064 GeneID:100041964
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : similar to Predicted gene, EG545013, transcript variant 2 transcript_id : XM_001477494.1

name	LOC546590 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265003 GeneID:546590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) transcript_id : XM_001476729.1

name	LOC666906 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265077 GeneID:666906
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : similar to Predicted gene, EG432825 transcript_id : XM_986936.2

name	LOC100041664 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265009 GeneID:100041664
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 9 Proteins product : similar to Predicted gene, EG545013 transcript_id : XM_001476781.1

name	LOC100042077 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265095 GeneID:100042077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : similar to diacylglycerol kinase, eta transcript_id : XM_001477712.1

name	LOC666329 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265094 GeneID:666329
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 13 Proteins product : similar to 1700001E04Rik protein, transcript variant 5 transcript_id : XM_988676.2

name	EG666918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265087 GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 21 ESTs, 8 Proteins product : predicted gene, EG666918, transcript variant 3 transcript_id : XM_987009.2

name	EG666918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265083 GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 12 ESTs, 2 Proteins product : predicted gene, EG666918, transcript variant 1 transcript_id : XM_001477634.1

name	EG666918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265085 GeneID:666918 MGI:3648195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 2 Proteins product : predicted gene, EG666918, transcript variant 2 transcript_id : XM_001477643.1

name	EG666706 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149264992 GeneID:666706 MGI:3644639
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_990636.2

name	LOC100041215 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264928 GeneID:100041215
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476036.1

name	LOC100041226 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264930 GeneID:100041226
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476052.1

name	LOC100041598 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265000 GeneID:100041598
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477070.1

name	LOC100041598 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265002 GeneID:100041598
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477053.1

name	LOC100041243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264933 GeneID:100041243
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476083.1

name	LOC100041651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265006 GeneID:100041651
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477094.1

name	LOC100041651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265008 GeneID:100041651
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477082.1

name	LOC100041287 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264950 GeneID:100041287
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476154.1

name	EG622640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265014 GeneID:622640 MGI:3646283
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477137.1

name	EG622640 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82952965 GeneID:622640 MGI:3646283
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_894290.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265019 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477165.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265021 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_001477181.1

name	LOC100041702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265023 GeneID:100041702
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477151.1

name	LOC100041784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265040 GeneID:100041784
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477302.1

name	LOC100041784 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265038 GeneID:100041784
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477292.1

name	LOC100041825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265049 GeneID:100041825
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477388.1

name	LOC100041438 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264979 GeneID:100041438
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476440.1

name	LOC100041442 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264981 GeneID:100041442
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476453.1

name	LOC100041456 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264984 GeneID:100041456
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001476469.1

name	LOC100041804 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265044 GeneID:100041804
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477348.1

name	LOC100041804 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265046 GeneID:100041804
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477325.1

name	LOC100041487 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264987 GeneID:100041487
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001476497.1

name	LOC100041836 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265051 GeneID:100041836
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477411.1

name	LOC100041774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265036 GeneID:100041774
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 2 protein_id : XP_001477267.1

name	LOC100041774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265034 GeneID:100041774
definition	codon_start : 1 product : similar to Predicted gene, EG432825 isoform 1 protein_id : XP_001477247.1

name	LOC100041840 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265053 GeneID:100041840
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001477450.1

name	LOC100041569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149264997 GeneID:100041569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476646.1

name	LOC100041970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265069 GeneID:100041970
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477571.1

name	LOC100041970 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265071 GeneID:100041970
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477556.1

name	LOC100042000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265080 GeneID:100042000
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477639.1

name	B930046C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265075 GeneID:544998 MGI:2441866
definition	codon_start : 1 product : hypothetical protein LOC544998 protein_id : XP_001477591.1

name	LOC100041964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265065 GeneID:100041964
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477544.1

name	LOC100041964 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265067 GeneID:100041964
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477524.1

name	LOC546590 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265004 GeneID:546590
definition	codon_start : 1 product : similar to High mobility group protein B2 (High mobility group protein 2) (HMG-2) protein_id : XP_001476779.1

name	LOC666906 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265078 GeneID:666906
definition	codon_start : 1 product : similar to Predicted gene, EG432825 protein_id : XP_992030.2

