MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-202F10
Chromosome	14 (Build37)
Map Location	20,527,848 - 20,661,035
singlet/doublet	doublet
Overlap gene	Nid2, 2700060E02Rik, LOC100039534
Upstream gene	Ube2e2, LOC627741, LOC100042299, LOC675069, LOC100042322, LOC632470, EG632477, EG632498, EG667341, LOC667344, LOC619996, EG434616, LOC675165, 1700110I01Rik, EG664814, LOC100039452, LOC100038983, LOC100039441, EG432825, LOC673583, EG664855
Downstream gene	Gng2, 1810063B07Rik, Kcnk5, LOC100039106, Kcnk16, Nudt13, Ecd, AA536717, Dnajc9, Mrps16, Ttc18, Anxa7, Zmynd17, Ppp3cb, Usp54, Myoz1, Synpo2l, Sec24c, Fut11, Chchd1, 2310021P13Rik, Ndst2, Camk2g, Plau
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ube2e2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218793 MGI:2384997
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627741 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC100042299 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC675069 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100042322 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC632470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG632477 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632477 MGI:3648627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG632498 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632498 MGI:3647982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG667341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667341 MGI:3643667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	LOC619996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins pseudo : _no_value

name	EG434616 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434616 MGI:3647174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein

name	LOC675165 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins pseudo : _no_value

name	1700110I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73549 MGI:1920799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG664814 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664814 MGI:3643017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	LOC100039452 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 16 Proteins

name	LOC100038983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100039441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein pseudo : _no_value

name	EG432825 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432825 MGI:3646663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC673583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG664855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664855 MGI:3643484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Nid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18074 MGI:1298229
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700060E02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68045 MGI:1915295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Gng2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14702 MGI:102705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	1810063B07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67509 MGI:1914759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 2 Proteins

name	Kcnk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16529 MGI:1336175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Kcnk16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74571 MGI:1921821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	Nudt13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67725 MGI:1914975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ecd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70601 MGI:1917851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA536717 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:105428 MGI:2145567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dnajc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108671 MGI:1915326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66242 MGI:1913492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76670 MGI:1923920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein

name	Anxa7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11750 MGI:88031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74843 MGI:1922093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 1 Protein

name	Ppp3cb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19056 MGI:107163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp54 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78787 MGI:1926037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myoz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59011 MGI:1929471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Synpo2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68760 MGI:1916010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec24c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:218811 MGI:1919746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fut11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73068 MGI:1920318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chchd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66121 MGI:1913371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310021P13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268721 MGI:1919156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ndst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17423 MGI:97040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camk2g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12325 MGI:88259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Plau (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18792 MGI:97611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2e2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450232 GeneID:218793 MGI:2384997
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) transcript_id : NM_144839.1

name	LOC100042322 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265141 GeneID:100042322
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to phosphatidylserine decarboxylase transcript_id : XM_001477939.1

name	EG632477 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396600 GeneID:632477 MGI:3648627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG632477 transcript_id : XM_989855.1

name	EG434616 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265171 GeneID:434616 MGI:3647174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 1 Protein product : predicted gene, EG434616 transcript_id : XM_486466.4

name	1700110I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265245 GeneID:73549 MGI:1920799
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700110I01 gene transcript_id : XM_001471969.1

name	LOC100039452 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265253 GeneID:100039452
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 16 Proteins product : similar to 1700001E04Rik protein transcript_id : XM_001472852.1

name	EG432825 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67010058 GeneID:432825 MGI:3646663
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432825 transcript_id : NM_001024706.1

name	EG664855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265248 GeneID:664855 MGI:3643484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG664855 transcript_id : XM_973078.2

name	Nid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370360 GeneID:18074 MGI:1298229
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nidogen 2 transcript_id : NM_008695.2

name	2700060E02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84370362 GeneID:68045 MGI:1915295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700060E02 gene transcript_id : NM_026528.3

name	LOC100039534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265255 GeneID:100039534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100039534 transcript_id : XM_001472977.1

name	Gng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490420 GeneID:14702 MGI:102705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 2 subunit transcript_id : NM_001038637.1

