MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-227F07
Chromosome	14 (Build37)
Map Location	42,041,246 - 42,042,428
singlet/doublet	singlet
Overlap gene	LOC666093
Upstream gene	LOC218945, LOC100040470, LOC382876, Sh2d4b, Tspan14, 5730469M10Rik, Dydc2, EG622782, Dydc1, Mat1a, Sftpa1, LOC100040498, LOC666079, Mbl1, Sftpd
Downstream gene	EG666099, LOC100040545, LOC676294, LOC545034, LOC100040587, EG666138, EG624191, EG666149, LOC666155, EG666156, LOC100040642, LOC100041729, LOC624277, LOC100041810, EG666186, LOC100041722, LOC100041841, EG666207, LOC666214, LOC632737, EG623168, LOC100041849, 1700016D02Rik, LOC100040726, LOC666228, LOC666233, LOC100041930, EG666152, EG385234, LOC100041950, LOC100041910, LOC674032, EG666239, LOC100040759, LOC100040771, EG666253
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC218945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:218945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100040470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC382876 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	Sh2d4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:328381 MGI:1925182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tspan14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52588 MGI:1196325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730469M10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70564 MGI:1917814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dydc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71200 MGI:1918450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622782 MGI:3646391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs

name	Dydc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69496 MGI:1916746
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins

name	Mat1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11720 MGI:88017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sftpa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20387 MGI:109518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040498 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Mbl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17194 MGI:96923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sftpd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20390 MGI:109515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666099 MGI:3646066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC676294 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC545034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 11 Proteins pseudo : _no_value

name	LOC100040587 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040587
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666138 MGI:3646596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	EG624191 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624191 MGI:3644578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	EG666149 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666149 MGI:3642973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC666155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG666156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666156 MGI:3648778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins

name	LOC100040642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins

name	LOC624277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100041810 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	EG666186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666186 MGI:3644387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC100041722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins pseudo : _no_value

name	LOC100041841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	EG666207 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666207 MGI:3647449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein

name	LOC666214 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins pseudo : _no_value

name	LOC632737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG623168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623168 MGI:3645739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041849 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins

name	1700016D02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75535 MGI:1922785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100040726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040726
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein pseudo : _no_value

name	LOC666228 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC666233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein pseudo : _no_value

name	LOC100041930 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG666152 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666152 MGI:3648771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG385234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385234 MGI:3645898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC100041950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC100041910 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins

name	LOC674032 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	EG666239 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666239 MGI:3643149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100040759 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein pseudo : _no_value

name	LOC100040771 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG666253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666253 MGI:3645411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Sh2d4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58866051 GeneID:328381 MGI:1925182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2 domain containing 4B transcript_id : NM_177816.3

name	Tspan14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122344 GeneID:52588 MGI:1196325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 14 transcript_id : NM_145928.1

name	5730469M10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387361 GeneID:70564 MGI:1917814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730469M10 gene transcript_id : NM_027464.2

name	Dydc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931159 GeneID:71200 MGI:1918450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DPY30 domain containing 2 transcript_id : NM_027717.1

name	EG622782 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265480 GeneID:622782 MGI:3646391
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 61 ESTs product : predicted gene, EG622782, transcript variant 1 transcript_id : XM_891420.3

name	Dydc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396917 GeneID:69496 MGI:1916746
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : DPY30 domain containing 1 transcript_id : XM_127632.5

name	Mat1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130982 GeneID:11720 MGI:88017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methionine adenosyltransferase I, alpha transcript_id : NM_133653.2

name	Sftpa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560851 GeneID:20387 MGI:109518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfactant associated protein A1 transcript_id : NM_023134.3

name	LOC100040498 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265390 GeneID:100040498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : hypothetical protein LOC100040498 transcript_id : XM_001474821.1

name	Mbl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130139 GeneID:17194 MGI:96923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose binding lectin (A) transcript_id : NM_010775.2

name	Sftpd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677920 GeneID:20390 MGI:109515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : surfactant associated protein D transcript_id : NM_009160.1