name	LOC100041664 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265010 GeneID:100041664
definition	codon_start : 1 product : similar to Predicted gene, EG545013 protein_id : XP_001476831.1

name	LOC100042077 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265096 GeneID:100042077
definition	codon_start : 1 product : similar to diacylglycerol kinase, eta protein_id : XP_001477762.1

name	LOC666329 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94396484 GeneID:666329
definition	codon_start : 1 product : similar to 1700001E04Rik protein isoform 5 protein_id : XP_993770.1

name	EG666918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265084 GeneID:666918 MGI:3648195
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 1 protein_id : XP_001477684.1

name	EG666918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265086 GeneID:666918 MGI:3648195
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 2 protein_id : XP_001477693.1

name	EG666918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396578 GeneID:666918 MGI:3648195
definition	codon_start : 1 product : similar to Predicted gene, EG545013 isoform 3 protein_id : XP_992103.1

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 1 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 2 pseudo : _no_value

name	LOC100041299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041299
definition	number : 3 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 1 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 2 pseudo : _no_value

name	LOC100041333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041333
definition	number : 3 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 5 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 4 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 3 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 2 pseudo : _no_value

name	LOC100041363 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041363
definition	number : 1 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 4 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 3 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 2 pseudo : _no_value

name	LOC100041406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041406
definition	number : 1 pseudo : _no_value

name	LOC100041421 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041421
definition	number : 2 pseudo : _no_value

name	LOC100041421 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041421
definition	number : 1 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 1 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 2 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 3 pseudo : _no_value

name	LOC100041431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041431
definition	number : 4 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 4 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 3 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 2 pseudo : _no_value

name	LOC100041507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041507
definition	number : 1 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 4 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 3 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 2 pseudo : _no_value

name	LOC100041540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041540
definition	number : 1 pseudo : _no_value

name	EG666844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666844
definition	number : 1 pseudo : _no_value

name	LOC666851 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666851
definition	number : 1 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 1 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 2 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 3 pseudo : _no_value

name	LOC100041600 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041600
definition	number : 4 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 1 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 2 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 3 pseudo : _no_value

name	EG666833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666833
definition	number : 4 pseudo : _no_value

name	LOC100041195 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264926 GeneID:100041195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032499.1

name	LOC100041545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264994 GeneID:100041545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041545 pseudo : _no_value transcript_id : XR_033000.1

name	LOC100041565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264995 GeneID:100041565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 8 Proteins product : hypothetical protein LOC100041565 pseudo : _no_value transcript_id : XR_033011.1

name	ENSMUSG00000057445 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264931 GeneID:622931 MGI:3704419
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : predicted gene, ENSMUSG00000057445 transcript_id : XR_032520.1

name	EG666684 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264940 GeneID:666684 MGI:3644039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 1 Protein product : predicted gene, EG666684 pseudo : _no_value transcript_id : XR_032534.1

name	LOC100041268 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264942 GeneID:100041268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032545.1

name	LOC100041279 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264947 GeneID:100041279
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein product : hypothetical protein LOC100041279 pseudo : _no_value transcript_id : XR_032551.1

name	LOC666637 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264952 GeneID:666637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 1 Protein product : hypothetical LOC666637 pseudo : _no_value transcript_id : XR_032568.1

name	LOC100041678 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265012 GeneID:100041678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_033046.1

name	LOC100041721 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265024 GeneID:100041721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 97 ESTs, 2 Proteins product : hypothetical protein LOC100041721 pseudo : _no_value transcript_id : XR_033072.1

name	LOC100041735 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265026 GeneID:100041735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 89 ESTs, 1 Protein product : hypothetical protein LOC100041735 pseudo : _no_value transcript_id : XR_033088.1

name	LOC100041817 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265047 GeneID:100041817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 ESTs, 6 Proteins product : similar to Predicted gene, EG432825 pseudo : _no_value transcript_id : XR_033173.1

name	LOC100041848 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265054 GeneID:100041848
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 7 Proteins product : hypothetical protein LOC100041848 pseudo : _no_value transcript_id : XR_033227.1