name	Gng2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490416 GeneID:14702 MGI:102705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein (G protein), gamma 2 subunit transcript_id : NM_010315.4

name	1810063B07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265257 GeneID:67509 MGI:1914759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 67 ESTs, 2 Proteins product : RIKEN cDNA 1810063B07 gene transcript_id : XM_973341.2

name	Kcnk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369488 GeneID:16529 MGI:1336175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily K, member 5 transcript_id : NM_021542.3

name	Kcnk16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82953419 GeneID:74571 MGI:1921821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : potassium channel, subfamily K, member 16 transcript_id : XM_138942.3

name	Nudt13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606386 GeneID:67725 MGI:1914975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 13 transcript_id : NM_026341.2

name	Ecd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383768 GeneID:70601 MGI:1917851
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecdysoneless homolog (Drosophila) transcript_id : NM_027475.2

name	AA536717 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803192 GeneID:105428 MGI:2145567
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA536717 transcript_id : NM_172379.2

name	AA536717 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67972426 GeneID:105428 MGI:2145567
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA536717 transcript_id : NM_001024512.1

name	Dnajc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381747 GeneID:108671 MGI:1915326
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily C, member 9 transcript_id : NM_134081.3

name	Mrps16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386526 GeneID:66242 MGI:1913492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S16 transcript_id : NM_025440.2

name	Ttc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396700 GeneID:76670 MGI:1923920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 1 Protein product : tetratricopeptide repeat domain 18, transcript variant 1 transcript_id : XM_127606.7

name	Anxa7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352931 GeneID:11750 MGI:88031
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : annexin A7 transcript_id : NM_009674.2

name	Zmynd17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396710 GeneID:74843 MGI:1922093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 1 Protein product : zinc finger, MYND domain containing 17 transcript_id : XM_127602.4

name	Ppp3cb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45592929 GeneID:19056 MGI:107163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 3, catalytic subunit, beta isoform transcript_id : NM_008914.1

name	Usp54 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053452 GeneID:78787 MGI:1926037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 54 transcript_id : NM_030180.2

name	Myoz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032009 GeneID:59011 MGI:1929471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myozenin 1 transcript_id : NM_021508.3

name	Synpo2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129847 GeneID:68760 MGI:1916010
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptopodin 2-like transcript_id : NM_175132.3

name	Sec24c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28916672 GeneID:218811 MGI:1919746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC24 related gene family, member C (S. cerevisiae) transcript_id : NM_172596.1

name	Fut11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130486 GeneID:73068 MGI:1920318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucosyltransferase 11 transcript_id : NM_028428.2

name	Chchd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365360 GeneID:66121 MGI:1913371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 1 transcript_id : NM_025366.2

name	2310021P13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366309 GeneID:268721 MGI:1919156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : RIKEN cDNA 2310021P13 gene transcript_id : NM_027996.2

name	Ndst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195687 GeneID:17423 MGI:97040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 transcript_id : NM_010811.2

name	Camk2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362728 GeneID:12325 MGI:88259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II gamma transcript_id : NM_001039139.1

name	Camk2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362741 GeneID:12325 MGI:88259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II gamma transcript_id : NM_001039138.1

name	Camk2g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362743 GeneID:12325 MGI:88259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent protein kinase II gamma transcript_id : NM_178597.4

name	Plau (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560816 GeneID:18792 MGI:97611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasminogen activator, urokinase transcript_id : NM_008873.2

name	Ube2e2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450233 CCDS:CCDS26838.1 GeneID:218793 MGI:2384997
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : TBC1 domain family, member 12 product : ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) protein_id : NP_659088.1

name	LOC100042322 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265142 GeneID:100042322
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477989.1

name	EG632477 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396601 GeneID:632477 MGI:3648627
definition	codon_start : 1 product : hypothetical protein protein_id : XP_994949.1

name	EG434616 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51827552 GeneID:434616 MGI:3647174
definition	codon_start : 1 product : similar to geranylgeranyl diphosphate synthase1 protein_id : XP_486466.1

name	1700110I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265246 GeneID:73549 MGI:1920799
definition	codon_start : 1 product : hypothetical protein LOC73549 protein_id : XP_001472019.1