name	EG666099 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396919 GeneID:666099 MGI:3646066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG666099 transcript_id : XM_981618.1

name	EG666138 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265392 GeneID:666138 MGI:3646596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666138 transcript_id : XM_981856.2

name	EG624191 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396926 GeneID:624191 MGI:3644578
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG624191 transcript_id : XM_888715.2

name	EG666149 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265497 GeneID:666149 MGI:3642973
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG666149 transcript_id : XM_981943.2

name	EG666156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265394 GeneID:666156 MGI:3648778
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 5 Proteins product : predicted gene, EG666156 transcript_id : XM_982027.2

name	LOC100041729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265491 GeneID:100041729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins product : hypothetical protein LOC100041729 transcript_id : XM_001477654.1

name	LOC100041810 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265499 GeneID:100041810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : hypothetical protein LOC100041810 transcript_id : XM_001477696.1

name	EG666186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396935 GeneID:666186 MGI:3644387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666186 transcript_id : XM_982176.1

name	LOC100041841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265503 GeneID:100041841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100041841, transcript variant 1 transcript_id : XM_001477713.1

name	LOC100041841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265505 GeneID:100041841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100041841, transcript variant 2 transcript_id : XM_001477723.1

name	EG666207 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396937 GeneID:666207 MGI:3647449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG666207 transcript_id : XM_982314.1

name	LOC632737 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265396 GeneID:632737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to CDNA sequence BC061237 transcript_id : XM_001475077.1

name	EG623168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396921 GeneID:623168 MGI:3645739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG623168 transcript_id : XM_891604.2

name	LOC100041849 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265507 GeneID:100041849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins product : hypothetical protein LOC100041849 transcript_id : XM_001477735.1

name	1700016D02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396940 GeneID:75535 MGI:1922785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 1700016D02 gene transcript_id : XM_982411.1

name	LOC100041930 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265517 GeneID:100041930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to Predicted gene, EG545047 transcript_id : XM_001477840.1

name	EG666152 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396929 GeneID:666152 MGI:3648771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG666152 transcript_id : XM_988677.1

name	LOC100041950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265520 GeneID:100041950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041950 transcript_id : XM_001477872.1

name	LOC100041910 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265512 GeneID:100041910
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 13 ESTs, 4 Proteins product : hypothetical protein LOC100041910 transcript_id : XM_001477788.1

name	LOC674032 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149265515 GeneID:674032
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to CDNA sequence BC061237 transcript_id : XM_001477825.1

name	EG666239 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94396942 GeneID:666239 MGI:3643149
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG666239 transcript_id : XM_982515.1

name	EG666253 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149265398 GeneID:666253 MGI:3645411
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : predicted gene, EG666253 transcript_id : XM_982603.2

name	Sh2d4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58866052 CCDS:CCDS26955.1 GeneID:328381 MGI:1925182
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : SH2 domain containing 4B protein_id : NP_808484.2

name	Tspan14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122345 CCDS:CCDS26956.1 GeneID:52588 MGI:1196325
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 14 product : tetraspanin 14 protein_id : NP_666040.1

name	5730469M10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229101 CCDS:CCDS26957.1 GeneID:70564 MGI:1917814
definition	codon_start : 1 product : hypothetical protein LOC70564 protein_id : NP_081740.2

name	Dydc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931160 CCDS:CCDS26958.1 GeneID:71200 MGI:1918450
definition	codon_start : 1 product : DPY30 domain containing 2 protein_id : NP_081993.1

name	EG622782 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82953830 GeneID:622782 MGI:3646391
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_896513.1

name	Dydc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265481 GeneID:69496 MGI:1916746
definition	codon_start : 1 product : DPY30 domain containing 1 protein_id : XP_127632.5

name	Mat1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526790 CCDS:CCDS26959.1 GeneID:11720 MGI:88017
definition	GO_function : GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004478 - methionine adenosyltransferase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : S-adenosylmethionine synthetase product : methionine adenosyltransferase I, alpha protein_id : NP_598414.1