name	LOC100041758 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265030 GeneID:100041758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 2 Proteins product : hypothetical protein LOC100041758 pseudo : _no_value transcript_id : XR_033105.1

name	LOC100041470 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264985 GeneID:100041470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 93 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032739.1

name	LOC100041747 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265029 GeneID:100041747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 90 ESTs, 1 Protein product : hypothetical protein LOC100041747 pseudo : _no_value transcript_id : XR_033096.1

name	LOC100041728 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265025 GeneID:100041728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 103 ESTs, 1 Protein product : hypothetical protein LOC100041728 pseudo : _no_value transcript_id : XR_033083.1

name	LOC100041530 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149264993 GeneID:100041530
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 105 ESTs, 1 Protein product : similar to 1700001E04Rik protein pseudo : _no_value transcript_id : XR_032805.1

name	EG666874 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149264998 GeneID:666874 MGI:3647183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : predicted gene, EG666874 pseudo : _no_value transcript_id : XR_001934.2

name	LOC100041958 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265063 GeneID:100041958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 94 ESTs, 1 Protein product : hypothetical protein LOC100041958 pseudo : _no_value transcript_id : XR_033237.1

name	LOC100042024 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265081 GeneID:100042024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 95 ESTs, 1 Protein product : hypothetical protein LOC100042024 pseudo : _no_value transcript_id : XR_033294.1

name	LOC100041675 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265011 GeneID:100041675
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to ribosomal protein L3 pseudo : _no_value transcript_id : XR_032924.1

name	LOC100042043 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265082 GeneID:100042043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein product : hypothetical protein LOC100042043 pseudo : _no_value transcript_id : XR_033305.1