name	LOC100039452 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265254 GeneID:100039452
definition	codon_start : 1 product : similar to 1700001E04Rik protein protein_id : XP_001472902.1

name	EG432825 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67010059 GeneID:432825 MGI:3646663
definition	codon_start : 1 product : hypothetical protein LOC432825 protein_id : NP_001019877.1

name	EG664855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265249 GeneID:664855 MGI:3643484
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_978172.2

name	Nid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370361 GeneID:18074 MGI:1298229
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA] [Evidence IPI]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IPI] [Evidence IDA] codon_start : 1 note : entactin 2 product : nidogen 2 protein_id : NP_032721.2

name	2700060E02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386026 CCDS:CCDS26839.1 GeneID:68045 MGI:1915295
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68045 protein_id : NP_080804.1

name	LOC100039534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265256 GeneID:100039534
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473027.1

name	Gng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490421 CCDS:CCDS26840.1 GeneID:14702 MGI:102705
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 2 subunit protein_id : NP_001033726.1

name	Gng2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754020 CCDS:CCDS26840.1 GeneID:14702 MGI:102705
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003924 - GTPase activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein (G protein), gamma 2 subunit protein_id : NP_034445.1

name	1810063B07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265258 GeneID:67509 MGI:1914759
definition	codon_start : 1 product : hypothetical protein LOC67509 protein_id : XP_978435.2

name	Kcnk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11496265 CCDS:CCDS26841.1 GeneID:16529 MGI:1336175
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : potassium inwardly-rectifying channel, subfamily K, member 5 product : potassium channel, subfamily K, member 5 protein_id : NP_067517.1

name	Kcnk16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82953420 GeneID:74571 MGI:1921821
definition	codon_start : 1 product : potassium channel, subfamily K, member 16 protein_id : XP_138942.3

name	Nudt13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606387 GeneID:67725 MGI:1914975
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : nudix-type motif 13 protein_id : NP_080617.2

name	Ecd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076957 CCDS:CCDS26842.1 GeneID:70601 MGI:1917851
definition	codon_start : 1 product : suppressor of S. cerevisiae gcr2 protein_id : NP_081751.1

name	AA536717 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67972427 GeneID:105428 MGI:2145567
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC105428 isoform 1 protein_id : NP_001019683.1

name	AA536717 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369503 GeneID:105428 MGI:2145567
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC105428 isoform 2 protein_id : NP_759011.1

name	Dnajc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956266 CCDS:CCDS26844.1 GeneID:108671 MGI:1915326
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : DnaJ homolog, subfamily C, member 9 protein_id : NP_598842.1

name	Mrps16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384844 GeneID:66242 MGI:1913492
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : mitochondrial ribosomal protein S16 protein_id : NP_079716.1

name	Ttc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28477293 GeneID:76670 MGI:1923920
definition	codon_start : 1 product : tetratricopeptide repeat domain 18 isoform 1 protein_id : XP_127606.2

name	Anxa7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753062 CCDS:CCDS26845.1 GeneID:11750 MGI:88031
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0008283 - cell proliferation [Evidence IMP] codon_start : 1 exception : mismatches in translation note : annexin VII product : annexin A7 protein_id : NP_033804.1

name	Zmynd17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265259 GeneID:74843 MGI:1922093
definition	codon_start : 1 product : zinc finger, MYND domain containing 17 protein_id : XP_127602.3

name	Ppp3cb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45592930 CCDS:CCDS26846.1 GeneID:19056 MGI:107163
definition	GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007507 - heart development [Evidence IMP]; GO:0006470 - protein amino acid dephosphorylation [Evidence IMP]; GO:0030217 - T cell differentiation [Evidence IMP] codon_start : 1 note : PP2BA beta product : protein phosphatase 3, catalytic subunit, beta isoform protein_id : NP_032940.1

name	Usp54 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053453 CCDS:CCDS26847.1 GeneID:78787 MGI:1926037
definition	codon_start : 1 product : ubiquitin specific protease 54 protein_id : NP_084456.2

