MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-205O08
Chromosome	14 (Build37)
Map Location	63,933,071 - 64,055,351
singlet/doublet	doublet
Overlap gene	LOC100042988, LOC432868, Blk, LOC668293, BC065085
Upstream gene	Rnaseh2b, Gucy1b2, LOC100042960, Ppia-ps14_723.1, LOC545062, EG629059, E130113E03Rik, Ints6, LOC100042969, LOC668263, Wdfy2, LOC668268, EG432867, EG654465, EG654458, 2410125J01Rik, Defb42, LOC100042978, Ctsb, Fdft1, Neil2, Gata4
Downstream gene	Tdh, Mtmr9, Xkr6, LOC668306, 2610028A01Rik, Sox7, 4930578I06Rik, Rp1l1, 4933401F05Rik, 1700007N14Rik, 1700049K14Rik, Msra
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rnaseh2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67153 MGI:1914403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gucy1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:239134 MGI:2660873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042960 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Ppia-ps14_723.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606717
definition	note : peptidylprolyl isomerase A pseudogene 14_723.1 pseudo : _no_value

name	LOC545062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 7 Proteins pseudo : _no_value

name	EG629059 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629059 MGI:3645930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins

name	E130113E03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319433 MGI:2442020
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 1 Protein

name	Ints6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18130 MGI:1202397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042969 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC668263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Wdfy2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:268752 MGI:2442811
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG432867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:432867 MGI:3646223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654465 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654465 MGI:3644478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654458 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654458 MGI:3647180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410125J01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73670 MGI:1920920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb42 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619548 MGI:3033850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 33 ESTs

name	Ctsb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13030 MGI:88561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fdft1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14137 MGI:102706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neil2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382913 MGI:2686058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gata4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14463 MGI:95664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042988 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC432868 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:432868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Blk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12143 MGI:88169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668293 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668293
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins pseudo : _no_value

name	BC065085 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219148 MGI:3606565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58865 MGI:1926231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210376 MGI:2442842
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xkr6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:219149 MGI:2447765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2610028A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72400 MGI:1919650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sox7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20680 MGI:98369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930578I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67750 MGI:1915000
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rp1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:271209 MGI:2384303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933401F05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71037 MGI:1918287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700007N14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74215 MGI:1921465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	1700049K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73382 MGI:1920632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110265 MGI:106916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaseh2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343619 GeneID:67153 MGI:1914403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease H2, subunit B transcript_id : NM_026001.2

name	Gucy1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369173 GeneID:239134 MGI:2660873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase 1, soluble, beta 2 transcript_id : NM_172810.2

name	LOC100042960 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265632 GeneID:100042960
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to hCG28707 transcript_id : XM_001479179.1

name	EG629059 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265634 GeneID:629059 MGI:3645930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins product : predicted gene, EG629059 transcript_id : XM_127791.7

name	E130113E03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397204 GeneID:319433 MGI:2442020
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 40 ESTs, 1 Protein product : RIKEN cDNA E130113E03 gene transcript_id : XM_893895.2

name	Ints6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51467748 GeneID:18130 MGI:1202397
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrator complex subunit 6 transcript_id : NM_008715.2

name	LOC100042969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265637 GeneID:100042969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042969 transcript_id : XM_001479206.1

name	Wdfy2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348899 GeneID:268752 MGI:2442811
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat and FYVE domain containing 2 transcript_id : NM_175546.3

name	EG432867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379964 GeneID:432867 MGI:3646223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG432867 transcript_id : NM_001037751.2

name	EG654465 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993779 GeneID:654465 MGI:3644478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG654465 transcript_id : NM_001039125.1

name	EG654458 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993766 GeneID:654458 MGI:3647180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG654458 transcript_id : NM_001039121.1

name	2410125J01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88595374 GeneID:73670 MGI:1920920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410125J01 gene transcript_id : NM_001039566.1

name	Defb42 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370606 GeneID:619548 MGI:3033850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 42 transcript_id : NM_001034910.2

name	LOC100042978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265640 GeneID:100042978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 33 ESTs product : hypothetical protein LOC100042978 transcript_id : XM_001479233.1

name	Ctsb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131153 GeneID:13030 MGI:88561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin B transcript_id : NM_007798.2

name	Fdft1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328172 GeneID:14137 MGI:102706
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : farnesyl diphosphate farnesyl transferase 1 transcript_id : NM_010191.2

name	Neil2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130802 GeneID:382913 MGI:2686058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nei like 2 (E. coli) transcript_id : NM_201610.2

name	Gata4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681730 GeneID:14463 MGI:95664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 4 transcript_id : NM_008092.3

name	LOC100042988 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265642 GeneID:100042988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042988 transcript_id : XM_001479240.1

name	LOC432868 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265775 GeneID:432868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical gene supported by AK052160 transcript_id : XM_001480510.1