clone name	MSMg01-500I03
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-239A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209P06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-185E06.b	B6Ng01-185E06.g
ACC	GA010425	GA010426
length	1,076	920
definition	B6Ng01-185E06.b	B6Ng01-185E06.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(6,642,320 - 6,642,855)	(6,030,375 - 6,031,293)
sequence	gaattcttttgtgattgggttacctcactcaggatgatgccctccaggtc catccatttggctaggaatttcataaattcattctttttaatagctgagt agtactccattgtgtaaatgtaccacattttctgtatccattcctctgtt gaggggcatctgggttatttccagcttctggctataataaataaggctgc tatgaacatagtggagcatgtgtccttcttaccagttggaacatcttctg gatatatgcccaggagtggtattctgggatcctccagtagtcctatgtcc aattttctgaggaactgccagactgatttccagagtggttgtacaagctt gcaatcccaccaacaacggagaaatgttcctttttctccacatccttgcc agcatctgctgtcaccagaatttttgatcttagccattctgactggtgtg aagtagaatctcagggttgttttgatttgcatttccctgatgattaagaa tgctgaacatttttcaagtgcttctctgccatttggtattcctcaggtga caattctttgtttagctctgagccccactttttaatggtgttattggatt ttctgaagtccaccttcttgtgttctttatacatattggttattagtccc ctatccgatttgggatcggtaaagatcctttccaaacctattggtggcct ttttgtcttattgacggtgtcttttgctttacagaagctttgcagtttca tgaggtaccatttgtccattctcaatcttacagcacagccattcctgttc tattcaggaactttccccctgtgcccatatctttctatgcttttccccac tttctcctctataagttttcatgggtctctgggttttatgtggaatttcc ttgatccactttagatttgacctttagtacaaaggagatagggaatggga tccattttcccatttcttcctaccatgttaacccgcccagtagttgccag caccatggtttgattttgcacttccttgtgtgcactttccttggtgcttt aggaataacaaaacccttaatcataa	gaattctccagctttggaaggagaggttgccaaaggggatcccacggatc catgagaggctccaggagaggcaccccagaaaaggatcaagctggggaga actagttaacaggtaggtcatggcagttgctagtgacatcatcagtaatg ccttccttggagaatctcttgtatctcggagagaactagaatcttctgcg ttgtcacctgtgttgtggtgacagcaactgcctgtggttcatcccttctg tttgctctgggttcaccagcaggaatgttttcctggctgctcaggctatg tcagaaagagaatggcgatgaaggagagaccagaccaacagagaaggaag agggaatcctttctcatgaaaaaggaagaaggaaatggttatggagaatg cacagtgagtcctgggcagagttggggaacttcctggtagaggtaggctt gagctgggccgtccaggagtaggtcttacaagctgaagccttggactttg tcaatgtcagacaaagattcaagaattttctgatgattagtttgacagag ccaggaattgacaaacctgcagctacttttctgggagctatttaatttca ttttgagtggcaaagaatgccaggagtgggcactattggaatatcagtgt gttattccttttcatggaagggagttgaagcacttcaccttccagattac tgtaggtactttgagtctctgatgaaaacaacagagaaggatgctcccct ggtcatgtcatgtggtgaggactcagacactttggattaattagtgcttg atagtgctaagcactatgaacttcaggatttccctgcaacacatctgata tgaacctgacaatgtccccatacctttatgtctgatgtaaattatagatt tcagggcaagggtcctgtaa
quality values	Open. Hide. 49 22 35 24 58 54 45 49 58 58 36 31 38 45 27 62 62 62 49 54 54 56 47 62 62 47 56 54 62 47 42 56 56 31 14 19 21 13 19 18 27 22 27 27 21 20 27 34 62 62 59 46 62 62 59 59 62 62 62 62 59 62 59 62 62 54 62 62 59 62 62 59 59 62 62 62 62 62 62 49 39 50 48 48 46 56 56 50 40 48 48 40 46 50 56 56 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 54 54 54 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 49 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 38 62 62 62 62 62 54 62 42 62 62 62 62 52 52 42 62 52 54 58 52 51 58 58 58 58 58 58 58 58 54 58 42 52 52 58 58 58 58 58 58 52 58 58 58 58 54 58 58 58 58 58 41 43 54 58 58 45 38 58 54 58 52 42 52 58 54 42 39 58 58 58 58 58 54 58 54 50 52 54 48 52 42 58 58 58 52 54 54 58 46 58 49 54 53 51 54 49 51 50 52 51 41 43 58 42 51 58 42 39 39 51 50 50 58 47 50 50 58 49 58 58 51 53 50 58 49 58 24 58 37 39 49 49 50 50 50 37 32 31 53 58 58 50 50 50 41 46 41 58 58 52 52 35 50 43 40 42 44 41 41 36 58 48 50 58 28 27 51 35 51 58 58 51 53 31 53 39 41 52 50 58 46 43 35 35 44 30 54 40 50 50 58 58 43 46 37 58 58 51 26 39 37 32 54 58 34 53 53 54 40 38 39 34 32 53 51 52 39 31 49 40 53 27 53 24 35 40 27 20 44 52 49 52 37 39 39 25 42 52 38 35 37 35 