name	Myoz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946924 GeneID:59011 MGI:1929471
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA] [Evidence IPI]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 note : skeletal muscle-specific protein; calcineurin-2; calsarcin-2 product : myozenin 1 protein_id : NP_067483.1

name	Synpo2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29611659 CCDS:CCDS26849.1 GeneID:68760 MGI:1916010
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : synaptopodin 2-like protein_id : NP_780341.1

name	Sec24c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916673 CCDS:CCDS26850.1 GeneID:218811 MGI:1919746
definition	GO_component : GO:0030127 - COPII vesicle coat [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SEC24 related gene family, member C protein_id : NP_766184.1

name	Fut11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037305 CCDS:CCDS26851.1 GeneID:73068 MGI:1920318
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : alpha (1,3) fucosyltransferase protein_id : NP_082704.1

name	Chchd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384734 CCDS:CCDS26852.1 GeneID:66121 MGI:1913371
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 1 protein_id : NP_079642.1

name	2310021P13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430709 GeneID:268721 MGI:1919156
definition	GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC268721 protein_id : NP_082272.1

name	Ndst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195688 CCDS:CCDS26854.1 GeneID:17423 MGI:97040
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0015016 - [heparan sulfate]-glucosamine N-sulfotransferase activity [Evidence TAS] GO_process : GO:0050875 - cellular physiological process [Evidence IMP]; GO:0006024 - glycosaminoglycan biosynthesis [Evidence TAS]; GO:0015012 - heparan sulfate proteoglycan biosynthesis [Evidence IMP] codon_start : 1 note : mastocytoma N-deacetylase/N-sulfotransferase; glucosaminyl N-deacetylase/N-sulphotransferase 2; heparan N-sulfotransferase 2; heparan sulfate N-deacetylase/N-sulfotransferase 2; heparan glucosaminyl N-deacetylase/N-sulfotransferase 2; [Heparan sulfate]-glucosamine N-sulfotransferase product : N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 protein_id : NP_034941.2

name	Camk2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362729 CCDS:CCDS26856.1 GeneID:12325 MGI:88259
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; CaMK II; Ca2+/calmodulin-dependent protein kinase II product : calcium/calmodulin-dependent protein kinase II gamma isoform 3 protein_id : NP_001034228.1

name	Camk2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362742 CCDS:CCDS26855.1 GeneID:12325 MGI:88259
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; CaMK II; Ca2+/calmodulin-dependent protein kinase II product : calcium/calmodulin-dependent protein kinase II gamma isoform 2 protein_id : NP_001034227.1

name	Camk2g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75991700 CCDS:CCDS26857.1 GeneID:12325 MGI:88259
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IMP] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0000082 - G1/S transition of mitotic cell cycle [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; CaMK II; Ca2+/calmodulin-dependent protein kinase II product : calcium/calmodulin-dependent protein kinase II gamma isoform 1 protein_id : NP_848712.2

name	Plau (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679377 CCDS:CCDS26858.1 GeneID:18792 MGI:97611
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008243 - plasminogen activator activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : urokinase-type plasminogen activator product : plasminogen activator, urokinase protein_id : NP_032899.1

name	LOC627741 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627741
definition	number : 1 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 1 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 2 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 3 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 4 pseudo : _no_value

name	LOC100042299 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042299
definition	number : 5 pseudo : _no_value

name	LOC675069 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675069
definition	number : 1 pseudo : _no_value

name	LOC632470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632470
definition	number : 3 pseudo : _no_value

name	LOC632470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632470
definition	number : 2 pseudo : _no_value

name	LOC632470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632470
definition	number : 1 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 6 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 5 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 4 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 3 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 2 pseudo : _no_value

name	EG632498 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632498
definition	number : 1 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 1 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 2 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 3 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 4 pseudo : _no_value

name	EG667341 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667341
definition	number : 5 pseudo : _no_value

name	LOC619996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619996
definition	number : 2 pseudo : _no_value

name	LOC619996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619996
definition	number : 1 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 4 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 3 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 2 pseudo : _no_value

name	LOC675165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675165
definition	number : 1 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 1 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 2 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 3 pseudo : _no_value