name	Blk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982489 GeneID:12143 MGI:88169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B lymphoid kinase transcript_id : NM_007549.2

name	BC065085 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41055045 GeneID:219148 MGI:3606565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC065085 transcript_id : NM_177628.3

name	Tdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254374 GeneID:58865 MGI:1926231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : L-threonine dehydrogenase transcript_id : NM_021480.4

name	Mtmr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563377 GeneID:210376 MGI:2442842
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 9 transcript_id : NM_177594.1

name	Xkr6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27735007 GeneID:219149 MGI:2447765
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X Kell blood group precursor related family member 6 homolog transcript_id : NM_173393.1

name	LOC668306 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94397212 GeneID:668306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC668306 transcript_id : XM_001000764.1

name	2610028A01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803006 GeneID:72400 MGI:1919650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610028A01 gene transcript_id : NM_028228.2

name	Sox7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755611 GeneID:20680 MGI:98369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SRY-box containing gene 7 transcript_id : NM_011446.1

name	4930578I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948266 GeneID:67750 MGI:1915000
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930578I06 gene transcript_id : NM_026359.3

name	Rp1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490371 GeneID:271209 MGI:2384303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinitis pigmentosa 1 homolog (human)-like 1 transcript_id : NM_146246.3

name	4933401F05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486703 GeneID:71037 MGI:1918287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933401F05 gene transcript_id : NM_001081063.1

name	1700007N14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94397205 GeneID:74215 MGI:1921465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : RIKEN cDNA 1700007N14 gene, transcript variant 2 transcript_id : XM_001003265.1

name	1700049K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676358 GeneID:73382 MGI:1920632
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700049K14 gene transcript_id : NM_028525.2

name	Msra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60097936 GeneID:110265 MGI:106916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine sulfoxide reductase A transcript_id : NM_026322.3

name	Rnaseh2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037097 CCDS:CCDS27189.1 GeneID:67153 MGI:1914403
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : deleted in lymphocytic leukemia 8 protein_id : NP_080277.1

name	Gucy1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370208 CCDS:CCDS27190.1 GeneID:239134 MGI:2660873
definition	EC_number : 4.6.1.2 GO_function : GO:0004383 - guanylate cyclase activity [Evidence IEA]; GO:0020037 - heme binding [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006182 - cGMP biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 note : soluble guanylyl cyclase beta2 subunit product : guanylate cyclase 1, soluble, beta 2 protein_id : NP_766398.1

name	LOC100042960 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265633 GeneID:100042960
definition	codon_start : 1 product : similar to hCG28707 protein_id : XP_001479229.1

name	EG629059 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265635 GeneID:629059 MGI:3645930
definition	codon_start : 1 product : hypothetical protein protein_id : XP_127791.7

name	E130113E03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82954336 GeneID:319433 MGI:2442020
definition	codon_start : 1 product : hypothetical protein LOC319433 protein_id : XP_898988.1

name	Ints6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51467749 CCDS:CCDS27191.1 GeneID:18130 MGI:1202397
definition	GO_component : GO:0032039 - integrator complex [Evidence ISS] GO_process : GO:0016180 - snRNA processing [Evidence ISS] codon_start : 1 note : Notch2-like; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 product : integrator complex subunit 6 protein_id : NP_032741.2

name	LOC100042969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265638 GeneID:100042969
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479256.1

name	Wdfy2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425326 CCDS:CCDS27192.1 GeneID:268752 MGI:2442811
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : WD repeat and FYVE domain containing 2 protein_id : NP_780755.1

name	EG432867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702294 GeneID:432867 MGI:3646223
definition	codon_start : 1 note : beta-defensin 42 product : hypothetical LOC432867 protein_id : NP_001032840.1

name	EG654465 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993780 GeneID:654465 MGI:3644478
definition	codon_start : 1 product : defensin beta 41 protein_id : NP_001034214.1

name	EG654458 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993767 GeneID:654458 MGI:3647180
definition	codon_start : 1 product : defensin beta 43 protein_id : NP_001034210.1

name	2410125J01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88595375 GeneID:73670 MGI:1920920
definition	codon_start : 1 product : beta-defensin 30 protein_id : NP_001034655.1

name	Defb42 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370322 GeneID:619548 MGI:3033850
definition	codon_start : 1 note : beta-defensin 44 product : defensin beta 42 protein_id : NP_001030082.1

name	LOC100042978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265641 GeneID:100042978
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479283.1

name	Ctsb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681079 CCDS:CCDS27197.1 GeneID:13030 MGI:88561
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004213 - cathepsin B activity [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0050790 - regulation of catalytic activity [Evidence IEA] codon_start : 1 product : cathepsin B preproprotein protein_id : NP_031824.1