49 49 29 25 14 16 19 21 32 32 37 22 33 10 33 51 33 30 54 27 47 40 42 19 29 32 38 31 39 54 40 14 12 25 38 49 24 20 54 42 42 47 31 31 29 15 33 28 37 34 40 31 23 32 34 34 32 18 29 11 19 17 32 33 32 31 32 52 52 32 27 40 40 20 26 32 52 52 45 40 32 41 51 31 31 30 39 36 33 33 11 9 46 45 16 24 15 6 21 41 27 8 30 31 32 8 18 37 29 31 51 51 31 26 14 51 23 31 23 35 46 14 51 10 33 30 8 31 32 31 29 23 33 16 31 21 46 13 12 13 26 22 46 31 24 11 12 42 9 42 30 24 9 6 9 17 17 18 8 33 10 17 17 16 16 33 9 37 13 41 8 20 25 38 14 22 33 22 20 15 5 6 14 7 12 14 17 21 24 43 29 32 22 24 8 11 11 11 11 13 10 26 32 31 15 11 18 9 35 12 35 11 37 23 24 9 8 21 11 9 8 15 15 31 25 18 24 10 31 31 16 10 20 22 11 33 6 9 10 6 9 44 10 7 9 11 17 29 9 11 27 9 25 11 9 10 11 25 22 10 19 10 30 10 24 34 23 13 10 16 19 12 22 15 39 10 8 4 5 7 10 5 10 12 11 16 32 31 6 17 27 9 10 23 8 12 16 21 9 24 10 6	Open. Hide. 62 38 28 39 62 56 56 56 47 41 42 56 27 14 13 13 9 13 14 10 21 21 20 27 27 44 50 44 62 59 59 51 62 59 56 62 59 59 59 59 50 56 51 41 44 43 62 46 62 62 59 59 62 59 59 59 62 59 62 59 62 51 56 29 28 28 28 38 54 46 46 36 34 59 59 62 62 59 43 59 59 59 59 59 62 59 59 59 51 51 56 56 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 59 62 62 54 62 62 59 62 62 62 59 59 59 62 59 62 62 59 59 56 62 62 59 62 59 62 62 59 59 59 59 43 49 51 56 56 59 59 62 56 59 59 59 56 56 62 62 59 59 62 62 62 62 54 62 62 59 62 59 59 62 62 62 59 59 59 59 29 54 49 59 59 59 59 49 43 56 56 59 62 62 59 59 59 62 59 56 62 62 62 59 62 59 62 62 62 62 59 62 62 59 62 49 62 59 51 62 59 59 59 56 59 56 59 62 59 62 59 59 59 62 59 59 59 59 59 62 56 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 49 50 51 43 62 56 50 44 54 48 46 51 62 59 59 59 62 59 59 59 62 59 62 62 51 43 62 56 56 56 62 62 62 62 62 43 62 51 59 51 62 59 62 62 59 62 59 38 36 48 56 51 59 56 43 59 59 50 54 50 59 59 59 46 39 59 50 56 43 51 59 41 41 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 43 43 36 29 27 41 62 62 51 51 49 56 49 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 49 33 45 59 59 50 62 51 41 51 45 43 39 59 59 51 51 62 59 62 62 45 59 51 51 45 59 59 56 59 59 56 46 46 43 56 51 62 62 62 39 39 56 38 30 35 56 62 62 47 44 51 51 56 56 62 62 62 62 51 56 45 62 62 56 51 62 42 42 51 51 51 38 50 47 39 56 56 51 54 47 56 54 56 47 56 37 32 38 40 32 43 56 40 38 43 56 43 43 56 38 43 50 47 54 46 50 27 38 33 33 56 62 54 62 62 54 62 52 62 62 48 54 62 42 47 49 42 47 54 62 42 33 38 35 42 47 50 62 54 39 62 47 43 62 62 52 54 54 41 48 52 47 18 50 45 39 41 31 42 39 32 52 39 52 58 54 54 54 33 35 46 42 41 47 47 47 34 26 40 31 37 58 54 58 41 52 43 45 41 43 40 45 27 42 39 46 47 58 34 10 54 52 58 54 52 35 52 45 47 33 34 34 42 42 54 34 32 38 41 50 37 51 18 18 58 42 48 33 39 53 52 40 50 47 37 46 34 37 34 42 54 51 50 48 20 48 40 50 20 22 30 21 16 32 39 53 53 36 25 17 20 50 30 36 34 50 50 39 50 27 37 51 37 21 43 10 58 32 52 33 39 51 46 34 26 14 35 29 34 40 32 27 30 37 28 17 28 31 26 29 17 40 35 39 15 41 42 51 34 24 31 40 32 35 29 14 37 32 37 37 24 15 28 31 50 50 31 39 15 28 27 44 40 40 41 40 33 28 37 21 37 9 18 14 12 13 40 18 40 34 28 27 51 49 40 29 25 25 18 39 32 32 39 18 18 19 40 52 39 29 51 53 45 51 31 33 20 17 35 43 28 12 25 14 12 33 40 53 32 28 9 34 16 42 37 53 31 33 45 27 32 32 18 32 32 32 19 26 28 17 31 41 23 33 34 37 10 35 29 31 34 21 23 53 32 25 40 33 31 28 9 4 9 14 11 6 9 19 40 29 31 19 15 22 18 42 31 18 12 19 16 18 28 27 10 16 34 31 28 15 31 42 26 25 31 45 14 28 29 37 13 6 11 15 12 8 9 12 7 9 19 29 21 18 22 33 35 36 36 27 15 6 9 18 9 9 9 27 29 9 25 12 11 31 22 46 31 27 12 8 38 10 25 21 29 11 26 33 19 16 24 21 31 18 35 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_6642320_6642855
seq2: B6Ng01-185E06.b_557_1116