name	Sftpa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543691 CCDS:CCDS26960.1 GeneID:20387 MGI:109518
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006817 - phosphate transport [Evidence IEA]; GO:0050828 - regulation of liquid surface tension [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IEA] codon_start : 1 note : surfactant pulmonary associated protein A1 product : surfactant associated protein A1 protein_id : NP_075623.2

name	LOC100040498 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265391 GeneID:100040498
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474871.1

name	Mbl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754654 CCDS:CCDS26961.1 GeneID:17194 MGI:96923
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006958 - complement activation, classical pathway [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : mannose binding lectin, serum (A) product : mannose binding lectin (A) protein_id : NP_034905.1

name	Sftpd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677921 CCDS:CCDS26962.1 GeneID:20390 MGI:109515
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0030139 - endocytic vesicle [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] GO_function : GO:0008367 - bacterial binding [Evidence ISS]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA] GO_process : GO:0048286 - alveolus development [Evidence ISS]; GO:0045087 - innate immune response [Evidence ISS]; GO:0048246 - macrophage chemotaxis [Evidence ISS]; GO:0045085 - negative regulation of interleukin-2 biosynthesis [Evidence ISS]; GO:0042130 - negative regulation of T cell proliferation [Evidence ISS]; GO:0006800 - oxygen and reactive oxygen species metabolism [Evidence ISS]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0050766 - positive regulation of phagocytosis [Evidence ISS]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0001817 - regulation of cytokine production [Evidence ISS]; GO:0050828 - regulation of liquid surface tension [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IEA]; GO:0043129 - surfactant homeostasis [Evidence ISS] codon_start : 1 product : surfactant associated protein D protein_id : NP_033186.1

name	EG666099 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396920 GeneID:666099 MGI:3646066
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_986712.1

name	EG666138 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265393 GeneID:666138 MGI:3646596
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986950.2

name	EG624191 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82953908 GeneID:624191 MGI:3644578
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893808.1

name	EG666149 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265498 GeneID:666149 MGI:3642973
definition	codon_start : 1 product : similar to cyclin-dependent kinase protein_id : XP_987037.2

name	EG666156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265395 GeneID:666156 MGI:3648778
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_987121.2

name	LOC100041729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265492 GeneID:100041729
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477704.1

name	LOC100041810 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265500 GeneID:100041810
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477746.1

name	EG666186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396936 GeneID:666186 MGI:3644387
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987270.1

name	LOC100041841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265504 GeneID:100041841
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001477763.1

name	LOC100041841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265506 GeneID:100041841
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001477773.1

name	EG666207 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396938 GeneID:666207 MGI:3647449
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987408.1

name	LOC632737 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265397 GeneID:632737
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001475127.1

name	EG623168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396922 GeneID:623168 MGI:3645739
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_896697.2

name	LOC100041849 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265508 GeneID:100041849
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477785.1

name	1700016D02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396941 GeneID:75535 MGI:1922785
definition	codon_start : 1 product : hypothetical protein LOC75535 protein_id : XP_987505.1

name	LOC100041930 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265518 GeneID:100041930
definition	codon_start : 1 product : similar to Predicted gene, EG545047 protein_id : XP_001477890.1

name	EG666152 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396930 GeneID:666152 MGI:3648771
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_993771.1

name	LOC100041950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265521 GeneID:100041950
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477922.1

name	LOC100041910 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265513 GeneID:100041910
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477838.1

name	LOC674032 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149265516 GeneID:674032
definition	codon_start : 1 product : similar to CDNA sequence BC061237 protein_id : XP_001477875.1

name	EG666239 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94396943 GeneID:666239 MGI:3643149
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987609.1

name	EG666253 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149265399 GeneID:666253 MGI:3645411
definition	codon_start : 1 product : hypothetical protein protein_id : XP_987697.2

name	LOC218945 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:218945
definition	number : 1 pseudo : _no_value

name	LOC100040470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040470
definition	number : 1 pseudo : _no_value

name	LOC100040470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040470
definition	number : 2 pseudo : _no_value

name	LOC100040470 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040470
definition	number : 3 pseudo : _no_value

name	LOC382876 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382876
definition	number : 1 pseudo : _no_value