name	Fdft1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328173 CCDS:CCDS27198.1 GeneID:14137 MGI:102706
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004310 - farnesyl-diphosphate farnesyltransferase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008299 - isoprenoid biosynthesis [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 note : squalene synthase product : farnesyl diphosphate farnesyl transferase 1 protein_id : NP_034321.2

name	Neil2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118130803 GeneID:382913 MGI:2686058
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005874 - microtubule [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005876 - spindle microtubule [Evidence IDA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0008534 - oxidized purine base lesion DNA N-glycosylase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006284 - base-excision repair [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : nei like 2 protein_id : NP_963904.2

name	Gata4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909569 GeneID:14463 MGI:95664
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] [Evidence IDA]; GO:0003704 - specific RNA polymerase II transcription factor activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007267 - cell-cell signaling [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0048617 - embryonic foregut morphogenesis [Evidence IMP]; GO:0048558 - embryonic gut morphogenesis [Evidence IMP]; GO:0035054 - embryonic heart tube anterior/posterior pattern formation [Evidence IMP]; GO:0035050 - embryonic heart tube development [Evidence IMP]; GO:0048598 - embryonic morphogenesis [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] [Evidence IGI]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : GATA-binding protein 4 product : GATA binding protein 4 protein_id : NP_032118.2

name	LOC100042988 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265643 GeneID:100042988
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479290.1

name	LOC432868 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265776 GeneID:432868
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480560.1

name	Blk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982490 CCDS:CCDS27200.1 GeneID:12143 MGI:88169
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : B lymphoid kinase protein_id : NP_031575.2

name	BC065085 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41055046 CCDS:CCDS27201.1 GeneID:219148 MGI:3606565
definition	codon_start : 1 product : hypothetical protein LOC219148 protein_id : NP_808296.2

name	Tdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254375 CCDS:CCDS27202.1 GeneID:58865 MGI:1926231
definition	EC_number : 1.1.1.103 GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0050662 - coenzyme binding [Evidence IEA]; GO:0008743 - L-threonine 3-dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : L-threonine 3-dehydrogenase product : L-threonine dehydrogenase protein_id : NP_067455.4

name	Mtmr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563378 CCDS:CCDS27203.1 GeneID:210376 MGI:2442842
definition	GO_function : GO:0030234 - enzyme regulator activity [Evidence IDA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : myotubularin related protein 9 protein_id : NP_808262.1

name	Xkr6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27735008 CCDS:CCDS27204.1 GeneID:219149 MGI:2447765
definition	codon_start : 1 product : XK-related protein 6 protein_id : NP_775569.1

name	LOC668306 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94397213 GeneID:668306
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000764.1

name	2610028A01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18129616 CCDS:CCDS27205.1 GeneID:72400 MGI:1919650
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IEA]; GO:0007004 - telomere maintenance via telomerase [Evidence IDA] codon_start : 1 note : PIN2-interacting protein X1; TRF1-interacting protein 1; liver-related putative tumor suppressor product : PIN2/TRF1-interacting protein protein_id : NP_082504.1

name	Sox7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755612 CCDS:CCDS27206.1 GeneID:20680 MGI:98369
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SRY-box 7 protein_id : NP_035576.1

name	4930578I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948267 GeneID:67750 MGI:1915000
definition	codon_start : 1 product : hypothetical protein LOC67750 protein_id : NP_080635.2

name	Rp1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27881421 GeneID:271209 MGI:2384303
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 product : retinitis pigmentosa 1 homolog (human)-like 1 protein_id : NP_666358.2

name	4933401F05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486704 GeneID:71037 MGI:1918287
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71037 protein_id : NP_001074532.1

name	1700007N14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94397206 GeneID:74215 MGI:1921465
definition	codon_start : 1 product : hypothetical protein LOC74215 isoform 2 protein_id : XP_001003265.1

name	1700049K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117676359 GeneID:73382 MGI:1920632
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73382 protein_id : NP_082801.2

name	Msra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981013 CCDS:CCDS27209.1 GeneID:110265 MGI:106916
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008113 - protein-methionine-S-oxide reductase activity [Evidence IMP] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 product : methionine sulfoxide reductase A protein_id : NP_080598.2

name	LOC668268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668268
definition	number : 1 pseudo : _no_value

name	LOC668268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668268
definition	number : 2 pseudo : _no_value

name	LOC668268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668268
definition	number : 3 pseudo : _no_value

name	LOC668293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668293
definition	number : 2 pseudo : _no_value

name	LOC668293 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668293
definition	number : 1 pseudo : _no_value

name	LOC545062 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265774 GeneID:545062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 7 Proteins product : similar to Small nuclear ribonucleoprotein polypeptide N pseudo : _no_value transcript_id : XR_034695.1

name	LOC668263 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265639 GeneID:668263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to ribosomal protein L7a pseudo : _no_value transcript_id : XR_034100.1