seq1  AAGTGCTTCTCTGCCATTTGGTATTCCTCAGGTGACAATTCTTTGTTTAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGCTTCTCTGCCATTTGGTATTCCTCAGGTGACAATTCTTTGTTTAG  50

seq1  CTCTGAGCCCCACTTTTTAATGGTGTTATTGGATTTTCTGAAGTCCACCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGAGCCCCACTTTTTAATGGTGTTATTGGATTTTCTGAAGTCCACCT  100

seq1  TCTTGTGTTCTTTATACATATTGGTTATTAGTCCCCTATCCGATTTGGGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTGTGTTCTTTATACATATTGGTTATTAGTCCCCTATCCGATTTGGGA  150

seq1  TCGGTAAAGATCCTTTCCAAACCTATTGGTGGCCTTTTTGTCTTATTGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGGTAAAGATCCTTTCCAAACCTATTGGTGGCCTTTTTGTCTTATTGAC  200

seq1  GGTGTCTTTTGCTTTACAGAAGCTTTGCAGTTTCATGAGGTACCATTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTCTTTTGCTTTACAGAAGCTTTGCAGTTTCATGAGGTACCATTTGT  250

seq1  CCATTCTCAATCTTACAGCACAAGCCATTCCTGTTCTATTCAGGAACTTT  300
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CCATTCTCAATCTTACAGCAC-AGCCATTCCTGTTCTATTCAGGAACTTT  299

seq1  CCCCCTGTGCCCATATC-TTCTATGCTTTTCCCCACTTTCTCCTCTATAA  349
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  CCCCCTGTGCCCATATCTTTCTATGCTTTTCCCCACTTTCTCCTCTATAA  349

seq1  G-TTTCAT-GGTCTCT-GGTTTTATGTGGAA-TTCCTTGATCCAC-TTAG  394
      | |||||| ||||||| |||||||||||||| ||||||||||||| ||||
seq2  GTTTTCATGGGTCTCTGGGTTTTATGTGGAATTTCCTTGATCCACTTTAG  399

seq1  ATTTGACC-TTAGTAC-AAGGAGATA-GGAAT-GGATCAA--TTCCCA-T  437
      |||||||| ||||||| ||||||||| ||||| ||||| |  |||||| |
seq2  ATTTGACCTTTAGTACAAAGGAGATAGGGAATGGGATCCATTTTCCCATT  449

seq1  TCTT-CTA-CATGTTAACC--GCCAGTAG-TGCCAGCACCATGG-TTGA-  480
      |||| ||| ||||||||||   ||||||| |||||||||||||| |||| 
seq2  TCTTCCTACCATGTTAACCCGCCCAGTAGTTGCCAGCACCATGGTTTGAT  499

seq1  TTTGCACTTCCTTG-GTGCAC-TTCCTTGGTGC-TTAGGGATAAC-AAAC  526
      |||||||||||||| |||||| ||||||||||| ||||| ||||| ||||
seq2  TTTGCACTTCCTTGTGTGCACTTTCCTTGGTGCTTTAGGAATAACAAAAC  549

seq1  CCTT-ATCATA  536
      |||| ||||||
seq2  CCTTAATCATA  560

seq1: chr14_6030375_6031293
seq2: B6Ng01-185E06.g_67_986 (reverse)

seq1  TTACAGGACCCTTTGCCCTGAAATCTATAATTTGCCTCAGACATAAAGAT  50
      ||||||||||| ||||||||||||||||||||| | |||||||||||| |
seq2  TTACAGGACCC-TTGCCCTGAAATCTATAATTTACATCAGACATAAAGGT  49

seq1  ATGGGGAACATTGTCAGG-TCATATCAGATGTGTTGCAGGGAAATCCTGA  99
      |||||| ||||||||||| |||||||||||||||||||||||||||||||
seq2  ATGGGG-ACATTGTCAGGTTCATATCAGATGTGTTGCAGGGAAATCCTGA  98