name	LOC100038983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038983
definition	number : 4 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 1 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 2 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 3 pseudo : _no_value

name	LOC673583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673583
definition	number : 4 pseudo : _no_value

name	LOC100039106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039106
definition	number : 6 pseudo : _no_value

name	LOC100039106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039106
definition	number : 5 pseudo : _no_value

name	LOC100039106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039106
definition	number : 4 pseudo : _no_value

name	LOC100039106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039106
definition	number : 3 pseudo : _no_value

name	LOC100039106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039106
definition	number : 2 pseudo : _no_value

name	LOC100039106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039106
definition	number : 1 pseudo : _no_value

name	LOC667344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265149 GeneID:667344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to Speer4e protein pseudo : _no_value transcript_id : XR_033495.1

name	EG664814 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265247 GeneID:664814 MGI:3643017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : predicted gene, EG664814 pseudo : _no_value transcript_id : XR_001650.2

name	LOC100039441 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265252 GeneID:100039441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 91 ESTs, 1 Protein product : hypothetical protein LOC100039441 pseudo : _no_value transcript_id : XR_030894.1

clone name	MSMg01-292K09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-401E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-359C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522K06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178N24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-325F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313A18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086P07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-202F10.b	B6Ng01-202F10.g
ACC	GA022855	GA022856
length	440	1,173
definition	B6Ng01-202F10.b	B6Ng01-202F10.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(20,527,848 - 20,528,293)	(20,659,855 - 20,661,035)
sequence	ttaacttaaaactgagttctgacccatcttcttaggagccgacctctgtc atagcagcctttcaaacatgatgtagaagcgatattcatcttactgggcc cgtagacatgagaaggtatgtctccagttctgaaaatgagcagaacttat gttgtatcttacaaacacaaggggcagagaccagatttcatgactattac tagaaatctcagacaatggatgaatcgcctaaagcatcacttgagtcaga aagccaagtatctaaaagccaagtagctaaacccttagcatttatctcag aatactcggggcaacctaagtgggctgcaagagcccccaggtcttggcct gtgtggggggcaatggtccagctccggctccagccaaaaacaatctaatg agcaccttttgttctctgggggctgggggtgggggtgggg	gaattcaagaacacccagaaaagatccctagactcatttcagattttaat taatcaaatttattaaagccaccagcagggtcacccacagtctttggccc aaatcagagatatgctatccagaggcaggtgaaagaaggtcttttaaaga tgaaacccagaagagcttttcctctctgctaagattagatggtcaaggtg acttcaaaatagtccttgaatgtctgaatgggcaggttatagaaaccaaa atcagcaattattcatatcataacaagcagatggccatagttgtacattt ctgggcagagggttaaggagtcagggttcccaagaatttattttctagga gcttgagtgggggaaaaacagctattaggtaccaagatggatgcctagca