clone name	MSMg01-307D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-330E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-192E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273I04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-205O08.b	B6Ng01-205O08.g
ACC	GA025452	GA025453
length	1,130	1,144
definition	B6Ng01-205O08.b	B6Ng01-205O08.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(63,933,071 - 63,934,189)	(64,054,239 - 64,055,351)
sequence	gaattctttacccttttgcctcactttcctaggtgctatgattccgtgca tgcaccatcatacctaactttatacgccgtattcttttctttatttttta gatttatttgtatttactggtatgttcatgtctgtatggatgtgtgtcct acctgtgcgggtgcccacagaggccagaagatgggtagggtgacctggat ctggagttgcaaggtagacgtgagggctgggaactgaacttgggtcttca ggacaagtggggcacattcttaattgttgcaccggctctccagctctgtg ttcagtgttaataggtaaagacagccttcttatccttatcactgttggac gcccactgtcctgagtgtagggattttgttcctctcttcttaaaacattt attatttatttattgtgcatgtgcgtgtgtgcgtgtgtacaacttgcctg aattgcttttctccttttaccatgtgaatcctaggaattgaactctggtc ctcagacttggcaccaatccccttttcccaataagccattttgttagccc tggttcctctctggtacagtgaagaagtctaaaggattagctctactcag agctcaaatactctcactcggatcagtccccaaacccatctcttcactgc cttctgctgaggtgacttcgggttcagattccttgaaacagttaagggat agcagctacctgatcctcttaggcccaagcatagccagcacaaacagctt tgctctagagtctgagcaggaccagtctccattgctggacacaagggaat agcaaggactaagtttactctctcattaagcaaatgaaaaccagtacagg cacattaacaggcttttagacaaggagcagcaggtagtgtaggacaggga ctttggagagaagggttgctctgccctgttacttgggagacctgggcatc tgcagtaagggcagcccaatgggggagtctggtgggagaaggcacatgga aggagatggctttggaatttcaaagggtccaaggtagccagagctcagat gcagagcataaggtggaggaagagctaccgagagccctgccaagtcaatc aggtctctctccgtacttctagtagagacc	gaattctccgcaccgttcttttttgaagggacgttcttttgcgttgcgtc agggcggttgcctggcgaccgtagagctagtccgccgccagcctctcggc gccgccgcccgcctcccattcaagccgcggcaggtcggcctcccggcacc gctggtccgagtgcacccgggtcctaaagacccccgattctccctccccg tgcaaggccaagcccagtcaggaactctcagcaagctccaggcgaaatca aacccaaacttttttttcccattaagatcaaagcaaagagagttatgtcc cgtcccgtcccgtcttactgccccctccctccaagcatggcaacgtggct ttgccactgtcagcagttcgctgagggaatgggcagggaaagcgggctgc actccacccaggaaagtcttgggttcctgatcccagcagcagccaccaag tcagaccaactggcactgacctgcgcgctcgcgcgctcgcgtgccacacc attgcagggctccagctgggtaggcatttgtgggcagctctggcttagtt ttcaagtggggaaaactgggatgttaagaggaaagagctgtgggtagtgc tggtgggcctgatgtgagagcctccttaaccacctgcacctcattcttgg gaactgcagcagctgcatctgtcctaatactcttagggtcaggttctact gccctaagttccaaccctgctccgtgagcacctagagctgttggcatctg gagcttgctagcacttagggtcacagagaacagaaagctgggactgacat gcttgtagactcttaggacccatcctgactgcaggatgaggcaaggggcc ccacacaagagaccagcttggggtgatgtcagaaaggtggttcttctttt gtccttcgaccagcttccttaaaacctctaaagggtaagaaggggtcttt ccaagagaatggagtcacctttcatcctcctcttgtctcttgagttcagt tgctgttgtttttaaggatctcttgaccttctttgctgggctagaaggag caccttgagggtggtgaccttcaacactcaaactaacctctccccaatga aacactggtgtctggaacttcatggtagactgggggaaggagtg
quality values	Open. Hide. 46 31 28 38 62 62 46 62 47 56 62 62 62 62 62 62 62 47 62 62 62 44 29 62 62 62 62 62 62 59 44 51 38 32 38 32 40 36 46 50 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 59 56 62 56 43 33 43 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 56 62 41 62 62 62 62 62 62 62 56 56 46 52 52 52 62 62 62 62 47 62 62 62 62 62 62 62 62 62 39 62 52 62 62 47 62 62 62 38 47 41 52 62 52 47 47 62 54 52 58 54 30 58 52 52 58 58 58 58 54 54 58 54 48 42 58 52 54 58 54 45 45 58 58 52 54 58 54 58 54 52 54 58 58 46 54 58 54 54 42 52 49 54 54 44 52 42 54 48 54 54 54 48 58 58 58 54 54 54 42 39 52 54 58 52 58 58 42 52 54 54 54 58 58 58 25 42 31 54 51 35 51 58 52 41 58 48 58 47 50 47 40 51 33 46 51 50 50 48 50 50 50 47 49 39 50 51 51 46 51 47 58 47 47 32 53 50 50 49 46 58 35 32 46 47 51 52 58 49 46 51 37 39 39 47 50 46 58 27 44 48 40 49 46 46 46 42 53 32 46 50 37 39 49 52 50 50 50 50 50 49 53 53 58 58 19 26 49 43 52 42 42 34 58 21 41 52 53 32 58 9 41 19 6 43 28 23 31 28 41 39 39 39 21 22 25 19 