name	LOC666079 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666079
definition	number : 1 pseudo : _no_value

name	LOC666093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666093
definition	number : 6 pseudo : _no_value

name	LOC666093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666093
definition	number : 5 pseudo : _no_value

name	LOC666093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666093
definition	number : 4 pseudo : _no_value

name	LOC666093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666093
definition	number : 3 pseudo : _no_value

name	LOC666093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666093
definition	number : 2 pseudo : _no_value

name	LOC666093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666093
definition	number : 1 pseudo : _no_value

name	LOC100040545 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040545
definition	number : 1 pseudo : _no_value

name	LOC100040545 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040545
definition	number : 2 pseudo : _no_value

name	LOC100040545 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040545
definition	number : 3 pseudo : _no_value

name	LOC100040545 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040545
definition	number : 4 pseudo : _no_value

name	LOC100040545 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040545
definition	number : 5 pseudo : _no_value

name	LOC100040545 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040545
definition	number : 6 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 7 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 6 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 5 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 4 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 3 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 2 pseudo : _no_value

name	LOC676294 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676294
definition	number : 1 pseudo : _no_value

name	LOC100040587 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040587
definition	number : 5 pseudo : _no_value

name	LOC100040587 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040587
definition	number : 4 pseudo : _no_value

name	LOC100040587 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040587
definition	number : 3 pseudo : _no_value

name	LOC100040587 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040587
definition	number : 2 pseudo : _no_value

name	LOC100040587 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040587
definition	number : 1 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 5 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 4 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 3 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 2 pseudo : _no_value

name	LOC666155 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666155
definition	number : 1 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 4 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 3 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 2 pseudo : _no_value

name	LOC100040642 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040642
definition	number : 1 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 1 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 2 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 3 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 4 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 5 pseudo : _no_value

name	LOC624277 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624277
definition	number : 6 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 6 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 5 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 4 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 3 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 2 pseudo : _no_value

name	LOC100040726 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040726
definition	number : 1 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 1 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 2 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 3 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 4 pseudo : _no_value

name	LOC666228 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666228
definition	number : 5 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 6 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 5 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 4 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 3 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 2 pseudo : _no_value

name	LOC100040759 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040759
definition	number : 1 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 1 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 2 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 3 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 4 pseudo : _no_value

name	LOC100040771 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040771
definition	number : 5 pseudo : _no_value

name	LOC545034 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265486 GeneID:545034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 11 Proteins product : hypothetical LOC545034 pseudo : _no_value transcript_id : XR_033318.1

name	LOC100041722 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265488 GeneID:100041722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins product : hypothetical protein LOC100041722 pseudo : _no_value transcript_id : XR_033330.1

name	LOC666214 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94396939 GeneID:666214
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 10 Proteins product : hypothetical LOC666214 pseudo : _no_value transcript_id : XR_001846.1

name	LOC666233 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149265511 GeneID:666233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 8 ESTs, 1 Protein product : similar to Predicted gene, EG434459 pseudo : _no_value transcript_id : XR_035685.1

name	EG385234 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149265519 GeneID:385234 MGI:3645898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG385234 transcript_id : XR_035340.1