tgaacatggagtttcattagctatcacaatggtacctaattttcaaagaa tacctctgcccaaaaggagaaagagcagtccgagaccaccacaaaggagt gagtcaccacctgcctgtgactccctgtattgccatcattacattggtaa atttggtttgtttgtttgtttgagggtcattcccttggatacagaacagt gcagtatgagccgtagggcctcagagtgagctgactggaatgcagtcagc ataaaccttgcttgccttcgtagagctcagcagcagccacggcattttgc ctgtcctctgctgtagagtctcagttattaacttttaccttgatggactg agatgtattcatccctgaaaagccctctagtttttggagattttcttatg ggtgtccagagctgactgagtgacaaaagccaaattttacactctaactt tttttttttacgctaatgaataaagagatgtaagatctgaaggtttcttc caatcttcaagaaatgccccaggagactcttctgggctggaggagcctca gtagtttaagacaaattagtgggtggcaagctgcaccctgaattccagtc atagattctggtgacagtgtccacagcctgggactgcatatgtattgggg tccaattggatggagagactggcttcaatcgagtagctttttaaaggcat tcatccagcaggcctgaggccccccccgaaatagacttatctcaattcga atctatgacatgattcccctttt
quality values	Open. Hide. 62 62 62 54 62 62 54 56 62 62 62 62 49 62 62 62 62 62 62 49 54 54 51 62 47 44 62 51 45 34 34 28 43 24 23 28 34 28 34 38 34 59 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 54 49 62 59 59 62 62 62 62 62 62 59 62 62 56 51 37 54 54 45 54 56 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 62 62 54 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 19 8	Open. Hide. 62 47 51 47 62 47 44 44 56 62 62 62 59 62 24 30 16 13 20 28 27 28 27 27 20 25 36 43 46 54 62 59 62 62 54 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 59 51 49 51 46 50 46 46 59 59 59 56 56 54 43 56 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 47 49 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 54 58 58 49 58 52 58 58 54 54 58 58 58 54 58 58 58 58 52 58 58 54 49 58 58 58 42 39 58 58 58 53 58 58 58 52 58 58 58 49 58 58 58 58 41 58 58 41 54 49 42 58 58 58 58 58 58 58 58 45 40 58 53 53 52 58 58 52 51 58 53 58 53 54 50 51 53 51 58 58 52 58 58 58 53 58 31 58 58 29 58 53 58 50 47 58 46 53 58 54 52 52 58 58 47 46 52 58 51 58 50 41 58 39 53 40 39 53 50 50 53 53 53 48 49 50 50 58 49 42 51 53 53 50 53 42 53 58 53 52 50 50 51 39 54 39 50 53 45 53 40 50 49 34 53 45 52 51 52 39 53 54 54 45 42 47 54 54 49 47 34 49 44 54 42 45 46 41 42 42 51 37 52 54 33 41 34 53 31 28 53 45 45 40 45 40 45 42 42 53 31 33 33 37 54 54 54 37 39 39 51 40 37 31 34 54 51 30 22 32 53 45 33 33 34 53 24 29 17 29 45 25 32 31 49 47 32 39 42 52 51 46 39 32 53 46 33 32 34 32 40 45 53 53 51 33 40 34 45 32 37 18 51 51 43 42 36 31 31 31 37 51 31 31 45 32 33 42 31 31 51 24 39 37 35 42 31 31 42 43 25 31 42 34 26 31 46 47 32 32 31 31 31 48 30 31 48 48 31 32 38 31 31 42 42 23 18 36 28 31 46 46 48 48 48 48 46 47 46 26 17 27 24 37 31 21 20 26 39 25 32 29 21 48 35 26 30 23 15 12 31 21 16 34 20 31 21 34 32 36 21 26 12 15 17 48 33 37 17 21 25 26 21 24 32 31 24 30 32 21 32 27 38 48 21 21 38 27 41 44 33 31 18 16 37 14 17 13 31 31 16 24 23 22 43 47 11 13 32 17 25 30 7 25 23 11 33 24 18 25 32 24 33 27 13 20 43 20 22 22 24 20 9 10 48 22 22 21 34 25 34 21 48 15 28 23 25 28 15 16 20 28 15 15 26 24 28 47 24 24 18 18 11 15 16 16 28 24 28 28 20 10 28 21 6 14 12 28 28 19 27 28 17 27 10 6 4 9 15 22 15 27 27 20 17 18 13 17 19 20 28 32 8 5 5 3 10 18 9 16 13 15 21 13 6 7 13 15 15 28 16 11 21 22 5 5 23 20 6 13 23 12 24 8 23 10 13 5 19 20 5 12 8 23 4 7 8 20 21 10 7 4 6 6 6 12 15 14 19 17 17 26 8 8 10 16 6 7 13 9 9 15 4 2 3 4 13 6 8 15 6 9 7 11 6 14 7 8 1 1 5 17 17 28 23 22 14 3 1 3 11 4 3 4 1 3 3 3 1 5 3 4 8 8 11 16 13 11 13 8 13 14 7 11 7 5 8 4 1 3 5 3 1 5 1 5 10 30 23 22 5 3 17 28