35 53 33 33 35 33 17 23 37 35 30 32 12 42 27 32 24 35 40 24 39 37 41 38 32 22 18 39 39 53 26 53 54 26 25 42 53 43 45 42 37 30 29 31 31 37 34 18 32 19 26 30 37 30 19 40 25 30 30 16 23 13 16 15 37 17 14 38 25 19 32 29 31 28 34 28 31 18 19 35 31 53 53 53 43 28 11 34 27 11 36 20 22 27 15 31 33 14 32 15 6 12 21 32 15 23 26 20 41 21 18 31 16 41 18 32 16 11 16 31 45 26 25 20 42 17 51 28 33 32 20 46 25 16 29 27 28 32 42 30 15 6 28 26 22 25 31 46 9 20 42 31 31 27 29 27 8 34 25 9 25 13 21 31 31 17 31 35 33 31 13 28 10 21 23 14 24 17 32 26 27 9 24 23 33 11 17 7 21 39 31 41 18 19 10 9 42 27 32 32 10 6 41 6 31 7 13 20 23 19 17 9 22 20 11 18 31 6 13 14 11 26 8 21 26 21 35 13 12 32 14 31 20 17 34 10 23 21 10 7 41 13 17 33 29 11 23 16 29 13 30 31 6 7 6 13 34 9 13 34 14 21 23 31 8 8 8 9 10 32 10 6 20 9 30 9 14 6 9 26 10 13 25 10 7 5 11 8 22 9 21 9 19 32 17 22 20 19 5 4 4 5 16 31 15 26 22 8 5 12 18 12 12 27 6 10 28 20 19 20 8 12 7 24 11 9 21 7 8 7 7 6 5 8 7 7 8 6 13 6 7 5 3 3 7 11 6 9	Open. Hide. 62 49 62 54 62 62 62 62 62 62 62 51 56 59 44 35 56 56 59 59 62 62 62 62 59 62 59 59 62 62 59 49 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 56 62 62 56 62 62 62 54 62 62 62 62 62 59 59 62 62 59 59 49 54 54 56 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 56 62 59 62 59 62 62 62 62 54 59 62 59 59 62 54 62 62 62 62 62 62 59 51 59 62 62 62 56 59 59 56 50 50 56 50 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 62 62 62 54 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 49 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 59 56 59 59 62 62 62 62 62 62 59 59 59 62 59 59 59 62 59 62 59 51 59 59 59 59 56 59 59 59 62 56 56 56 59 59 59 59 59 59 62 62 62 62 59 59 59 62 43 59 51 43 59 59 62 62 62 59 62 59 59 62 62 59 62 59 62 59 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 51 59 46 56 59 59 59 59 59 45 62 62 62 56 62 62 62 62 62 62 62 62 56 44 44 62 56 56 62 62 47 44 56 62 62 62 62 56 56 56 56 62 56 56 62 62 62 56 62 62 62 62 56 56 62 62 62 51 62 62 62 62 62 62 56 31 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 56 56 43 45 42 47 62 47 47 56 39 62 40 56 62 56 56 56 62 56 62 62 56 54 54 62 62 42 53 33 33 52 35 50 46 62 50 62 62 52 28 38 30 35 43 34 52 47 47 47 33 54 34 45 43 42 33 41 43 38 42 37 41 50 42 31 25 52 48 39 34 25 28 33 27 26 35 53 42 41 45 54 52 52 54 45 21 48 54 54 27 28 54 49 42 58 42 42 34 24 39 37 41 54 27 50 54 49 52 45 32 39 42 54 41 26 42 41 30 58 58 35 39 42 22 29 15 54 52 49 35 52 42 52 39 46 42 49 50 51 50 47 25 38 40 38 24 14 25 34 23 48 47 38 37 50 40 50 50 48 19 50 21 37 47 37 49 26 53 26 28 36 50 50 32 41 42 25 37 34 42 40 44 26 50 29 21 9 16 32 21 37 31 27 52 40 34 34 11 9 7 31 25 32 39 29 50 50 26 50 18 38 24 18 29 17 29 37 9 14 35 42 19 40 16 32 30 37 35 25 32 19 37 31 40 39 49 42 29 35 25 49 34 41 46 42 45 25 6 14 25 8 42 15 21 40 39 39 39 29 13 27 27 37 19 18 21 24 41 24 31 30 9 34 9 26 33 37 49 15 16 7 13 36 17 14 31 23 20 21 22 19 32 6 38 24 31 20 25 21 32 28 53 47 42 38 24 32 32 27 31 10 46 27 17 26 25 14 22 31 18 42 11 8 8 10 25 8 13 6 49 52 31 31 25 11 21 6 14 26 10 32 16 18 30 27 36 32 18 12 8 6 29 30 18 10 31 6 26 10 22 11 8 11 12 23 51 32 29 11 18 7 32 15 8 43 51 13 14 18 12 41 9 16 22 27 26 15 41 9 34 12 12 18 11 20 13 31 13 12 16 33 14 43 28 34 27 31 10 17 34 27 30 28 11 8 13 31 11 11 15 15 14 21 30 11 9 15 18 17 31 23 21 17 31 25 7 13 6 7 7 6 14 38 31 10 30 15 9 10 6 5 5 5 16 5 24 32 11 7 25 5 29 11 9 36 15 25 15 11 6 32 21 26 37 19 13 13 21 24 11 38 10 24 19 14 30 5 5 13 32 14 43 16 9 20 7 5 6 23 17 19 12 11 14 15 19 12 19 8 6 18 5 16 8 29 4 5 11 21 10 5 8 5 6 25 19 28 7 19 21 18 9 29 13 30 6 5 6 6 5 8 7 9 12 12 16 16 7 16 21 10 16 6 10 9 6 16 3 4 8 17 15 9 16 32 28 27 8 3 6 7 10 8 5 9 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_63933071_63934189
seq2: B6Ng01-205O08.b_49_1178