clone name	MSMg01-368G21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-301B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-180D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458O21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-213K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296H01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-227F07.b	B6Ng01-227F07.g
ACC	GA041028	GA041029
length	1,218	1,166
definition	B6Ng01-227F07.b	B6Ng01-227F07.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcctttgtgaatgtgttacctcactcaggatgatgccctccaggtc catccatttggctaggaatttcataaattcattctttttaatagctgagt agtactccattgtgtagatgtaccacattttctgtatccattcctctgtt gaggggcatctgggttctttccagcttctggctattataaataaggctgc tatgaacatagtggagcatgtgtccttcttaccagttggggcatcttctg gataaatgccgaggagaggtattgctggatcctctggtagtactatgtcc aattttctgaggaaccgccagactgatttccagagtggttgtacaagcct gcaatcccaccaacaatggaggagtgttcctctttctccacatccacgcc agcatctgctgtcacctgaatttttgatcttagccattctgactggtgtg aggtggaatctcagggttgttttgatttgcatttccctgatgattaagaa tgttgaacattttttcaggtgcttctctgccattcggtattcctcaggtg agaattctttgttcagttctgagccccattttttaatggggttgttcgat tttctgaagtccaccttcttgagttctttatatatgttggatattagccc cctatctgatttaggataggtaaagatcctttcccaatctgttggtggtc tttttgtcttattgacggtgtcttttgccttgcagaaactttggagtttc attaggtcccatttgtcaattctcgatcttacagcacatgccattgctgt tctgttcaggaatttttcccctgtgcccatatcttcaaggcttttcccca ctttctcctctataagtttcagtgtctctggttttatgtgaagttctttg atccacttagatttgaccttagtaacaaggagataagtatggatcgattc gcattctttctacatgaataacaaccagttgtgccagcaccaattgttga aaatgctgtctttcttccacctggatggttttagctccctgtcgaagatc agtgaccatagtgtgtgggctcattctggttctcaattctattccattgg tctactggtcgtctcctatacagtacaatgccagattcaatcacagttgc ttgagtagcttaaggtcagccatggggtatccacctgaagtatcccttac tcctcgtgatcagagagt	gaattccatgggcctatgttaagaagtctggggacagggacccatgaaat tctggatatccagacagtgctgggttgcagggagttcacagcaggtttga gcctgctggcctgcaaggagaccagggcaaggggttctcagaatcttgga catgcaggcacttacagaagtctcagagggagctgagcacggaggaggcc agcaggctgagaactagccctgaaatcagggaatggggaattctggatta gctcagaggtgactagcccaggagtattgaggggccttctgttggagact tagatggcaaggctctgtaggcaaaggctttttctccatgtaacccacag ttggtttgatgagagagacagtccttggttctaaactgtttattgattgt ttttcatggaaatgaaagcataacatgtcttgaggttagactagaagtta agtaccttctgaggaaggaatgtccaggaagagaagcttattgactgaac cctaacatcttctaggtacctcattagcagcgagaaccctattctgttct aaatgaccacaggcaatgttcctatgtagagattttggtcccatgaaaga ggcatggtaggaagcaggttagacttttgccatctactgtgggtctggga cttccaacccactcaactttaccaaattctggacatggtagtctactgtc ccaggtcttagtctgagatttattgatgtgaggagacaccaagacatatg tttagtatgtgagtctcaaagccaaccttccacactgacacactgtttct aacaaggccacaactcctaaaagtaccacccccatattcaagccaccaca ctcctatgcaatctcccaagacatctacctcactctgtcctactgttttc ctttttctccttcacaaattatgtgttctattattttcttgaaatatcct cctataacccaacactagtgcataccttctatggatactgcagtttaaat gcacatctctagaacatcatgtaccatccacaatagaccacatgatgtgt atttgtcttttttgggtgtgggttatatcacctcagaaagatatcatgta tccatcataactgtggtcattaatttgtccagtccatacatggtatgaac cataattccattaccc
quality values	Open. Hide. 62 47 34 31 62 62 62 62 62 62 62 62 62 54 51 44 47 38 47 62 59 62 59 62 62 59 59 59 62 59 59 62 62 59 49 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 59 46 62 62 54 33 62 62 62 62 62 62 59 59 62 62 59 62 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 47 58 58 58 58 40 58 54 42 58 58 58 58 58 58 58 58 54 49 54 58 58 54 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 52 58 54 58 58 49 54 54 58 58 58 58 54 58 54 51 58 58 58 51 58 49 58 58 50 58 58 51 53 49 58 58 58 58 58 58 58 58 54 58 58 51 51 58 51 49 49 50 51 51 51 53 53 58 58 58 49 32 53 39 49 58 53 58 58 58 58 58 54 58 51 58 51 54 58 29 58 50 52 37 54 46 37 50 47 39 40 49 58 58 