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_20527848_20528293
seq2: B6Ng01-202F10.b_48_493

seq1  GAATTCTTAACTTAAAACTGAGTTCTGACCCATCTTCTTAGGAGCCGACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAACTTAAAACTGAGTTCTGACCCATCTTCTTAGGAGCCGACC  50

seq1  TCTGTCATAGCAGCCTTTCAAACATGATGTAGAAGCGATATTCATCTTAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTCATAGCAGCCTTTCAAACATGATGTAGAAGCGATATTCATCTTAC  100

seq1  TGGGCCCGTAGACATGAGAAGGTATGTCTCCAGTTCTGAAAATGAGCAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCCCGTAGACATGAGAAGGTATGTCTCCAGTTCTGAAAATGAGCAGA  150

seq1  ACTTATGTTGTATCTTACAAACACAAGGGGCAGAGACCAGATTTCATGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTATGTTGTATCTTACAAACACAAGGGGCAGAGACCAGATTTCATGAC  200

seq1  TATTACTAGAAATCTCAGACAATGGATGAATCGCCTAAAGCATCACTTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTACTAGAAATCTCAGACAATGGATGAATCGCCTAAAGCATCACTTGA  250

seq1  GTCAGAAAGCCAAGTATCTAAAAGCCAAGTAGCTAAACCCTTAGCATTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGAAAGCCAAGTATCTAAAAGCCAAGTAGCTAAACCCTTAGCATTTA  300

seq1  TCTCAGAATACTCGGGGCAACCTAAGTGGGCTGCAAGAGCCCCCAGGTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAGAATACTCGGGGCAACCTAAGTGGGCTGCAAGAGCCCCCAGGTCT  350

seq1  TGGCCTGTGTGGGGGGCAATGGTCCAGCTCCGGCTCCAGCCAAAAACAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCTGTGTGGGGGGCAATGGTCCAGCTCCGGCTCCAGCCAAAAACAAT  400

seq1  CTAATGAGCACCTTTTGTTCTCTGGGGGCTGGGGGTGGGGGTGGGG  446
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATGAGCACCTTTTGTTCTCTGGGGGCTGGGGGTGGGGGTGGGG  446

seq1: chr14_20659855_20661035
seq2: B6Ng01-202F10.g_65_1237 (reverse)

seq1  -AAAAGGGATTCATGGGCATAGATCTGAATTGAGATAAAGGTTTTTTTTT  49
       ||| |||| |||| | |||||||  ||||||||||||  || | |||  
seq2  AAAAGGGGAATCAT-GTCATAGATTCGAATTGAGATAA--GTCTATTT--  45

seq1  GGGGGGGGGGGCTCAG--CTGCTGGTATGAATGCTTTTAAAAAGCTACTC  97
        |||||||| |||||  ||||||| |||||||| |||||||||||||||
seq2  -CGGGGGGGGCCTCAGGCCTGCTGG-ATGAATGCCTTTAAAAAGCTACTC  93

seq1  GATTTGAGGCAGTCTCTCCATCCAAATGGGACCCCAATACATATGCAGGT  147
      ||||  || |||||||||||||| ||| ||||||||||||||||||||  
seq2  GATTGAAGCCAGTCTCTCCATCC-AATTGGACCCCAATACATATGCAG--  140

seq1  TCCCAGGCTGTGGACACTTGTCACCAGAATCTTATGACTGGAATTCAGGG  197
      ||||||||||||||||| ||||||||||||| ||||||||||||||||||
seq2  TCCCAGGCTGTGGACAC-TGTCACCAGAATC-TATGACTGGAATTCAGGG  188

seq1  TGCAGCTTGCCA-CCACTAATTTGTCTTAAACTACTGAGGCTCCTCCAGC  246
      |||||||||||| |||||||||||||||||||||||||||||||||||| 
seq2  TGCAGCTTGCCACCCACTAATTTGTCTTAAACTACTGAGGCTCCTCCAG-  237

seq1  CCCAGAAGAGTCTCCTGGGGCATTTCTTGAAGATTGGAAGAAACCTTCAG  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGAAGAGTCTCCTGGGGCATTTCTTGAAGATTGGAAGAAACCTTCAG  287

seq1  ATCTTACATCTCTTTATTCATTAGCGT-AAAAAAAAAAGTTAGAGTGTAA  345
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  ATCTTACATCTCTTTATTCATTAGCGTAAAAAAAAAAAGTTAGAGTGTAA  337