seq1  AGTTCATAGTGCTTAGCACTATCAAGCACTAATTAATCCAAAGTGTCTGA  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCATAGTGCTTAGCACTATCAAGCACTAATTAATCCAAAGTGTCTGA  148

seq1  GTCCTCACCACATGACATGACCAGGGGAGCATCCTTCTCTGTTGTTTTCA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCACCACATGACATGACCAGGGGAGCATCCTTCTCTGTTGTTTTCA  198

seq1  TCAGAGACTCAAGTTACCTACAGTAATCTGGAAGGTGAAGTGCTTCAACT  249
      ||||||||||||  ||||||||||||||||||||||||||||||||||||
seq2  TCAGAGACTCAAAGTACCTACAGTAATCTGGAAGGTGAAGTGCTTCAACT  248

seq1  CCCTTCCATG-AAAGGAATAACACACTGATATTCCAATAGTGCCCACTCC  298
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CCCTTCCATGAAAAGGAATAACACACTGATATTCCAATAGTGCCCACTCC  298

seq1  TGGCATTCTTTGCCACTCAAAATGAAATTAAATAGCTCCCAGAAAAGTAG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCATTCTTTGCCACTCAAAATGAAATTAAATAGCTCCCAGAAAAGTAG  348

seq1  CTGCAGGTTTGTCAATTCCTGGCTCTGTCAAACTAATCATCAG-AAATTC  397
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CTGCAGGTTTGTCAATTCCTGGCTCTGTCAAACTAATCATCAGAAAATTC  398

seq1  TTGAATCTTTGTCTGACATTGACAAAGTCCAAGGCTTCAGCTTGTAAGAC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAATCTTTGTCTGACATTGACAAAGTCCAAGGCTTCAGCTTGTAAGAC  448

seq1  CTACTCCTGGACGGCCCAGCTCAAGCCTACCTCTACCAGGAAGTTCCCCA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTCCTGGACGGCCCAGCTCAAGCCTACCTCTACCAGGAAGTTCCCCA  498

seq1  ACTCTGCCCAGGACTCACTGTGCATTCTCCATAACCATTTCCTTCTTCCT  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTGCCCAGGACTCACTGTGCATTCTCCATAACCATTTCCTTCTTCCT  548

seq1  TTTTCATGAGAAAGGATTCCCTCTTCCTTCTCTGTTGGTCTGGTCTCTCC  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCATGAGAAAGGATTCCCTCTTCCTTCTCTGTTGGTCTGGTCTCTCC  598

seq1  TTCATCGCCATTCTCTTTCTGACATAGCCTGAGCAGCCAGGAAAACATTC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATCGCCATTCTCTTTCTGACATAGCCTGAGCAGCCAGGAAAACATTC  648

seq1  CTGCTGGTGAACCCAGAGCAAACAGAAGGGATGAACCACAGGCAGTTGCT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGGTGAACCCAGAGCAAACAGAAGGGATGAACCACAGGCAGTTGCT  698

seq1  GTCACCACAACACAGGTGACAACGCAGAAGATTCTAGTTCTCTCCGAGAT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACCACAACACAGGTGACAACGCAGAAGATTCTAGTTCTCTCCGAGAT  748

seq1  ACAAGAGATTCTCCAAGGAAGGCATTACTGATGATGTCACTAGCAACTGC  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGAGATTCTCCAAGGAAGGCATTACTGATGATGTCACTAGCAACTGC  798

seq1  CATGACCTACCTGTTAACTAGTTCTCCCCAGCTTGATCCTTTTCTGGGGT  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGACCTACCTGTTAACTAGTTCTCCCCAGCTTGATCCTTTTCTGGGGT  848

seq1  GCCTCTCCTGGAGCCTCTCATGGATCCGTGGGATCCCCTTTGGCAACCTC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCTCCTGGAGCCTCTCATGGATCCGTGGGATCCCCTTTGGCAACCTC  898

seq1  TCCTTCCAAAGCTGGAGAATTC  919
      ||||||||||||||||||||||
seq2  TCCTTCCAAAGCTGGAGAATTC  920

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information