seq1  GAATTCTTTACCCTTTTGCCTCACTTTCCTAGGTGCTATGATTCCGTGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTACCCTTTTGCCTCACTTTCCTAGGTGCTATGATTCCGTGCA  50

seq1  TGCACCATCATACCTAACTTTATACGCCGTATTCTTTTCTTTATTTTTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACCATCATACCTAACTTTATACGCCGTATTCTTTTCTTTATTTTTTA  100

seq1  GATTTATTTGTATTTACTGGTATGTTCATGTCTGTATGGATGTGTGTCCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTTATTTGTATTTACTGGTATGTTCATGTCTGTATGGATGTGTGTCCT  150

seq1  ACCTGTGCGGGTGCCCACAGAGGCCAGAAGATGGGTAGGGTGACCTGGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGTGCGGGTGCCCACAGAGGCCAGAAGATGGGTAGGGTGACCTGGAT  200

seq1  CTGGAGTTGCAAGGTAGACGTGAGGGCTGGGAACTGAACTTGGGTCTTCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAGTTGCAAGGTAGACGTGAGGGCTGGGAACTGAACTTGGGTCTTCA  250

seq1  GGACAAGTGGGGCACATTCTTAATTGTTGCACCGGCTCTCCAGCTCTGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACAAGTGGGGCACATTCTTAATTGTTGCACCGGCTCTCCAGCTCTGTG  300

seq1  TTCAGTGTTAATAGGTAAAGACAGCCTTCTTATCCTTATCACTGTTGGAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGTGTTAATAGGTAAAGACAGCCTTCTTATCCTTATCACTGTTGGAC  350

seq1  GCCCACTGTCCTGAGTGTAGGGATTTTGTTCCTCTCTTCTTAAAACATTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCACTGTCCTGAGTGTAGGGATTTTGTTCCTCTCTTCTTAAAACATTT  400

seq1  ATTATTTATTTATTGTGCATGTGCGTGTGTGCGTGTGTACAACTTGCCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATTTATTTATTGTGCATGTGCGTGTGTGCGTGTGTACAACTTGCCTG  450

seq1  AATTGCTTTTCTCCTTTTACCATGTGAATCCTAGGAATTGAACTCTGGTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGCTTTTCTCCTTTTACCATGTGAATCCTAGGAATTGAACTCTGGTC  500

seq1  CTCAGACTTGGCACCAATCCCCTTTTCCCAATAAGCCATTTTGTTAGCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGACTTGGCACCAATCCCCTTTTCCCAATAAGCCATTTTGTTAGCCC  550

seq1  TGGTTCCTCTCTGGTACAGTGAAGAAGTCTAAAGGATTAGCTCTACTCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTCCTCTCTGGTACAGTGAAGAAGTCTAAAGGATTAGCTCTACTCAG  600