seq1  AATTTGGCTTTTGTCACTCAGTCAGCTCTGGACACCCATAAGAAAATCTC  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTGGCTTTTGTCACTCAGTCAGCTCTGGACACCCATAAGAAAATCTC  387

seq1  CAAAAACTAGAGGGCTTTTCAGGGATGAATACATCTCAGTCCATCAAGGT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAACTAGAGGGCTTTTCAGGGATGAATACATCTCAGTCCATCAAGGT  437

seq1  AAAAGTTAATAACTGAGACTCTACAGCAGAGGACAGGCAAAATGCCGTGG  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGTTAATAACTGAGACTCTACAGCAGAGGACAGGCAAAATGCCGTGG  487

seq1  CTGCTGCTGAGCTCTACGAAGGCAAGCAAGGTTTATGCTGACTGCATTCC  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTGCTGAGCTCTACGAAGGCAAGCAAGGTTTATGCTGACTGCATTCC  537

seq1  AGTCAGCTCACTCTGAGGCCCTACGGCTCATACTGCACTGTTCTGTATCC  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCAGCTCACTCTGAGGCCCTACGGCTCATACTGCACTGTTCTGTATCC  587

seq1  AAGGGAATGACCCTCAAACAAACAAACAAACCAAATTTACCAATGTAATG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGAATGACCCTCAAACAAACAAACAAACCAAATTTACCAATGTAATG  637

seq1  ATGGCAATACAGGGAGTCACAGGCAGGTGGTGACTCACTCCTTTGTGGTG  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCAATACAGGGAGTCACAGGCAGGTGGTGACTCACTCCTTTGTGGTG  687

seq1  GTCTCGGACTGCTCTTTCTCCTTTTGGGCAGAGGTATTCTTTGAAAATTA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCGGACTGCTCTTTCTCCTTTTGGGCAGAGGTATTCTTTGAAAATTA  737

seq1  GGTACCATTGTGATAGCTAATGAAACTCCATGTTCATGCTAGGCATCCAT  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTACCATTGTGATAGCTAATGAAACTCCATGTTCATGCTAGGCATCCAT  787

seq1  CTTGGTACCTAATAGCTGTTTTTCCCCCACTCAAGCTCCTAGAAAATAAA  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGTACCTAATAGCTGTTTTTCCCCCACTCAAGCTCCTAGAAAATAAA  837

seq1  TTCTTGGGAACCCTGACTCCTTAACCCTCTGCCCAGAAATGTACAACTAT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTGGGAACCCTGACTCCTTAACCCTCTGCCCAGAAATGTACAACTAT  887

seq1  GGCCATCTGCTTGTTATGATATGAATAATTGCTGATTTTGGTTTCTATAA  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCATCTGCTTGTTATGATATGAATAATTGCTGATTTTGGTTTCTATAA  937

seq1  CCTGCCCATTCAGACATTCAAGGACTATTTTGAAGTCACCTTGACCATCT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCCCATTCAGACATTCAAGGACTATTTTGAAGTCACCTTGACCATCT  987

seq1  AATCTTAGCAGAGAGGAAAAGCTCTTCTGGGTTTCATCTTTAAAAGACCT  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTTAGCAGAGAGGAAAAGCTCTTCTGGGTTTCATCTTTAAAAGACCT  1037

seq1  TCTTTCACCTGCCTCTGGATAGCATATCTCTGATTTGGGCCAAAGACTGT  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCACCTGCCTCTGGATAGCATATCTCTGATTTGGGCCAAAGACTGT  1087

seq1  GGGTGACCCTGCTGGTGGCTTTAATAAATTTGATTAATTAAAATCTGAAA  1145
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGACCCTGCTGGTGGCTTTAATAAATTTGATTAATTAAAATCTGAAA  1137

seq1  TGAGTCTAGGGATCTTTTCTGGGTGTTCTTGAATTC  1181
      ||||||||||||||||||||||||||||||||||||
seq2  TGAGTCTAGGGATCTTTTCTGGGTGTTCTTGAATTC  1173

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information