50 41 41 49 44 50 58 58 31 58 42 40 58 51 51 58 58 51 50 58 41 33 58 58 41 53 52 58 58 58 51 54 40 51 51 45 37 30 53 54 53 45 41 54 40 51 34 47 50 54 54 54 50 38 50 50 44 47 49 45 32 54 54 24 37 51 54 37 53 45 53 32 53 54 54 42 37 52 44 37 31 54 32 33 54 51 37 51 54 51 53 40 40 40 30 40 54 39 40 52 37 45 37 37 48 34 31 45 40 40 45 31 32 32 53 32 40 32 30 46 35 34 32 37 53 32 18 25 29 52 31 42 32 31 12 47 39 40 31 53 51 51 14 16 46 46 31 28 41 31 31 28 46 32 30 31 33 31 37 51 19 31 13 30 31 48 30 31 51 51 51 28 51 46 31 29 31 40 46 31 32 32 31 35 25 31 21 31 31 34 43 28 41 47 24 31 32 31 21 38 25 32 33 38 32 42 21 8 48 48 32 31 27 32 31 32 38 38 15 29 31 18 14 48 25 25 20 26 16 41 23 32 33 36 31 13 16 7 47 30 31 31 18 28 27 38 29 9 23 26 6 5 10 24 8 31 27 23 29 11 28 19 13 33 33 31 36 26 32 33 28 27 42 42 21 32 27 32 34 21 25 10 6 41 13 30 6 11 17 23 23 31 23 5 4 8 25 32 10 24 18 26 29 19 19 17 29 19 20 20 31 18 19 29 17 16 19 10 13 26 10 14 6 19 22 32 48 48 33 13 32 21 34 31 8 19 22 48 23 14 24 17 34 16 7 4 7 8 10 22 6 9 13 22 6 34 27 9 22 20 26 25 16 32 15 3 6 9 25 8 38 28 12 28 10 28 27 10 11 20 29 14 20 27 19 7 6 3 5 8 22 13 7 47 4 3 3 4 6 31 23 12 5 3 4 6 4 7 24 15 10 11 22 8 5 6 21 23 10 10 13 12 9 9 11 17 6 6 6 11 12 11 8 5 1 3 4 3 3 6 6 5 11 16 5 7 24 15 13 12 5 8 6 16 4 6 4 5 8 2 1 3 12 4 5 8 18 6 6 9 7 3 8 7 6 6 4 2 2 3 3 5 18 7 5 7 11 3 5 7 14 8 13 5 24 5 5 12 6 12 4 4 11 8 11 7 6 7 7 5 25 5 9 21 16 2 1 1 5 6 6 7 3 2 1 1 1 2 10 5 18 5 12 15 6 1 3 2 5 8 4 7 7 5	Open. Hide. 62 49 42 47 62 62 59 43 62 62 62 62 62 62 62 56 62 62 54 54 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 59 62 62 59 62 59 59 62 54 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 56 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 39 49 46 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 54 53 58 53 58 58 58 58 58 54 58 58 58 52 47 47 58 58 58 58 58 54 58 52 54 42 58 58 58 58 49 48 54 58 58 46 58 58 58 58 58 48 58 41 58 50 50 51 58 58 54 58 54 58 58 54 52 54 53 41 51 46 51 51 52 58 42 49 58 58 58 54 50 37 32 54 53 53 52 49 54 58 50 58 58 51 50 50 44 58 58 58 46 28 58 50 50 49 39 51 58 58 51 52 51 58 52 54 44 50 51 58 40 50 50 50 41 58 52 50 51 51 52 58 54 49 40 40 50 51 58 52 58 41 38 53 50 39 39 49 54 53 45 54 52 31 42 54 52 42 46 54 45 37 52 53 53 50 51 29 37 29 49 40 42 49 52 51 45 53 51 42 53 49 35 54 53 35 33 42 31 44 46 23 52 42 32 45 37 44 37 42 53 31 54 35 36 52 45 37 40 53 37 35 51 29 37 37 53 33 24 54 35 29 51 27 11 53 43 53 40 25 27 33 31 45 32 32 32 35 33 34 27 41 31 32 31 53 34 49 27 32 25 29 42 31 30 28 13 40 8 32 24 31 34 35 40 33 32 51 31 30 51 46 42 35 33 35 28 29 24 31 41 41 36 25 24 31 24 30 25 31 28 30 30 31 33 24 25 14 26 31 31 30 27 19 30 30 32 31 31 34 26 32 31 31 43 31 46 25 23 32 34 42 23 32 35 43 33 31 26 26 36 31 31 35 37 31 32 42 31 28 19 17 31 35 24 31 25 46 46 33 27 31 31 48 48 46 23 22 27 25 21 22 31 26 12 22 26 44 36 37 31 26 22 31 25 25 19 13 38 21 38 36 18 28 31 48 48 29 33 22 16 24 21 48 31 25 31 32 38 22 25 26 35 15 10 9 11 30 18 47 28 18 15 17 9 6 13 32 11 6 32 21 21 43 11 17 9 18 8 24 13 25 18 19 19 7 14 24 32 24 34 24 28 9 24 33 11 14 43 21 14 28 19 10 13 8 22 20 16 11 7 6 6 5 14 11 7 19 5 17 8 10 8 5 16 21 14 28 23 18 8 8 7 6 7 29 13 21 9 7 5 13 6 7 14 20 16 28 14 3 3 3 6 34 5 22 11 21 13 38 38 47 23 7 18 28 23 8 10 8 20 25 17 7 5 7 6 3 7 17 7 5 4 10 15 10 8 12 17 4 5 11 5 3 3 3 8 5 7 6 4 10 4 17 4 3 2 4 16 4 9 13 3 6 2 1 1 5 2 4 19 15 5 6 4 6 6 10 5 21 5 6 6 3 4 8 6 23 8 15 1 2 2 3 1 5 14 13 10 14 16 8 16 7 4 7 22 7 7 9 6 6 8 5 7 29 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr14_42041246_42042428
seq2: B6Ng01-227F07.g_66_1231