seq1  AGCTCAAATACTCTCACTCGGATCAGTCCCCAAACCCATCTCTTCACTGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCAAATACTCTCACTCGGATCAGTCCCCAAACCCATCTCTTCACTGC  650

seq1  CTTCTGCTGAGGTGACTTCGGGTTCAGATTCCTTGAAACAGTTAAGGGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGCTGAGGTGACTTCGGGTTCAGATTCCTTGAAACAGTTAAGGGAT  700

seq1  AGCAGCTACCTGATCCTCTTAGGCCCAAGCATAGCCAGCACAAACAGCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGCTACCTGATCCTCTTAGGCCCAAGCATAGCCAGCACAAACAGCTT  750

seq1  TGCTCTAGAGTCTGAGCAGGACCAGTCTCCATTGCTGGACACAAGGGAAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCTAGAGTCTGAGCAGGACCAGTCTCCATTGCTGGACACAAGGGAAT  800

seq1  AGCAAGGACTAAGTTTACTCTCTCATTAAGCAAATGAAAACCAGTACAGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAGGACTAAGTTTACTCTCTCATTAAGCAAATGAAAACCAGTACAGG  850

seq1  CACATTAACAGGCTTTTAGACAAGGAGCAGCAGGTAGTGTAGGACAGGGA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACATTAACAGGCTTTTAGACAAGGAGCAGCAGGTAGTGTAGGACAGGGA  900

seq1  CTTTGGAGAGAAGGGTTGCTCTGCCCTGTTTACTTGGGAGACCTTGGGCA  950
      |||||||||||||||||||||||||||| |||||||||||||| ||||||
seq2  CTTTGGAGAGAAGGGTTGCTCTGCCCTG-TTACTTGGGAGACC-TGGGCA  948

seq1  TCTGCAGT-AGGGCAGCCCA--TGGGGAGCCTGGT-GGAG-AGGCACATG  995
      |||||||| |||||||||||   |||||| ||||| |||| |||||||||
seq2  TCTGCAGTAAGGGCAGCCCAATGGGGGAGTCTGGTGGGAGAAGGCACATG  998

seq1  G-AGGAGATGGCTTGGGAATTTCAAAGGGT-CAAGGTAGCCAGAGCTCAG  1043
      | |||||||||||| ||||||||||||||| |||||||||||||||||||
seq2  GAAGGAGATGGCTTTGGAATTTCAAAGGGTCCAAGGTAGCCAGAGCTCAG  1048

seq1  A-GCAGAGCAT-AGGT-GAGG-AGAGCTACCGAGAGCCCTGCAGAG-CCA  1088
      | ||||||||| |||| |||| ||||||||||||||||||||  || | |
seq2  ATGCAGAGCATAAGGTGGAGGAAGAGCTACCGAGAGCCCTGCCAAGTCAA  1098

seq1  TCAGGCTCTC-CTCCGT-CCTCTAGTAGAGACC  1119
      ||||| |||| |||||| | |||||||||||||
seq2  TCAGG-TCTCTCTCCGTACTTCTAGTAGAGACC  1130

seq1: chr14_64054239_64055351
seq2: B6Ng01-205O08.g_70_1213 (reverse)

seq1  CACTCC-TACCCCAGTCTACCCAGA--GTCCAGACA-CAGTGGTTCA-TG  45
      |||||| | ||||||||||||  ||   |||||||| ||||| |||| ||
seq2  CACTCCTTCCCCCAGTCTACCATGAAGTTCCAGACACCAGTGTTTCATTG  50

seq1  GGGAG-GGGTAGGTTGGGTGTTG-AGGTCAC--ACCTC-AGGTGCTCC-T  89
      ||||| || ||| ||| |||||| |||||||   |||| ||||||||| |
seq2  GGGAGAGGTTAGTTTGAGTGTTGAAGGTCACCACCCTCAAGGTGCTCCTT  100

seq1  CTAG-CCAGCAAGAAGGGTCAAGGAGCATCCTT-AAAACCACAGCAACTG  137
      |||| |||||||  | |||||| ||| |||||| ||||| ||||||||||
seq2  CTAGCCCAGCAAAGAAGGTCAA-GAG-ATCCTTAAAAACAACAGCAACTG  148

seq1  -ACTCAAGAGAC-AGAGGA-GATG-AAGGTGACT-CATTCTCTTGGAAAG  182
       ||||||||||| |||||| |||| ||||||||| |||||||||||||||
seq2  AACTCAAGAGACAAGAGGAGGATGAAAGGTGACTCCATTCTCTTGGAAAG  198

seq1  A-CCCTTC-TACCCTT---AGGGTTTTAGGGAGCTGGTCG-AGGAC-AAA  225
      | |||||| |||||||   ||| ||| ||| ||||||||| ||||| |||
seq2  ACCCCTTCTTACCCTTTAGAGGTTTTAAGGAAGCTGGTCGAAGGACAAAA  248

seq1  GA--GACCACC-TTCTGGCATCACCCCAAGCTGGTCTCTTGTGT-GGGCC  271
      ||   |||||| ||||| |||||||||||||||||||||||||| |||||
seq2  GAAGAACCACCTTTCTGACATCACCCCAAGCTGGTCTCTTGTGTGGGGCC  298

seq1  CCTTGCCTCATCCTGCAGTCAGGAT-GGTCCTAAGAGTCTACAAGCATGT  320
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  CCTTGCCTCATCCTGCAGTCAGGATGGGTCCTAAGAGTCTACAAGCATGT  348

seq1  CAGT-CCAGC-TTCTGTTCTCTGTGACCCTAAGTGCTAGC-AGCTCCAGA  367
      |||| ||||| ||||||||||||||||||||||||||||| |||||||||
seq2  CAGTCCCAGCTTTCTGTTCTCTGTGACCCTAAGTGCTAGCAAGCTCCAGA  398

seq1  TGCCAACAGCTCTAGGTGCTCACGGAGCAGGGTTGGAACTTAGGGCAGTA  417
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAACAGCTCTAGGTGCTCACGGAGCAGGGTTGGAACTTAGGGCAGTA  448

seq1  GAACCTGACCCTAAGAGTATTAGGACAGATGCAGCTGCTGCAGTTCCCAA  467
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCTGACCCTAAGAGTATTAGGACAGATGCAGCTGCTGCAGTTCCCAA  498

seq1  GAATGAGGTGCAGGTGGTTAAGGAGGCTCTCACATCAGGCCCACCAGCAC  517
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGAGGTGCAGGTGGTTAAGGAGGCTCTCACATCAGGCCCACCAGCAC  548

seq1  TACCCACAGCTCTTTCCTCTTAACATCCCAGTTTTCCCCACTTGAAAACT  567
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCACAGCTCTTTCCTCTTAACATCCCAGTTTTCCCCACTTGAAAACT  598

seq1  AAGCCAGAGCTGCCCACAAATGCCTACCCAGCTGGAGCCCTGCAATGGTG  617
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCAGAGCTGCCCACAAATGCCTACCCAGCTGGAGCCCTGCAATGGTG  648

seq1  TGGCACGCGAGCGCGCGAGCGCGCAGGTCAGTGCCAGTTGGTCTGACTTG  667
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCACGCGAGCGCGCGAGCGCGCAGGTCAGTGCCAGTTGGTCTGACTTG  698

seq1  GTGGCTGCTGCTGGGATCAGGAACCCAAGACTTTCCTGGGTGGAGTGCAG  717
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCTGCTGCTGGGATCAGGAACCCAAGACTTTCCTGGGTGGAGTGCAG  748

seq1  CCCGCTTTCCCTGCCCATTCCCTCAGCGAACTGCTGACAGTGGCAAAGCC  767
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCGCTTTCCCTGCCCATTCCCTCAGCGAACTGCTGACAGTGGCAAAGCC  798

seq1  ACGTTGCCATGCTTGGAGGGAGGGGGCAGTAAGACGGGACGGGACGGGAC  817
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTTGCCATGCTTGGAGGGAGGGGGCAGTAAGACGGGACGGGACGGGAC  848

seq1  ATAACTCTCTTTGCTTTGATCTTAATGGGAAAAAAAAGTTTGGGTTTGAT  867
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAACTCTCTTTGCTTTGATCTTAATGGGAAAAAAAAGTTTGGGTTTGAT  898

seq1  TTCGCCTGGAGCTTGCTGAGAGTTCCTGACTGGGCTTGGCCTTGCACGGG  917
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGCCTGGAGCTTGCTGAGAGTTCCTGACTGGGCTTGGCCTTGCACGGG  948

seq1  GAGGGAGAATCGGGGGTCTTTAGGACCCGGGTGCACTCGGACCAGCGGTG  967
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGAGAATCGGGGGTCTTTAGGACCCGGGTGCACTCGGACCAGCGGTG  998

seq1  CCGGGAGGCCGACCTGCCGCGGCTTGAATGGGAGGCGGGCGGCGGCGCCG  1017
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGGAGGCCGACCTGCCGCGGCTTGAATGGGAGGCGGGCGGCGGCGCCG  1048

seq1  AGAGGCTGGCGGCGGACTAGCTCTACGGTCGCCAGGCAACCGCCCTGACG  1067
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGCTGGCGGCGGACTAGCTCTACGGTCGCCAGGCAACCGCCCTGACG  1098

seq1  CAACGCAAAAGAACGTCCCTTCAAAAAAGAACGGTGCGGAGAATTC  1113
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACGCAAAAGAACGTCCCTTCAAAAAAGAACGGTGCGGAGAATTC  1144

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information