seq1  GAATTCCATGGGCCTATGTTAAGGAGTCTGGGGACAGGGACCCATGAAAT  50
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  GAATTCCATGGGCCTATGTTAAGAAGTCTGGGGACAGGGACCCATGAAAT  50

seq1  TCTGGATATCCAGACAGTGCTGGGTTGCAGGGAGTTCACAGCAGGTTTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGATATCCAGACAGTGCTGGGTTGCAGGGAGTTCACAGCAGGTTTGA  100

seq1  GCCTGCTGGCCTGCAAGGAGACCAGGACAAGGGGTTCTCAGAATCTTGGA  150
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  GCCTGCTGGCCTGCAAGGAGACCAGGGCAAGGGGTTCTCAGAATCTTGGA  150

seq1  CATGCAGGCACTTACAGAAGTCTCAGAGGGAGCTGAGCATGGAGGAGGCC  200
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CATGCAGGCACTTACAGAAGTCTCAGAGGGAGCTGAGCACGGAGGAGGCC  200

seq1  AGCAGGCTGAGAACTAGCCCTGAAATCAGGGAATGGGGAATTCTGGATTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGCTGAGAACTAGCCCTGAAATCAGGGAATGGGGAATTCTGGATTA  250

seq1  GCTCAGAGGTGACTAGCCCAGGAGTATTGAGGGGCCTTCTCTTGGAGACT  300
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  GCTCAGAGGTGACTAGCCCAGGAGTATTGAGGGGCCTTCTGTTGGAGACT  300

seq1  TAGATGGCAAGGCTCTGTAGGCAAAGGCTTTTTCTCCATGTAACCCACAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATGGCAAGGCTCTGTAGGCAAAGGCTTTTTCTCCATGTAACCCACAG  350

seq1  TTGGTTTGATGAGAGAGACAGTCCTTGGTTCTAAACTGTTTATTGATTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTTTGATGAGAGAGACAGTCCTTGGTTCTAAACTGTTTATTGATTGT  400

seq1  TTTTCATGGAAATGAAAGCATAACATGTCTTGAGGTTAGACTAGAAGTTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCATGGAAATGAAAGCATAACATGTCTTGAGGTTAGACTAGAAGTTA  450

seq1  AGTACCTTCTGAGGAAGGAATGTCCAGGAAGAGAAGCTTATTGACTGAAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACCTTCTGAGGAAGGAATGTCCAGGAAGAGAAGCTTATTGACTGAAC  500

seq1  CCTAACATCTTCTAGGTACCTCATTAGCAGCGAGAACCCAATTCTGTTCT  550
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CCTAACATCTTCTAGGTACCTCATTAGCAGCGAGAACCCTATTCTGTTCT  550

seq1  AAATGACCACAGGCCATGTTCCTATGTAGAGATTTTGGTCCCATGAAAGA  600
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AAATGACCACAGGCAATGTTCCTATGTAGAGATTTTGGTCCCATGAAAGA  600

seq1  GGCCTGGTAGGAAGCAGGTTAGACTTTTGCCATCTACTGTGGGTCTGGGA  650
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGGTAGGAAGCAGGTTAGACTTTTGCCATCTACTGTGGGTCTGGGA  650

seq1  CTTCCAACCCACTCAACTTTACCAAATTCTGGACATGGTAGTCTACTGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCAACCCACTCAACTTTACCAAATTCTGGACATGGTAGTCTACTGTC  700

seq1  CCAGGTCTTAGTCTGAGTTTTATTGATGTGAGGAGACTCCAGGACATATG  750
      ||||||||||||||||| ||||||||||||||||||| ||| ||||||||
seq2  CCAGGTCTTAGTCTGAGATTTATTGATGTGAGGAGACACCAAGACATATG  750

seq1  TTTAGTATGCGGGTCTCAATGCCTACCCTCCACACTGACACACTGTTTCT  800
      ||||||||| | ||||||| ||| ||| ||||||||||||||||||||||
seq2  TTTAGTATGTGAGTCTCAAAGCCAACCTTCCACACTGACACACTGTTTCT  800

seq1  AACAAGGCCACAACTCCTAAAAGTACCACCCTTATATTCAAGCCACCACA  850
      |||||||||||||||||||||||||||||||  |||||||||||||||||
seq2  AACAAGGCCACAACTCCTAAAAGTACCACCCCCATATTCAAGCCACCACA  850

seq1  CTCCTATGCAATCTCCCAAGACATCTACCTCACTCTGTCCTACTGTTTTC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTATGCAATCTCCCAAGACATCTACCTCACTCTGTCCTACTGTTTTC  900

seq1  CTTTTTCTCCTTCACAAATTATGTGTTCTATTATTTTCTTGAAATATCCT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTCTCCTTCACAAATTATGTGTTCTATTATTTTCTTGAAATATCCT  950

seq1  CCTATAACCCAACACTAGTGCATTAACTTCTATGGATACTGCAGTTTAAA  1000
      |||||||||||||||||||||| || ||||||||||||||||||||||||
seq2  CCTATAACCCAACACTAGTGCA-TACCTTCTATGGATACTGCAGTTTAAA  999

seq1  TGCACATCTCTAGACATTCAATGTTACCATCCACATAAGA-CACATCATG  1049
      ||||||||||||||   || ||| |||||||||||  ||| ||||| |||
seq2  TGCACATCTCTAGAACATC-ATG-TACCATCCACAATAGACCACATGATG  1047

seq1  TGGTATTTGTC-TTTTTGGGTCTGGGTTATATCA-CTCAGAAAGATTATT  1097
      | ||||||||| ||||||||| |||||||||||| |||||||||||   |
seq2  T-GTATTTGTCTTTTTTGGGTGTGGGTTATATCACCTCAGAAAGAT--AT  1094

seq1  CATGTCTCCATCCATTAACCTGTAAATTTCATTTATATTGTCACAGTTCA  1147
      ||||| ||||| |||  | ||||     ||||| || ||||| |||| ||
seq2  CATGTATCCAT-CAT--AACTGT---GGTCATTAAT-TTGTC-CAGTCCA  1136

seq1  TTACCATTGTGTATATGAACCATATATTCATTACCC  1183
      |   ||| |    |||||||||||  | ||||||||
seq2  T--ACATGG----TATGAACCATAATTCCATTACCC  1166

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information